Starting /dee2/code/volunteer_pipeline.sh SRR7172664 current disk space = 3059001102336 free memory = 1426753860 SRR7172664 SRAfilesize 63503cf4fb41fdf9ec5bd98104b3ef94 SRR7172664.sra SRR7172664.sra file validated SRR7172664 is paired end SRR7172664 is conventional basespace SRR7172664 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172664_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.21325 30.0 18.0 33.0 18.0 33.0 2 30.63825 31.0 29.0 33.0 27.0 33.0 3 31.8565 33.0 32.0 33.0 30.0 33.0 4 31.3205 33.0 32.0 33.0 28.0 33.0 5 31.962 33.0 32.0 33.0 31.0 33.0 6 37.0005 38.0 37.0 38.0 35.0 38.0 7 37.4295 38.0 38.0 38.0 37.0 38.0 8 37.6855 38.0 38.0 38.0 38.0 38.0 9 37.70725 38.0 38.0 38.0 38.0 38.0 10-14 37.693900000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.6545 38.0 38.0 38.0 38.0 38.0 20-24 37.63775 38.0 38.0 38.0 38.0 38.0 25-29 37.67745 38.0 38.0 38.0 38.0 38.0 30-34 37.66515 38.0 38.0 38.0 38.0 38.0 35-39 37.62949999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.576750000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.514599999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.51605 38.0 38.0 38.0 38.0 38.0 55-59 37.41175 38.0 38.0 38.0 37.2 38.0 60-64 37.41245 38.0 38.0 38.0 37.0 38.0 65-69 37.356399999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.36095 38.0 38.0 38.0 37.0 38.0 75-79 37.273450000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.2316 38.0 38.0 38.0 36.8 38.0 85-89 37.1005 38.0 38.0 38.0 36.0 38.0 90-94 37.05615 38.0 38.0 38.0 36.0 38.0 95-99 37.10965 38.0 38.0 38.0 36.0 38.0 100-104 36.97234999999999 38.0 38.0 38.0 35.8 38.0 105-109 36.75705 38.0 38.0 38.0 35.0 38.0 110-114 36.600750000000005 38.0 38.0 38.0 34.6 38.0 115-119 36.604200000000006 38.0 38.0 38.0 34.6 38.0 120-124 36.522149999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.18245 38.0 37.6 38.0 33.6 38.0 130-134 35.823249999999994 38.0 36.6 38.0 32.2 38.0 135-139 35.43555 38.0 36.0 38.0 31.0 38.0 140-144 35.51715 38.0 36.0 38.0 31.0 38.0 145-149 35.365899999999996 38.0 36.0 38.0 31.0 38.0 150-151 32.608375 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 2.0 18 1.0 19 0.0 20 2.0 21 2.0 22 4.0 23 5.0 24 4.0 25 9.0 26 12.0 27 14.0 28 14.0 29 12.0 30 18.0 31 39.0 32 57.0 33 64.0 34 119.0 35 211.0 36 589.0 37 2818.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.756035578144854 12.579415501905972 13.01143583227446 38.65311308767471 2 21.532663316582916 19.547738693467338 39.74874371859297 19.17085427135678 3 18.4 27.875 27.150000000000002 26.575 4 22.5 33.050000000000004 23.0 21.45 5 21.475 35.175 25.05 18.3 6 16.400000000000002 35.65 27.075 20.875 7 13.450000000000001 21.675 46.400000000000006 18.475 8 18.925 20.8 30.625000000000004 29.65 9 18.375 22.05 33.675 25.900000000000002 10-14 19.525000000000002 28.95 27.384999999999998 24.14 15-19 19.115 27.944999999999997 29.225 23.715 20-24 19.195 29.134999999999998 28.04 23.630000000000003 25-29 19.49 28.275 28.4 23.835 30-34 19.78 28.22 28.415000000000003 23.585 35-39 19.415 28.299999999999997 28.349999999999998 23.935000000000002 40-44 19.84 28.765 27.689999999999998 23.705000000000002 45-49 20.04 27.82 28.075 24.065 50-54 20.135 28.110000000000003 28.044999999999998 23.71 55-59 19.84 28.63 28.125 23.405 60-64 19.689999999999998 28.470000000000002 28.185 23.655 65-69 19.79 28.410000000000004 27.565 24.235 70-74 19.725 28.544999999999998 28.13 23.599999999999998 75-79 20.05 28.225 28.18 23.544999999999998 80-84 19.78 28.51 28.24 23.47 85-89 20.035 28.439999999999998 27.935 23.59 90-94 19.62 28.73 27.765 23.885 95-99 19.939999999999998 28.315 27.905 23.84 100-104 19.939999999999998 28.000000000000004 