Starting /dee2/code/volunteer_pipeline.sh SRR7172660 current disk space = 3058230583296 free memory = 1504359308 SRR7172660 SRAfilesize 4b0516f17d9583715db2602020113e68 SRR7172660.sra SRR7172660.sra file validated SRR7172660 is paired end SRR7172660 is conventional basespace SRR7172660 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172660_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.4465 18.0 18.0 33.0 18.0 33.0 2 30.033 31.0 28.0 33.0 27.0 33.0 3 30.2775 31.0 29.0 33.0 27.0 33.0 4 31.387 32.0 32.0 33.0 28.0 33.0 5 32.66325 33.0 33.0 33.0 32.0 34.0 6 36.202 38.0 36.0 38.0 33.0 38.0 7 37.4065 38.0 38.0 38.0 37.0 38.0 8 37.56875 38.0 38.0 38.0 37.0 38.0 9 37.612 38.0 38.0 38.0 38.0 38.0 10-14 37.66025 38.0 38.0 38.0 38.0 38.0 15-19 37.65990000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.64495000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.64675 38.0 38.0 38.0 38.0 38.0 30-34 37.585950000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.565000000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.550599999999996 38.0 38.0 38.0 37.8 38.0 45-49 37.5241 38.0 38.0 38.0 37.6 38.0 50-54 37.49980000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.40335 38.0 38.0 38.0 37.0 38.0 60-64 37.38705 38.0 38.0 38.0 37.0 38.0 65-69 37.34405 38.0 38.0 38.0 37.0 38.0 70-74 37.318099999999994 38.0 38.0 38.0 36.6 38.0 75-79 37.244899999999994 38.0 38.0 38.0 36.2 38.0 80-84 37.2032 38.0 38.0 38.0 36.2 38.0 85-89 37.1074 38.0 38.0 38.0 36.0 38.0 90-94 37.0472 38.0 38.0 38.0 36.0 38.0 95-99 36.910900000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.8655 38.0 38.0 38.0 35.0 38.0 105-109 36.701750000000004 38.0 38.0 38.0 34.8 38.0 110-114 36.6437 38.0 38.0 38.0 34.4 38.0 115-119 36.49640000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.378499999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.10935 38.0 37.4 38.0 33.4 38.0 130-134 35.928 38.0 36.8 38.0 32.8 38.0 135-139 35.65705 38.0 36.4 38.0 32.0 38.0 140-144 35.38755 38.0 36.0 38.0 30.6 38.0 145-149 34.79965 38.0 35.6 38.0 29.4 38.0 150-151 31.711624999999998 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 4.0 21 1.0 22 3.0 23 5.0 24 4.0 25 4.0 26 9.0 27 13.0 28 22.0 29 19.0 30 30.0 31 50.0 32 51.0 33 70.0 34 129.0 35 222.0 36 676.0 37 2684.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.32156436719175 13.498098859315588 13.335143943508962 34.84519282998371 2 19.759879939969984 19.93496748374187 38.0440220110055 22.26113056528264 3 19.675 26.025 27.325 26.974999999999998 4 22.825 34.050000000000004 21.175 21.95 5 20.875 37.574999999999996 23.5 18.05 6 18.15 35.625 25.074999999999996 21.15 7 13.075000000000001 21.675 43.6 21.65 8 17.625 23.775 29.799999999999997 28.799999999999997 9 17.875 22.725 32.65 26.75 10-14 19.634999999999998 29.92 26.825 23.62 15-19 19.605 28.410000000000004 28.655 23.330000000000002 20-24 20.14 28.13 27.985 23.745 25-29 19.695 28.585 28.294999999999998 23.425 30-34 19.835 28.32 28.175 23.669999999999998 35-39 20.015 28.375 27.810000000000002 23.799999999999997 40-44 20.18 28.42 28.084999999999997 23.315 45-49 20.155 28.389999999999997 27.700000000000003 23.755000000000003 50-54 20.09 28.655 27.51 23.745 55-59 20.09 28.285 27.785 23.84 60-64 20.84 28.075 27.51 23.575 65-69 19.64 28.315 28.084999999999997 23.96 70-74 19.955000000000002 28.125 28.244999999999997 23.674999999999997 75-79 20.335 27.505000000000003 27.955000000000002 24.205 80-84 20.16 28.205000000000002 27.665 23.97 85-89 20.155 28.09 28.325 23.43 90-94 20.82 27.3 28.205000000000002 23.674999999999997 95-99 20.175 27.93 28.310000000000002 23.585 100-104 20.255000000000003 27.91 28.144999999999996 23.69 105-109 20.395 27.58 28.299999999999997 23.724999999999998 110-114 20.599999999999998 28.33 27.900000000000002 