Starting /dee2/code/volunteer_pipeline.sh SRR7172663 current disk space = 3059112550400 free memory = 1416932768 SRR7172663 SRAfilesize d552944e2d8230b411d8fb731c395bf7 SRR7172663.sra SRR7172663.sra file validated SRR7172663 is paired end SRR7172663 is conventional basespace SRR7172663 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172663_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.91175 18.0 18.0 30.0 18.0 32.0 2 27.101 29.0 25.0 31.0 18.0 33.0 3 28.915 31.0 27.0 33.0 18.0 33.0 4 31.2205 33.0 31.0 33.0 27.0 33.0 5 32.18725 33.0 32.0 33.0 31.0 33.0 6 36.973 38.0 37.0 38.0 35.0 38.0 7 37.48525 38.0 38.0 38.0 37.0 38.0 8 37.588 38.0 38.0 38.0 37.0 38.0 9 37.606 38.0 38.0 38.0 38.0 38.0 10-14 37.5737 38.0 38.0 38.0 38.0 38.0 15-19 37.576 38.0 38.0 38.0 38.0 38.0 20-24 37.556850000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.58495 38.0 38.0 38.0 38.0 38.0 30-34 37.5898 38.0 38.0 38.0 38.0 38.0 35-39 37.548649999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.44805 38.0 38.0 38.0 37.2 38.0 45-49 37.41245 38.0 38.0 38.0 37.0 38.0 50-54 37.4193 38.0 38.0 38.0 37.0 38.0 55-59 37.29025 38.0 38.0 38.0 37.0 38.0 60-64 37.295399999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.22715 38.0 38.0 38.0 36.6 38.0 70-74 37.16375000000001 38.0 38.0 38.0 36.4 38.0 75-79 37.14735 38.0 38.0 38.0 36.0 38.0 80-84 37.08284999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.905100000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.909 38.0 38.0 38.0 35.2 38.0 95-99 36.858 38.0 38.0 38.0 35.0 38.0 100-104 36.704 38.0 38.0 38.0 34.6 38.0 105-109 36.479749999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.2184 38.0 37.6 38.0 33.6 38.0 115-119 36.398 38.0 38.0 38.0 34.0 38.0 120-124 36.286350000000006 38.0 37.4 38.0 33.8 38.0 125-129 35.94495 38.0 36.8 38.0 32.6 38.0 130-134 35.1584 38.0 35.4 38.0 28.8 38.0 135-139 35.082100000000004 38.0 35.6 38.0 28.4 38.0 140-144 34.94225 38.0 35.0 38.0 28.0 38.0 145-149 34.53555 38.0 35.0 38.0 27.6 38.0 150-151 30.80125 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 1.0 20 1.0 21 1.0 22 3.0 23 7.0 24 3.0 25 6.0 26 7.0 27 24.0 28 19.0 29 26.0 30 35.0 31 56.0 32 63.0 33 120.0 34 169.0 35 297.0 36 728.0 37 2430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.61352657004831 16.85736079328757 10.399186371726417 33.12992626493771 2 21.78939432018095 19.52751947725559 34.832872581050516 23.850213621512943 3 19.875 25.75 25.2 29.175 4 22.175 33.45 22.7 21.675 5 21.825 35.925000000000004 23.375 18.875 6 18.4 34.975 25.525 21.099999999999998 7 13.55 22.650000000000002 43.675000000000004 20.125 8 17.7 22.425 30.15 29.725 9 17.75 23.474999999999998 31.424999999999997 27.35 10-14 20.16 29.175 27.08 23.585 15-19 20.244999999999997 28.005000000000003 27.985 23.765 20-24 19.89 28.215 28.165000000000003 23.73 25-29 19.97 28.804999999999996 27.615000000000002 23.61 30-34 19.805 28.244999999999997 27.750000000000004 24.2 35-39 19.84 28.310000000000002 28.1 23.75 40-44 19.744999999999997 28.605000000000004 27.855 23.794999999999998 45-49 19.975 28.63 27.495000000000005 23.9 50-54 20.674999999999997 28.215 27.939999999999998 23.169999999999998 55-59 20.3 28.1 27.79 23.810000000000002 60-64 19.97 28.410000000000004 27.810000000000002 23.810000000000002 65-69 20.32 27.650000000000002 27.925 24.104999999999997 70-74 20.13 27.634999999999998 28.305000000000003 23.93 75-79 20.105 28.01 28.285 23.599999999999998 80-84 20.1 28.134999999999998 27.96 23.805 85-89 20.275000000000002 28.015 28.315 23.395 90-94 21.105 27.805000000000003 27.88 23.21 95-99 20.630000000000003 27.66 28.055000000000003 23.655 100-104 20.26 28.055000000000003 28.025 23.66 105-109 20.13 27.79 28.134999999999998 23.945 