27.884999999999998 24.175 105-109 20.14 27.61 28.744999999999997 23.505000000000003 110-114 19.665 28.4 28.1 23.835 115-119 19.975 28.37 28.15 23.505000000000003 120-124 20.115 28.26 27.55 24.075 125-129 20.165 28.205000000000002 28.225 23.405 130-134 20.145 28.29 27.215 24.349999999999998 135-139 20.275000000000002 28.79 27.465 23.47 140-144 20.119999999999997 29.12 27.389999999999997 23.369999999999997 145-149 20.044999999999998 28.470000000000002 27.66 23.825 150-151 20.6625 28.325 27.237499999999997 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.0 26 5.5 27 6.0 28 6.0 29 9.5 30 17.0 31 28.5 32 38.0 33 43.5 34 51.5 35 67.5 36 98.0 37 117.5 38 139.5 39 181.0 40 208.0 41 237.5 42 268.0 43 291.5 44 295.0 45 290.5 46 282.0 47 257.5 48 211.5 49 171.5 50 153.0 51 125.0 52 94.0 53 68.0 54 53.0 55 38.5 56 36.0 57 29.5 58 17.0 59 13.5 60 10.5 61 8.5 62 6.5 63 4.5 64 2.0 65 2.5 66 2.0 67 1.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTG 20 3.5889345E-4 108.74062 8 >>END_MODULE SRR7172664 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172664_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23 34.0 33.0 34.0 33.0 34.0 2 33.30325 34.0 33.0 34.0 33.0 34.0 3 33.33525 34.0 33.0 34.0 33.0 34.0 4 33.34775 34.0 33.0 34.0 33.0 34.0 5 33.3205 34.0 33.0 34.0 33.0 34.0 6 37.4175 38.0 38.0 38.0 38.0 38.0 7 37.42825 38.0 38.0 38.0 38.0 38.0 8 37.4745 38.0 38.0 38.0 38.0 38.0 9 37.44575 38.0 38.0 38.0 38.0 38.0 10-14 37.45765 38.0 38.0 38.0 38.0 38.0 15-19 37.4587 38.0 38.0 38.0 38.0 38.0 20-24 37.4199 38.0 38.0 38.0 38.0 38.0 25-29 37.24875 38.0 38.0 38.0 37.8 38.0 30-34 36.76005 38.0 38.0 38.0 37.2 38.0 35-39 36.97305 38.0 38.0 38.0 37.0 38.0 40-44 37.30645 38.0 38.0 38.0 37.4 38.0 45-49 37.33434999999999 38.0 38.0 38.0 37.8 38.0 50-54 37.31975 38.0 38.0 38.0 37.8 38.0 55-59 37.2433 38.0 38.0 38.0 37.0 38.0 60-64 37.08235 38.0 38.0 38.0 37.0 38.0 65-69 37.005849999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.0097 38.0 38.0 38.0 36.4 38.0 75-79 37.0312 38.0 38.0 38.0 36.4 38.0 80-84 37.018449999999994 38.0 38.0 38.0 36.4 38.0 85-89 36.945100000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.85265 38.0 38.0 38.0 35.8 38.0 95-99 36.7829 38.0 38.0 38.0 35.8 38.0 100-104 36.72375 38.0 38.0 38.0 35.0 38.0 105-109 36.69985 38.0 38.0 38.0 35.0 38.0 110-114 36.52195 38.0 38.0 38.0 34.6 38.0 115-119 36.3478 38.0 38.0 38.0 34.0 38.0 120-124 36.11905 38.0 37.8 38.0 33.6 38.0 125-129 35.923500000000004 38.0 37.6 38.0 33.2 38.0 130-134 35.6671 38.0 36.4 38.0 32.0 38.0 135-139 35.34285 38.0 36.0 38.0 31.0 38.0 140-144 35.030150000000006 38.0 36.0 38.0 30.6 38.0 145-149 34.39335 38.0 35.6 38.0 27.4 38.0 150-151 29.871375 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 5.0 13 1.0 14 2.0 15 5.0 16 2.0 17 2.0 18 4.0 19 2.0 20 4.0 21 4.0 22 6.0 23 7.0 24 9.0 25 10.0 26 9.0 27 22.0 28 11.0 29 19.0 30 14.0 31 45.0 32 60.0 33 85.0 34 129.0 35 249.0 36 479.0 37 2804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.325 14.625 18.175 30.875000000000004 2 24.825 23.05 36.375 15.75 3 20.05 27.525 32.4 20.025000000000002 4 24.45 36.1 20.9 18.55 5 24.474999999999998 36.65 21.9 16.975 6 17.95 38.925 24.2 18.925 7 18.975 16.375 43.974999999999994 20.674999999999997 8 20.724999999999998 21.525 28.875 28.875 9 22.75 24.474999999999998 28.1 24.675 10-14 23.01 29.439999999999998 26.340000000000003 21.21 15-19 23.5 28.310000000000002 28.105000000000004 20.085 20-24 22.23 28.655 27.85 21.265 25-29 22.79847374234361 28.813133848779998 27.693543528466712 20.69484888040968 30-34 23.241621319229008 27.737374764786654 28.118801810507044 20.90220210547729 35-39 22.637705992037493 28.21649952124175 