Starting /dee2/code/volunteer_pipeline.sh SRR7172662 current disk space = 3058761601024 free memory = 1579726524 SRR7172662 SRAfilesize aa1d89469132c6b6fe7b0626b8c7d327 SRR7172662.sra SRR7172662.sra file validated SRR7172662 is paired end SRR7172662 is conventional basespace SRR7172662 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172662_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.87675 33.0 33.0 34.0 32.0 34.0 2 32.52825 33.0 33.0 34.0 32.0 34.0 3 32.341 33.0 33.0 34.0 31.0 34.0 4 32.496 33.0 33.0 34.0 31.0 34.0 5 32.43425 33.0 33.0 33.0 31.0 34.0 6 36.98425 38.0 37.0 38.0 35.0 38.0 7 37.3945 38.0 38.0 38.0 37.0 38.0 8 37.53625 38.0 38.0 38.0 37.0 38.0 9 37.5555 38.0 38.0 38.0 38.0 38.0 10-14 37.58675 38.0 38.0 38.0 38.0 38.0 15-19 37.58055 38.0 38.0 38.0 38.0 38.0 20-24 37.5302 38.0 38.0 38.0 38.0 38.0 25-29 37.579600000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.55714999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.53635 38.0 38.0 38.0 38.0 38.0 40-44 37.46755 38.0 38.0 38.0 37.8 38.0 45-49 37.443949999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.360200000000006 38.0 38.0 38.0 37.2 38.0 55-59 37.2525 38.0 38.0 38.0 37.0 38.0 60-64 37.25255 38.0 38.0 38.0 37.0 38.0 65-69 37.2041 38.0 38.0 38.0 36.8 38.0 70-74 37.0893 38.0 38.0 38.0 36.2 38.0 75-79 36.93725 38.0 38.0 38.0 36.0 38.0 80-84 36.92695 38.0 38.0 38.0 36.0 38.0 85-89 36.658500000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.80715 38.0 38.0 38.0 35.4 38.0 95-99 36.82165 38.0 38.0 38.0 35.4 38.0 100-104 36.58559999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.2329 38.0 38.0 38.0 33.8 38.0 110-114 36.150549999999996 38.0 37.6 38.0 33.2 38.0 115-119 36.08905 38.0 37.2 38.0 33.0 38.0 120-124 36.21635 38.0 37.6 38.0 33.6 38.0 125-129 35.928700000000006 38.0 37.2 38.0 32.4 38.0 130-134 35.45739999999999 38.0 36.2 38.0 30.4 38.0 135-139 35.1177 38.0 35.8 38.0 28.2 38.0 140-144 35.247749999999996 38.0 36.0 38.0 30.2 38.0 145-149 34.944500000000005 38.0 35.8 38.0 29.6 38.0 150-151 31.27775 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 5.0 24 8.0 25 6.0 26 16.0 27 14.0 28 24.0 29 40.0 30 34.0 31 55.0 32 49.0 33 77.0 34 153.0 35 229.0 36 599.0 37 2674.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.32412381683295 13.072397032489128 11.818879508825788 37.78459964185213 2 19.366993217784476 19.91961818638533 38.759105752323535 21.954282843506657 3 18.625 26.474999999999998 26.974999999999998 27.925 4 22.025 33.225 21.625 23.125 5 20.175 36.3 24.725 18.8 6 16.925 35.4 26.674999999999997 21.0 7 13.900000000000002 21.05 44.75 20.3 8 17.025000000000002 21.325 32.0 29.65 9 17.7 23.05 32.1 27.150000000000002 10-14 19.905 29.225 26.729999999999997 24.14 15-19 20.02 28.035 28.560000000000002 23.385 20-24 20.25 28.315 27.834999999999997 23.599999999999998 25-29 19.830000000000002 28.725 27.375 24.07 30-34 20.244999999999997 28.634999999999998 27.839999999999996 23.28 35-39 19.525000000000002 28.494999999999997 27.644999999999996 24.335 40-44 20.005 28.34 28.065 23.59 45-49 19.775000000000002 28.46 27.51 24.255 50-54 20.145 28.255000000000003 28.07 23.53 55-59 19.825 28.475 27.855 23.845 60-64 20.119999999999997 27.634999999999998 28.000000000000004 24.245 65-69 19.865 28.51 27.794999999999998 23.830000000000002 70-74 20.1 27.815 27.97 24.115000000000002 75-79 19.895 28.275 27.71 24.12 80-84 20.685000000000002 28.110000000000003 27.825 23.380000000000003 85-89 20.325 28.18 27.93 23.565 90-94 19.98 28.1 27.855 24.065 95-99 20.14 27.705000000000002 28.075 24.08 100-104 20.465 27.865000000000002 28.084999999999997 23.585 105-109 19.865 28.565 27.295 24.275 110-114 20.482289373624173 27.796678006804083 27.78166900140084 23.9393636181709 