110-114 20.895 28.410000000000004 27.29 23.405 115-119 20.79 28.475 27.58 23.155 120-124 20.794999999999998 28.34 27.1 23.765 125-129 20.785 28.310000000000002 27.82 23.085 130-134 20.775 28.910000000000004 27.084999999999997 23.23 135-139 20.74 28.215 27.47 23.575 140-144 21.18 27.450000000000003 27.634999999999998 23.735 145-149 20.91 28.525 27.555000000000003 23.01 150-151 21.0375 28.012500000000003 26.85 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.5 26 3.5 27 4.5 28 6.0 29 9.0 30 13.0 31 17.5 32 29.0 33 38.0 34 51.5 35 71.0 36 84.5 37 101.0 38 129.0 39 167.5 40 194.5 41 232.5 42 258.0 43 278.5 44 296.5 45 279.0 46 272.0 47 268.0 48 234.0 49 205.0 50 173.5 51 127.5 52 104.0 53 86.5 54 68.5 55 51.0 56 34.5 57 24.5 58 21.0 59 16.0 60 9.0 61 6.0 62 5.5 63 5.5 64 6.0 65 4.5 66 1.5 67 1.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7625000000000002 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGACA 10 0.0063298983 148.6923 1 AATGAAG 10 0.0068343505 144.975 145 GAGAGAG 20 0.005940113 28.995 45-49 >>END_MODULE SRR7172663 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172663_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01275 34.0 33.0 34.0 32.0 34.0 2 33.01475 34.0 33.0 34.0 32.0 34.0 3 33.0 34.0 33.0 34.0 32.0 34.0 4 33.0035 34.0 33.0 34.0 32.0 34.0 5 33.00425 34.0 33.0 34.0 33.0 34.0 6 37.09575 38.0 38.0 38.0 37.0 38.0 7 37.03275 38.0 38.0 38.0 37.0 38.0 8 37.09725 38.0 38.0 38.0 37.0 38.0 9 37.0275 38.0 38.0 38.0 37.0 38.0 10-14 36.991049999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.0038 38.0 38.0 38.0 37.0 38.0 20-24 36.9945 38.0 38.0 38.0 37.0 38.0 25-29 36.814099999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.3991 38.0 38.0 38.0 36.0 38.0 35-39 36.576 38.0 38.0 38.0 35.8 38.0 40-44 36.82885 38.0 38.0 38.0 36.6 38.0 45-49 36.85795 38.0 38.0 38.0 36.8 38.0 50-54 36.847500000000004 38.0 38.0 38.0 36.8 38.0 55-59 36.70675 38.0 38.0 38.0 36.0 38.0 60-64 36.5291 38.0 38.0 38.0 35.6 38.0 65-69 36.4427 38.0 38.0 38.0 35.0 38.0 70-74 36.3999 38.0 38.0 38.0 34.8 38.0 75-79 36.3461 38.0 38.0 38.0 34.6 38.0 80-84 36.3391 38.0 38.0 38.0 34.4 38.0 85-89 36.2896 38.0 38.0 38.0 34.2 38.0 90-94 36.19675 38.0 38.0 38.0 34.0 38.0 95-99 36.08005 38.0 38.0 38.0 34.0 38.0 100-104 35.96755 38.0 38.0 38.0 33.4 38.0 105-109 35.92915000000001 38.0 38.0 38.0 33.4 38.0 110-114 35.7946 38.0 38.0 38.0 33.0 38.0 115-119 35.4322 38.0 37.0 38.0 31.0 38.0 120-124 35.28415 38.0 36.6 38.0 29.6 38.0 125-129 34.91394999999999 38.0 36.0 38.0 27.8 38.0 130-134 34.4906 38.0 35.4 38.0 25.6 38.0 135-139 34.23235 38.0 34.2 38.0 25.0 38.0 140-144 33.709950000000006 38.0 33.0 38.0 22.4 38.0 145-149 32.8202 38.0 33.0 38.0 14.4 38.0 150-151 28.711624999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 10.0 4 6.0 5 3.0 6 5.0 7 1.0 8 3.0 9 3.0 10 2.0 11 4.0 12 1.0 13 3.0 14 1.0 15 2.0 16 4.0 17 3.0 18 2.0 19 7.0 20 3.0 21 10.0 22 8.0 23 15.0 24 11.0 25 9.0 26 17.0 27 20.0 28 31.0 29 36.0 30 45.0 31 68.0 32 74.0 33 83.0 34 182.0 35 253.0 36 555.0 37 2503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.425 16.925 15.475 27.175 2 23.75 25.275 33.650000000000006 17.325 3 21.375 27.200000000000003 30.3 21.125 4 25.224999999999998 34.1 21.875 18.8 5 24.75 36.4 21.224999999999998 17.625 6 18.45 37.225 25.2 19.125 7 18.95 18.575 42.225 20.25 8 22.35 22.55 27.1 28.000000000000004 9 22.400000000000002 25.15 27.200000000000003 25.25 10-14 23.169999999999998 28.98 26.119999999999997 21.73 15-19 23.14 28.255000000000003 27.744999999999997 20.86 20-24 22.75 29.005 27.395000000000003 20.849999999999998 25-29 22.740261693487742 28.33508798315536 27.858825888604805 21.06582443475209 30-34 23.21537213546948 28.45264652200365 