28.23665776344303 20.90913672327773 40-44 23.21 28.470000000000002 28.035 20.285 45-49 22.86 28.18 28.62 20.34 50-54 23.005 28.03 28.610000000000003 20.355 55-59 23.044999999999998 28.63 27.950000000000003 20.375 60-64 23.255 27.905 28.044999999999998 20.794999999999998 65-69 23.25 27.76 28.34 20.65 70-74 22.57 28.78 28.15 20.5 75-79 23.18 28.26 28.375 20.185 80-84 23.119999999999997 28.025 28.1 20.755000000000003 85-89 23.885 28.285 28.225 19.605 90-94 23.72 27.889999999999997 28.125 20.265 95-99 23.695 27.88 28.044999999999998 20.380000000000003 100-104 23.405 28.449999999999996 27.935 20.21 105-109 23.225 27.925 28.43 20.419999999999998 110-114 23.565 28.360000000000003 28.08 19.994999999999997 115-119 23.785 29.054999999999996 27.245 19.915 120-124 24.08 28.494999999999997 27.49 19.935 125-129 24.205 27.925 27.91 19.96 130-134 24.365000000000002 28.71 27.310000000000002 19.615 135-139 23.985 28.78 27.389999999999997 19.845 140-144 24.735 28.444999999999997 27.49 19.33 145-149 24.73 28.28 28.235 18.755 150-151 25.324999999999996 28.475 27.275 18.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.0 25 3.5 26 2.5 27 3.0 28 3.5 29 5.5 30 14.0 31 19.5 32 29.5 33 44.0 34 53.0 35 61.5 36 80.5 37 113.5 38 136.0 39 180.0 40 236.5 41 256.5 42 267.0 43 283.5 44 291.0 45 288.0 46 280.5 47 264.5 48 237.5 49 184.0 50 148.0 51 122.5 52 94.5 53 79.0 54 57.5 55 41.0 56 29.5 57 23.5 58 18.5 59 11.5 60 6.0 61 5.5 62 5.0 63 3.5 64 2.0 65 0.5 66 1.5 67 2.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.41000000000000003 30-34 1.685 35-39 0.7849999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.7249999999999996 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.8 0.0 0.0 0.0 0.0 138-139 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673778 spots for SRR7172664.sra Written 673778 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra Read 673775 spots for SRR7172664.sra Written 673775 spots for SRR7172664.sra SRR ids: ['SRR7172664.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__nfd46d9 SRR7172664.sra spots: 13475503 blocks: [[1, 673775], [673776, 1347550], [1347551, 2021325], [2021326, 2695100], [2695101, 3368875], [3368876, 4042650], [4042651, 4716425], [4716426, 5390200], [5390201, 6063975], [6063976, 6737750], [6737751, 7411525], [7411526, 8085300], [8085301, 8759075], [8759076, 9432850], [9432851, 10106625], [10106626, 10780400], [10780401, 11454175], [11454176, 12127950], [12127951, 12801725], [12801726, 13475503]] SRR7172664 file size 4544705 SRR7172664 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172664 SRR7172664_1.fastq SRR7172664_2.fastq Input file: SRR7172664_1.fastq Paired file: SRR7172664_2.fastq trimmed: SRR7172664-trimmed-pair1.fastq, SRR7172664-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:43:56 2025 >> started Mon Feb 10 11:44:20 2025 >> done (23.069s) 13475503 read pairs processed; of these: 7967 ( 0.06%) short read pairs filtered out after trimming by size control 5848 ( 0.04%) empty read pairs filtered out after trimming by size control 13461688 (99.90%) read pairs available; of these: 5496353 (40.83%) trimmed read pairs available after processing 7965335 (59.