115-119 20.62 27.735 27.93 23.715 120-124 20.23 27.85 27.68 24.240000000000002 125-129 20.855 27.224999999999998 28.16 23.76 130-134 20.785 27.54 27.775 23.9 135-139 20.775 27.625 27.435 24.165 140-144 21.285 27.71 27.639999999999997 23.365 145-149 21.235 28.075 26.965 23.724999999999998 150-151 21.325 28.15 26.9125 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 2.0 24 2.0 25 4.5 26 6.0 27 6.0 28 10.5 29 15.5 30 20.5 31 25.0 32 31.5 33 42.5 34 55.0 35 71.0 36 84.5 37 104.5 38 139.5 39 160.5 40 185.5 41 221.5 42 257.0 43 261.5 44 258.5 45 279.5 46 276.5 47 261.0 48 241.0 49 197.0 50 158.0 51 135.5 52 113.5 53 84.5 54 56.0 55 51.5 56 44.5 57 31.0 58 21.5 59 15.0 60 13.0 61 12.0 62 12.5 63 8.0 64 4.5 65 4.0 66 3.0 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.2875 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATAA 10 0.0068343505 144.975 9 >>END_MODULE SRR7172662 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172662_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07475 34.0 33.0 34.0 32.0 34.0 2 33.18325 34.0 33.0 34.0 33.0 34.0 3 33.19325 34.0 33.0 34.0 33.0 34.0 4 33.16025 34.0 33.0 34.0 33.0 34.0 5 33.1625 34.0 33.0 34.0 33.0 34.0 6 37.316 38.0 38.0 38.0 38.0 38.0 7 37.3075 38.0 38.0 38.0 38.0 38.0 8 37.332 38.0 38.0 38.0 38.0 38.0 9 37.30325 38.0 38.0 38.0 37.0 38.0 10-14 37.242399999999996 38.0 38.0 38.0 37.4 38.0 15-19 37.25145 38.0 38.0 38.0 37.8 38.0 20-24 37.2626 38.0 38.0 38.0 38.0 38.0 25-29 36.9134 38.0 38.0 38.0 37.0 38.0 30-34 36.193200000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.48565 38.0 38.0 38.0 35.8 38.0 40-44 37.10415 38.0 38.0 38.0 36.8 38.0 45-49 37.157650000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.10635 38.0 38.0 38.0 37.0 38.0 55-59 37.0235 38.0 38.0 38.0 36.6 38.0 60-64 36.8465 38.0 38.0 38.0 36.0 38.0 65-69 36.779500000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.76445 38.0 38.0 38.0 36.0 38.0 75-79 36.6747 38.0 38.0 38.0 35.4 38.0 80-84 36.73094999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.68155 38.0 38.0 38.0 35.4 38.0 90-94 36.52725 38.0 38.0 38.0 34.6 38.0 95-99 36.53385 38.0 38.0 38.0 34.8 38.0 100-104 36.387299999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.34310000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.21795 38.0 38.0 38.0 34.2 38.0 115-119 35.921299999999995 38.0 38.0 38.0 33.2 38.0 120-124 35.69494999999999 38.0 37.4 38.0 31.4 38.0 125-129 35.53605 38.0 36.8 38.0 31.2 38.0 130-134 35.21695 38.0 36.2 38.0 30.0 38.0 135-139 34.9528 38.0 36.0 38.0 28.2 38.0 140-144 34.469699999999996 38.0 35.6 38.0 27.0 38.0 145-149 33.41715000000001 38.0 33.2 38.0 18.6 38.0 150-151 29.140749999999997 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 0.0 5 1.0 6 2.0 7 2.0 8 3.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 4.0 15 2.0 16 5.0 17 3.0 18 4.0 19 6.0 20 2.0 21 6.0 22 9.0 23 6.0 24 16.0 25 18.0 26 23.0 27 21.0 28 19.0 29 28.0 30 41.0 31 42.0 32 63.0 33 92.0 34 158.0 35 281.0 36 516.0 37 2611.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.5 17.1 16.5 27.900000000000002 2 25.275 24.075 33.45 17.2 3 20.225 26.950000000000003 32.225 20.599999999999998 4 25.5 33.875 22.05 18.575 5 25.4 35.949999999999996 19.975 18.675 6 17.75 39.35 22.175 20.724999999999998 7 17.349999999999998 18.2 43.425000000000004 21.025 8 21.0 22.675 27.3 29.025000000000002 9 22.3 25.324999999999996 28.025 24.349999999999998 10-14 23.36 28.875 25.900000000000002 21.865000000000002 15-19 22.869999999999997 27.525 28.435 21.17 20-24 23.485 28.58 27.165 20.77 25-29 22.810908907596914 28.829964208297625 27.075666683470285 21.283460200635176 30-34 23.393646550837875 28.379767657037114 27.30543847023748 20.921147321887528 35-39 23.5291136674606 