27.484283106874873 20.847698235651997 35-39 23.28677652733119 28.451567524115756 27.10008038585209 21.161575562700964 40-44 22.905 28.345 27.325 21.425 45-49 22.41 28.52 28.165000000000003 20.905 50-54 22.74 28.87 27.615000000000002 20.775 55-59 23.169999999999998 28.555000000000003 27.794999999999998 20.48 60-64 23.32 28.384999999999998 27.965 20.330000000000002 65-69 23.14 28.475 27.845 20.54 70-74 23.82 28.575 27.355 20.25 75-79 23.79 28.33 27.245 20.635 80-84 23.645 27.955000000000002 27.68 20.72 85-89 23.885 28.1 27.665 20.349999999999998 90-94 23.815 28.51 27.71 19.965 95-99 23.98 28.09 27.055 20.875 100-104 23.974999999999998 27.97 27.735 20.32 105-109 23.96 27.405 27.894999999999996 20.74 110-114 24.224999999999998 28.73 27.544999999999998 19.5 115-119 23.645 28.189999999999998 27.6 20.565 120-124 24.169999999999998 27.744999999999997 27.439999999999998 20.645 125-129 24.505 27.939999999999998 27.345000000000002 20.21 130-134 24.224999999999998 28.42 27.095000000000002 20.26 135-139 24.125 27.67 27.96 20.244999999999997 140-144 23.974999999999998 28.065 27.575 20.385 145-149 25.165 28.084999999999997 27.175 19.575 150-151 25.387500000000003 27.3 27.3875 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.5 25 3.5 26 4.5 27 2.0 28 1.5 29 4.5 30 9.0 31 19.5 32 25.5 33 28.5 34 42.5 35 50.5 36 67.0 37 98.0 38 133.5 39 178.0 40 214.0 41 257.5 42 288.0 43 280.0 44 284.5 45 281.0 46 266.5 47 265.0 48 242.0 49 211.0 50 174.0 51 131.0 52 105.5 53 84.5 54 57.5 55 37.5 56 30.5 57 24.5 58 20.5 59 19.0 60 15.5 61 10.0 62 5.5 63 5.0 64 4.5 65 3.0 66 2.5 67 2.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.265 30-34 1.38 35-39 0.48 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7874999999999996 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATTTA 10 0.0068857023 144.61249 4 >>END_MODULE Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727205 spots for SRR7172663.sra Written 727205 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra Read 727196 spots for SRR7172663.sra Written 727196 spots for SRR7172663.sra SRR ids: ['SRR7172663.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_atgkckac SRR7172663.sra spots: 14543929 blocks: [[1, 727196], [727197, 1454392], [1454393, 2181588], [2181589, 2908784], [2908785, 3635980], [3635981, 4363176], [4363177, 5090372], [5090373, 5817568], [5817569, 6544764], [6544765, 7271960], [7271961, 7999156], [7999157, 8726352], [8726353, 9453548], [9453549, 10180744], [10180745, 10907940], [10907941, 11635136], [11635137, 12362332], [12362333, 13089528], [13089529, 13816724], [13816725, 14543929]] SRR7172663 file size 4906759 SRR7172663 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172663 SRR7172663_1.fastq SRR7172663_2.fastq Input file: SRR7172663_1.fastq Paired file: SRR7172663_2.fastq trimmed: SRR7172663-trimmed-pair1.fastq, SRR7172663-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:29:41 2025 >> started Mon Feb 10 11:29:57 2025 >> done (15.515s) 14543929 read pairs processed; of these: 25129 ( 0.17%) short read pairs filtered out after trimming by size control 16198 ( 0.11%) empty read pairs filtered out after trimming by size control 14502602 (99.72%) read pairs available; of these: 5838538 (40.26%) trimmed read pairs available after processing 8664064 (59.