23.169999999999998 115-119 20.36 28.360000000000003 27.345000000000002 23.935000000000002 120-124 20.07 27.605 28.410000000000004 23.915 125-129 20.599999999999998 27.63 27.860000000000003 23.91 130-134 20.855 27.634999999999998 27.905 23.605 135-139 20.93 28.144999999999996 27.625 23.3 140-144 20.605 27.584999999999997 28.08 23.73 145-149 20.48 28.205000000000002 27.72 23.595 150-151 20.275000000000002 28.7 27.150000000000002 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 3.0 26 5.0 27 8.0 28 9.5 29 12.5 30 19.0 31 23.5 32 28.5 33 36.0 34 48.0 35 72.0 36 96.0 37 106.5 38 128.0 39 164.5 40 206.5 41 237.5 42 259.0 43 278.0 44 289.0 45 288.5 46 263.5 47 246.5 48 229.0 49 189.5 50 158.5 51 139.5 52 107.0 53 78.5 54 60.5 55 45.0 56 38.0 57 29.5 58 27.5 59 23.0 60 13.0 61 6.5 62 6.0 63 5.0 64 2.5 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.95 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.9624999999999999 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.7375 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.2625 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCGAA 10 0.00518638 158.79453 1 >>END_MODULE SRR7172660 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172660_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23725 33.0 33.0 34.0 33.0 34.0 2 33.3115 34.0 33.0 34.0 33.0 34.0 3 33.37075 34.0 33.0 34.0 33.0 34.0 4 33.335 34.0 33.0 34.0 33.0 34.0 5 33.33925 34.0 33.0 34.0 33.0 34.0 6 37.55725 38.0 38.0 38.0 38.0 38.0 7 37.562 38.0 38.0 38.0 38.0 38.0 8 37.5445 38.0 38.0 38.0 38.0 38.0 9 37.45775 38.0 38.0 38.0 38.0 38.0 10-14 37.45865 38.0 38.0 38.0 38.0 38.0 15-19 37.44595 38.0 38.0 38.0 38.0 38.0 20-24 37.47865 38.0 38.0 38.0 38.0 38.0 25-29 37.45345 38.0 38.0 38.0 38.0 38.0 30-34 37.436400000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.395799999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.38995 38.0 38.0 38.0 37.8 38.0 45-49 37.31269999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.3052 38.0 38.0 38.0 37.0 38.0 55-59 37.1936 38.0 38.0 38.0 37.0 38.0 60-64 37.1302 38.0 38.0 38.0 36.8 38.0 65-69 37.17315000000001 38.0 38.0 38.0 36.6 38.0 70-74 37.1259 38.0 38.0 38.0 36.2 38.0 75-79 37.10744999999999 38.0 38.0 38.0 36.4 38.0 80-84 37.00705 38.0 38.0 38.0 36.0 38.0 85-89 36.947849999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.851600000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.744749999999996 38.0 38.0 38.0 35.2 38.0 100-104 36.6559 38.0 38.0 38.0 34.8 38.0 105-109 36.480000000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.3568 38.0 38.0 38.0 34.0 38.0 115-119 36.196 38.0 38.0 38.0 33.8 38.0 120-124 36.005050000000004 38.0 38.0 38.0 33.6 38.0 125-129 35.7078 38.0 37.0 38.0 32.2 38.0 130-134 35.49634999999999 38.0 36.8 38.0 31.8 38.0 135-139 35.102799999999995 38.0 36.0 38.0 29.2 38.0 140-144 34.7408 38.0 35.8 38.0 27.6 38.0 145-149 34.083999999999996 38.0 35.0 38.0 24.8 38.0 150-151 30.715 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 6.0 16 6.0 17 3.0 18 4.0 19 3.0 20 2.0 21 4.0 22 2.0 23 6.0 24 12.0 25 16.0 26 11.0 27 16.0 28 20.0 29 23.0 30 31.0 31 53.0 32 54.0 33 71.0 34 110.0 35 195.0 36 504.0 37 2837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.800000000000004 15.825 17.075000000000003 28.299999999999997 2 25.1 22.400000000000002 34.625 17.875 3 20.875 26.974999999999998 30.2 21.95 4 24.125 34.525 22.3 19.05 5 23.25 37.974999999999994 21.6 17.175 6 19.5 38.025 22.900000000000002 19.575 7 19.075 16.825000000000003 43.6 20.5 8 20.5 22.625 27.325 29.549999999999997 9 22.85 24.5 28.299999999999997 24.349999999999998 10-14 22.79 28.34 26.889999999999997 21.98 15-19 23.305 27.925 28.005000000000003 20.765 20-24 22.965 28.084999999999997 28.044999999999998 20.905 25-29 22.509999999999998 