28.566360918258756 26.828155881011504 21.076369533269144 40-44 23.56 27.325 28.03 21.085 45-49 23.425 28.28 27.76 20.535 50-54 23.580000000000002 28.065 27.744999999999997 20.61 55-59 23.775 27.944999999999997 27.51 20.77 60-64 24.255 27.47 27.975 20.3 65-69 23.395 28.26 27.47 20.875 70-74 23.82 27.445000000000004 27.515 21.22 75-79 23.925 28.22 27.439999999999998 20.415 80-84 23.73 28.275 27.375 20.62 85-89 24.05 27.865000000000002 27.195000000000004 20.89 90-94 23.974999999999998 28.015 27.715 20.294999999999998 95-99 23.755000000000003 28.360000000000003 26.765 21.12 100-104 23.79 28.42 27.125 20.665 105-109 24.075 28.58 26.6 20.745 110-114 23.990000000000002 28.01 27.134999999999998 20.865000000000002 115-119 23.65 27.92 27.639999999999997 20.79 120-124 24.38 27.939999999999998 27.334999999999997 20.345 125-129 24.22 27.655 27.694999999999997 20.43 130-134 24.055 28.18 27.63 20.135 135-139 24.275 27.689999999999998 27.73 20.305 140-144 24.265 28.165000000000003 27.634999999999998 19.935 145-149 24.795 28.03 27.229999999999997 19.945 150-151 24.975 28.425 27.175 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 1.0 27 2.5 28 3.5 29 7.0 30 7.0 31 6.5 32 15.5 33 25.0 34 34.5 35 50.5 36 74.5 37 101.5 38 123.0 39 156.5 40 193.5 41 235.5 42 277.0 43 286.0 44 295.5 45 307.5 46 299.0 47 271.5 48 235.0 49 207.5 50 180.5 51 145.5 52 107.5 53 86.5 54 72.0 55 48.0 56 35.5 57 28.0 58 19.0 59 12.5 60 9.5 61 7.5 62 8.0 63 8.0 64 3.0 65 1.0 66 1.5 67 2.5 68 1.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.815 30-34 2.73 35-39 1.335 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.725 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCC 10 0.0068803662 144.65 2 TTGATCA 10 0.0068803662 144.65 7 >>END_MODULE Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra Read 752205 spots for SRR7172662.sra Written 752205 spots for SRR7172662.sra Read 752188 spots for SRR7172662.sra Written 752188 spots for SRR7172662.sra SRR ids: ['SRR7172662.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tcam81sv SRR7172662.sra spots: 15043777 blocks: [[1, 752188], [752189, 1504376], [1504377, 2256564], [2256565, 3008752], [3008753, 3760940], [3760941, 4513128], [4513129, 5265316], [5265317, 6017504], [6017505, 6769692], [6769693, 7521880], [7521881, 8274068], [8274069, 9026256], [9026257, 9778444], [9778445, 10530632], [10530633, 11282820], [11282821, 12035008], [12035009, 12787196], [12787197, 13539384], [13539385, 14291572], [14291573, 15043777]] SRR7172662 file size 5076142 SRR7172662 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172662 SRR7172662_1.fastq SRR7172662_2.fastq Input file: SRR7172662_1.fastq Paired file: SRR7172662_2.fastq trimmed: SRR7172662-trimmed-pair1.fastq, SRR7172662-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:15:21 2025 >> started Mon Feb 10 12:15:38 2025 >> done (16.985s) 15043777 read pairs processed; of these: 17877 ( 0.12%) short read pairs filtered out after trimming by size control 12637 ( 0.08%) empty read pairs filtered out after trimming by size control 15013263 (99.80%) read pairs available; of these: 7300045 (48.62%) trimmed read pairs available after processing 7713218 (51.