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 2 0.00% 31 4 0.00% 32 3 0.00% 33 3 0.00% 34 2 0.00% 35 3 0.00% 36 6 0.00% 37 3 0.00% 38 2 0.00% 39 2 0.00% 40 8 0.00% 41 4 0.00% 42 5 0.00% 43 3 0.00% 44 9 0.00% 45 11 0.00% 46 9 0.00% 47 7 0.00% 48 8 0.00% 49 9 0.00% 50 15 0.00% 51 18 0.00% 52 18 0.00% 53 19 0.00% 54 32 0.00% 55 22 0.00% 56 28 0.00% 57 46 0.00% 58 49 0.00% 59 45 0.00% 60 44 0.00% 61 85 0.00% 62 100 0.00% 63 77 0.00% 64 100 0.00% 65 102 0.00% 66 126 0.00% 67 161 0.00% 68 183 0.00% 69 211 0.00% 70 218 0.00% 71 259 0.00% 72 296 0.00% 73 340 0.00% 74 345 0.00% 75 442 0.00% 76 543 0.00% 77 628 0.00% 78 650 0.00% 79 750 0.01% 80 822 0.01% 81 971 0.01% 82 1136 0.01% 83 1382 0.01% 84 2498 0.02% 85 3432 0.02% 86 3351 0.02% 87 3616 0.02% 88 3717 0.03% 89 3771 0.03% 90 4026 0.03% 91 4164 0.03% 92 4554 0.03% 93 4873 0.03% 94 5371 0.04% 95 5702 0.04% 96 6087 0.04% 97 6398 0.04% 98 6793 0.05% 99 7353 0.05% 100 7754 0.05% 101 8362 0.06% 102 9022 0.06% 103 9643 0.07% 104 10389 0.07% 105 11092 0.08% 106 11697 0.08% 107 12276 0.08% 108 12771 0.09% 109 13425 0.09% 110 14376 0.10% 111 14893 0.10% 112 15880 0.11% 113 17142 0.12% 114 18453 0.13% 115 19416 0.13% 116 20101 0.14% 117 21250 0.15% 118 21468 0.15% 119 22331 0.15% 120 23815 0.16% 121 24686 0.17% 122 25996 0.18% 123 27488 0.19% 124 28727 0.20% 125 30123 0.21% 126 31419 0.22% 127 32648 0.23% 128 34044 0.23% 129 35299 0.24% 130 36596 0.25% 131 38719 0.27% 132 40382 0.28% 133 42866 0.30% 134 45431 0.31% 135 48095 0.33% 136 50715 0.35% 137 53257 0.37% 138 56168 0.39% 139 59575 0.41% 140 63410 0.44% 141 69909 0.48% 142 76166 0.53% 143 84952 0.59% 144 97457 0.67% 145 114510 0.79% 146 139151 0.96% 147 186232 1.28% 148 274298 1.89% 149 543769 3.75% 150 3044797 20.99% 151 8664064 59.74% 14502602 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=370.37 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=30.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=35 prefix-density=0.30 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=306.08 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.1 sequence=GAAGAAGAAGAAA SRR7172663 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:30:45 Started mapping on | Feb 10 11:30:45 Finished on | Feb 10 11:32:57 Mapping speed, Million of reads per hour | 395.53 Number of input reads | 14502602 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13231768 Uniquely mapped reads % | 91.24% Average mapped length | 295.47 Number of splices: Total | 13751648 Number of splices: Annotated (sjdb) | 13520202 Number of splices: GT/AG | 13532614 Number of splices: GC/AG | 175326 Number of splices: AT/AC | 10064 Number of splices: Non-canonical | 33644 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360436 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 47597 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.87% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 931539 931539 931539 N_multimapping 360436 360436 360436 N_noFeature 277015 13125223 321392 N_ambiguous 138206 910 75382 UnstrandedReadsAssigned:12816547 PositiveStrandReadsAssigned:105635 NegativeStrandReadsAssigned:12834994 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172663 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172663-trimmed-pair1.fastq SRR7172663-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,502,602 reads, 12,785,004 reads pseudoaligned [quant] estimated average fragment length: 244.504 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7172663.ke.tsv 34699 SRR7172663.se.tsv 87100 total ==> SRR7172663.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.5 1182 51.0452 Potri.005G024800.1.v4.1 1035 791.496 109 10.5533 Potri.004G059700.1.v4.1 961 717.502 24 2.56331 Potri.007G009000.2.v4.1 1416 1172.5 0 0 Potri.003G141000.2.v4.1 2943 2699.5 366.122 10.3934 Potri.016G087400.1.v4.1 270 78.0899 927 909.698 Potri.015G069301.1.v4.1 564 324.76 0 0 Potri.010G195200.1.v4.1 1773 1529.5 262 13.127 Potri.012G127500.1.v4.1 977 733.502 6035 630.505 ==> SRR7172663.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 178 SRR7172663 completed mapping pipeline successfully