28.335 27.93 21.224999999999998 30-34 22.25 28.215 28.105000000000004 21.43 35-39 22.52 28.095 28.299999999999997 21.085 40-44 23.025000000000002 27.750000000000004 27.495000000000005 21.73 45-49 22.830000000000002 28.310000000000002 27.889999999999997 20.97 50-54 23.015 28.26 27.615000000000002 21.11 55-59 23.645 28.155 27.560000000000002 20.64 60-64 23.455000000000002 28.005000000000003 27.805000000000003 20.735 65-69 23.78 27.860000000000003 27.939999999999998 20.419999999999998 70-74 24.15 28.065 27.52 20.265 75-79 23.35 28.03 27.775 20.845 80-84 24.14 28.075 27.339999999999996 20.445 85-89 23.25 27.91 27.775 21.065 90-94 23.805 28.4 27.355 20.44 95-99 23.615 27.52 27.715 21.15 100-104 23.995 27.944999999999997 27.894999999999996 20.165 105-109 23.785 28.215 27.685 20.315 110-114 23.630000000000003 27.495000000000005 27.955000000000002 20.919999999999998 115-119 23.75 27.97 28.025 20.255000000000003 120-124 23.985 28.189999999999998 27.43 20.395 125-129 23.645 28.325 27.584999999999997 20.445 130-134 23.525 28.365000000000002 27.735 20.375 135-139 24.115000000000002 28.084999999999997 27.305 20.495 140-144 23.74 28.349999999999998 27.395000000000003 20.515 145-149 24.525 28.494999999999997 26.979999999999997 20.0 150-151 24.3125 27.962500000000002 27.712500000000002 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 1.0 25 2.5 26 2.5 27 2.0 28 4.0 29 5.5 30 10.5 31 15.5 32 18.0 33 22.0 34 39.0 35 59.0 36 73.5 37 94.0 38 133.5 39 173.0 40 198.0 41 223.5 42 255.0 43 287.0 44 301.5 45 291.0 46 275.0 47 265.0 48 245.5 49 221.0 50 183.5 51 142.0 52 114.0 53 89.5 54 67.0 55 52.0 56 36.5 57 21.0 58 17.0 59 14.5 60 10.5 61 8.5 62 6.0 63 5.5 64 3.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.1125 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 3.2125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGAAG 10 0.006830828 145.0 5 TTTTTTT 35 0.0035366106 20.714287 1 >>END_MODULE Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864363 spots for SRR7172660.sra Written 864363 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra Read 864355 spots for SRR7172660.sra Written 864355 spots for SRR7172660.sra SRR ids: ['SRR7172660.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3zcrphs SRR7172660.sra spots: 17287108 blocks: [[1, 864355], [864356, 1728710], [1728711, 2593065], [2593066, 3457420], [3457421, 4321775], [4321776, 5186130], [5186131, 6050485], [6050486, 6914840], [6914841, 7779195], [7779196, 8643550], [8643551, 9507905], [9507906, 10372260], [10372261, 11236615], [11236616, 12100970], [12100971, 12965325], [12965326, 13829680], [13829681, 14694035], [14694036, 15558390], [15558391, 16422745], [16422746, 17287108]] SRR7172660 file size 5836333 SRR7172660 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172660 SRR7172660_1.fastq SRR7172660_2.fastq Input file: SRR7172660_1.fastq Paired file: SRR7172660_2.fastq trimmed: SRR7172660-trimmed-pair1.fastq, SRR7172660-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:01:31 2025 >> started Mon Feb 10 17:01:48 2025 >> done (17.301s) 17287108 read pairs processed; of these: 11232 ( 0.06%) short read pairs filtered out after trimming by size control 8811 ( 0.05%) empty read pairs filtered out after trimming by size control 17267065 (99.88%) read pairs available; of these: 7432076 (43.04%) trimmed read pairs available after processing 9834989 (56.