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 6 0.00% 37 1 0.00% 38 4 0.00% 39 5 0.00% 40 3 0.00% 41 8 0.00% 42 6 0.00% 43 7 0.00% 44 4 0.00% 45 12 0.00% 46 8 0.00% 47 12 0.00% 48 8 0.00% 49 9 0.00% 50 11 0.00% 51 9 0.00% 52 18 0.00% 53 17 0.00% 54 27 0.00% 55 25 0.00% 56 24 0.00% 57 32 0.00% 58 36 0.00% 59 49 0.00% 60 62 0.00% 61 63 0.00% 62 75 0.00% 63 64 0.00% 64 108 0.00% 65 102 0.00% 66 114 0.00% 67 143 0.00% 68 140 0.00% 69 190 0.00% 70 240 0.00% 71 235 0.00% 72 249 0.00% 73 346 0.00% 74 336 0.00% 75 395 0.00% 76 492 0.00% 77 522 0.00% 78 613 0.00% 79 667 0.00% 80 756 0.01% 81 882 0.01% 82 1073 0.01% 83 1265 0.01% 84 1810 0.01% 85 2240 0.02% 86 2368 0.02% 87 2662 0.02% 88 2898 0.02% 89 2990 0.02% 90 3256 0.02% 91 3573 0.03% 92 3760 0.03% 93 4072 0.03% 94 4422 0.03% 95 4623 0.03% 96 5187 0.04% 97 5601 0.04% 98 5874 0.04% 99 6321 0.05% 100 6965 0.05% 101 7448 0.06% 102 7927 0.06% 103 8477 0.06% 104 8873 0.07% 105 9674 0.07% 106 10205 0.08% 107 10802 0.08% 108 11310 0.08% 109 11958 0.09% 110 12703 0.09% 111 13438 0.10% 112 14293 0.11% 113 14931 0.11% 114 16183 0.12% 115 16800 0.12% 116 17899 0.13% 117 18453 0.14% 118 19228 0.14% 119 20029 0.15% 120 20944 0.16% 121 21995 0.16% 122 22588 0.17% 123 23766 0.18% 124 24989 0.19% 125 25984 0.19% 126 27113 0.20% 127 28511 0.21% 128 29664 0.22% 129 30718 0.23% 130 32031 0.24% 131 33200 0.25% 132 34781 0.26% 133 36827 0.27% 134 38583 0.29% 135 40268 0.30% 136 42481 0.32% 137 44624 0.33% 138 47726 0.35% 139 50829 0.38% 140 53999 0.40% 141 58533 0.43% 142 63562 0.47% 143 69456 0.52% 144 78551 0.58% 145 93700 0.70% 146 115508 0.86% 147 153580 1.14% 148 233111 1.73% 149 566117 4.21% 150 3023867 22.46% 151 7965335 59.17% 13461688 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=73.37 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=8.2 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=21 prefix-density=0.44 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=35.23 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=6.9 sequence=TGATTTTGATCAGTATGGCTGAGGAAAACAAGAGCCATGAGTATGAGACCAAAGTTGGTGAAGAGAGTGGTGCTGTTG SRR7172664 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:45:20 Started mapping on | Feb 10 11:45:20 Finished on | Feb 10 11:47:21 Mapping speed, Million of reads per hour | 400.51 Number of input reads | 13461688 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12715198 Uniquely mapped reads % | 94.45% Average mapped length | 295.91 Number of splices: Total | 12745885 Number of splices: Annotated (sjdb) | 12499831 Number of splices: GT/AG | 12540206 Number of splices: GC/AG | 163644 Number of splices: AT/AC | 9263 Number of splices: Non-canonical | 32772 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292485 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 30105 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 462574 462574 462574 N_multimapping 292485 292485 292485 N_noFeature 393033 12617765 429436 N_ambiguous 128566 391 67322 UnstrandedReadsAssigned:12193599 PositiveStrandReadsAssigned:97042 NegativeStrandReadsAssigned:12218440 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172664 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172664-trimmed-pair1.fastq SRR7172664-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,461,688 reads, 12,110,620 reads pseudoaligned [quant] estimated average fragment length: 241.961 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7172664.ke.tsv 34699 SRR7172664.se.tsv 87100 total ==> SRR7172664.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.04 1489 73.3273 Potri.005G024800.1.v4.1 1035 794.039 1205 132.805 Potri.004G059700.1.v4.1 961 720.077 0 0 Potri.007G009000.2.v4.1 1416 1175.04 0 0 Potri.003G141000.2.v4.1 2943 2702.04 681.253 22.064 Potri.016G087400.1.v4.1 270 78.0579 633 709.667 Potri.015G069301.1.v4.1 564 327.185 0 0 Potri.010G195200.1.v4.1 1773 1532.04 544.966 31.1292 Potri.012G127500.1.v4.1 977 736.055 4428 526.46 ==> SRR7172664.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 617 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 219 SRR7172664 completed mapping pipeline successfully