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 7 0.00% 26 4 0.00% 27 1 0.00% 28 2 0.00% 29 6 0.00% 30 1 0.00% 31 2 0.00% 32 1 0.00% 33 1 0.00% 34 6 0.00% 35 1 0.00% 36 4 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 2 0.00% 41 0 0.00% 42 7 0.00% 43 5 0.00% 44 5 0.00% 45 4 0.00% 46 4 0.00% 47 9 0.00% 48 10 0.00% 49 12 0.00% 50 11 0.00% 51 21 0.00% 52 10 0.00% 53 25 0.00% 54 18 0.00% 55 20 0.00% 56 32 0.00% 57 28 0.00% 58 41 0.00% 59 41 0.00% 60 49 0.00% 61 58 0.00% 62 60 0.00% 63 65 0.00% 64 84 0.00% 65 81 0.00% 66 94 0.00% 67 119 0.00% 68 177 0.00% 69 157 0.00% 70 181 0.00% 71 228 0.00% 72 204 0.00% 73 262 0.00% 74 300 0.00% 75 369 0.00% 76 442 0.00% 77 537 0.00% 78 563 0.00% 79 595 0.00% 80 682 0.00% 81 832 0.01% 82 943 0.01% 83 1131 0.01% 84 2029 0.01% 85 2612 0.02% 86 2746 0.02% 87 3041 0.02% 88 3229 0.02% 89 3221 0.02% 90 3181 0.02% 91 3516 0.02% 92 3794 0.03% 93 3838 0.03% 94 4150 0.03% 95 4459 0.03% 96 4740 0.03% 97 5109 0.03% 98 5427 0.04% 99 5960 0.04% 100 6198 0.04% 101 6481 0.04% 102 7164 0.05% 103 7363 0.05% 104 7882 0.05% 105 8372 0.06% 106 9146 0.06% 107 9642 0.06% 108 9865 0.07% 109 10509 0.07% 110 11285 0.08% 111 11889 0.08% 112 12802 0.09% 113 13413 0.09% 114 14589 0.10% 115 14913 0.10% 116 15908 0.11% 117 16382 0.11% 118 17382 0.12% 119 18127 0.12% 120 18688 0.12% 121 19880 0.13% 122 21045 0.14% 123 21878 0.15% 124 23460 0.16% 125 24528 0.16% 126 25645 0.17% 127 26820 0.18% 128 28008 0.19% 129 29906 0.20% 130 31622 0.21% 131 33022 0.22% 132 34854 0.23% 133 37348 0.25% 134 40114 0.27% 135 42541 0.28% 136 45402 0.30% 137 48325 0.32% 138 52388 0.35% 139 56846 0.38% 140 61521 0.41% 141 67832 0.45% 142 76108 0.51% 143 85698 0.57% 144 99729 0.66% 145 120567 0.80% 146 152035 1.01% 147 208202 1.39% 148 333309 2.22% 149 792410 5.28% 150 4341371 28.92% 151 7713218 51.38% 15013263 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=28 prefix-density=0.42 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=51.43 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=11.9 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=20 prefix-density=0.44 prefix-fanout=2.8 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=30.15 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172662 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:16:23 Started mapping on | Feb 10 12:16:24 Finished on | Feb 10 12:18:46 Mapping speed, Million of reads per hour | 380.62 Number of input reads | 15013263 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13688538 Uniquely mapped reads % | 91.18% Average mapped length | 296.20 Number of splices: Total | 14471785 Number of splices: Annotated (sjdb) | 14248372 Number of splices: GT/AG | 14248199 Number of splices: GC/AG | 176190 Number of splices: AT/AC | 10611 Number of splices: Non-canonical | 36785 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456465 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 31785 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884801 884801 884801 N_multimapping 456465 456465 456465 N_noFeature 258679 13569779 291740 N_ambiguous 156829 1334 70765 UnstrandedReadsAssigned:13273030 PositiveStrandReadsAssigned:117425 NegativeStrandReadsAssigned:13326033 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172662 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172662-trimmed-pair1.fastq SRR7172662-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,013,263 reads, 13,243,495 reads pseudoaligned [quant] estimated average fragment length: 245.968 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7172662.ke.tsv 34699 SRR7172662.se.tsv 87100 total ==> SRR7172662.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.03 1209 42.8079 Potri.005G024800.1.v4.1 1035 790.032 651 51.731 Potri.004G059700.1.v4.1 961 716.043 159 13.9403 Potri.007G009000.2.v4.1 1416 1171.03 0 0 Potri.003G141000.2.v4.1 2943 2698.03 428 9.95889 Potri.016G087400.1.v4.1 270 72.7257 1179.26 1017.97 Potri.015G069301.1.v4.1 564 321.95 0 0 Potri.010G195200.1.v4.1 1773 1528.03 155 6.36815 Potri.012G127500.1.v4.1 977 732.043 4849 415.844 ==> SRR7172662.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 414 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 896 SRR7172662 completed mapping pipeline successfully