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 3 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 4 0.00% 35 4 0.00% 36 5 0.00% 37 5 0.00% 38 3 0.00% 39 3 0.00% 40 7 0.00% 41 2 0.00% 42 11 0.00% 43 7 0.00% 44 2 0.00% 45 7 0.00% 46 9 0.00% 47 7 0.00% 48 5 0.00% 49 11 0.00% 50 18 0.00% 51 8 0.00% 52 18 0.00% 53 13 0.00% 54 13 0.00% 55 23 0.00% 56 19 0.00% 57 20 0.00% 58 32 0.00% 59 23 0.00% 60 37 0.00% 61 38 0.00% 62 56 0.00% 63 52 0.00% 64 64 0.00% 65 72 0.00% 66 84 0.00% 67 97 0.00% 68 87 0.00% 69 126 0.00% 70 151 0.00% 71 154 0.00% 72 193 0.00% 73 188 0.00% 74 233 0.00% 75 281 0.00% 76 354 0.00% 77 406 0.00% 78 371 0.00% 79 440 0.00% 80 545 0.00% 81 540 0.00% 82 707 0.00% 83 829 0.00% 84 1328 0.01% 85 1916 0.01% 86 2043 0.01% 87 2257 0.01% 88 2481 0.01% 89 2491 0.01% 90 2808 0.02% 91 2873 0.02% 92 3104 0.02% 93 3193 0.02% 94 3566 0.02% 95 3699 0.02% 96 4003 0.02% 97 4255 0.02% 98 4748 0.03% 99 4931 0.03% 100 5279 0.03% 101 5711 0.03% 102 6355 0.04% 103 6681 0.04% 104 7361 0.04% 105 7809 0.05% 106 8250 0.05% 107 8772 0.05% 108 9266 0.05% 109 9957 0.06% 110 10652 0.06% 111 11149 0.06% 112 12058 0.07% 113 12704 0.07% 114 13730 0.08% 115 14489 0.08% 116 15869 0.09% 117 16275 0.09% 118 17314 0.10% 119 18081 0.10% 120 19166 0.11% 121 20001 0.12% 122 21225 0.12% 123 22389 0.13% 124 23914 0.14% 125 25463 0.15% 126 26346 0.15% 127 28188 0.16% 128 29372 0.17% 129 30850 0.18% 130 32993 0.19% 131 35223 0.20% 132 37114 0.21% 133 39710 0.23% 134 42745 0.25% 135 45369 0.26% 136 48899 0.28% 137 52717 0.31% 138 57064 0.33% 139 61590 0.36% 140 67617 0.39% 141 74914 0.43% 142 84182 0.49% 143 95415 0.55% 144 112363 0.65% 145 136835 0.79% 146 175200 1.01% 147 243727 1.41% 148 394333 2.28% 149 822367 4.76% 150 4250902 24.62% 151 9834989 56.96% 17267065 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=30.44 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=8.8 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGATGTTGTA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=97.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.6 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATC SRR7172660 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:02:39 Started mapping on | Feb 10 17:02:40 Finished on | Feb 10 17:04:53 Mapping speed, Million of reads per hour | 467.38 Number of input reads | 17267065 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16057443 Uniquely mapped reads % | 92.99% Average mapped length | 296.94 Number of splices: Total | 16299434 Number of splices: Annotated (sjdb) | 15999269 Number of splices: GT/AG | 16040155 Number of splices: GC/AG | 206414 Number of splices: AT/AC | 12033 Number of splices: Non-canonical | 40832 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436947 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 57025 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785158 785158 785158 N_multimapping 436947 436947 436947 N_noFeature 412957 15913084 475623 N_ambiguous 174067 1061 91685 UnstrandedReadsAssigned:15470419 PositiveStrandReadsAssigned:143298 NegativeStrandReadsAssigned:15490135 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172660 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172660-trimmed-pair1.fastq SRR7172660-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,267,065 reads, 15,375,298 reads pseudoaligned [quant] estimated average fragment length: 256.888 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7172660.ke.tsv 34699 SRR7172660.se.tsv 87100 total ==> SRR7172660.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.11 1322 48.6346 Potri.005G024800.1.v4.1 1035 779.112 256 21.3004 Potri.004G059700.1.v4.1 961 705.18 82 7.53809 Potri.007G009000.2.v4.1 1416 1160.11 0 0 Potri.003G141000.2.v4.1 2943 2687.11 623 15.0297 Potri.016G087400.1.v4.1 270 70.6419 940.569 863.128 Potri.015G069301.1.v4.1 564 313.608 0 0 Potri.010G195200.1.v4.1 1773 1517.11 431 18.4165 Potri.012G127500.1.v4.1 977 721.133 6313 567.502 ==> SRR7172660.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 528 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 375 SRR7172660 completed mapping pipeline successfully