Starting /dee2/code/volunteer_pipeline.sh SRR7172665 current disk space = 3059110264832 free memory = 1409694504 SRR7172665 SRAfilesize d974f5e66a10aab0bf1fb1b29a83edc3 SRR7172665.sra SRR7172665.sra file validated SRR7172665 is paired end SRR7172665 is conventional basespace SRR7172665 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172665_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.73875 28.0 18.0 32.0 18.0 33.0 2 29.693 31.0 28.0 33.0 25.0 33.0 3 31.6795 33.0 31.0 33.0 28.0 33.0 4 31.34275 33.0 31.0 33.0 29.0 34.0 5 32.08025 33.0 33.0 33.0 29.0 34.0 6 37.2255 38.0 38.0 38.0 36.0 38.0 7 37.54975 38.0 38.0 38.0 37.0 38.0 8 37.50925 38.0 38.0 38.0 38.0 38.0 9 37.649 38.0 38.0 38.0 38.0 38.0 10-14 37.598 38.0 38.0 38.0 38.0 38.0 15-19 37.539300000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5169 38.0 38.0 38.0 38.0 38.0 25-29 37.53705 38.0 38.0 38.0 38.0 38.0 30-34 37.5087 38.0 38.0 38.0 38.0 38.0 35-39 37.52735 38.0 38.0 38.0 38.0 38.0 40-44 37.45455 38.0 38.0 38.0 37.6 38.0 45-49 37.26540000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.3196 38.0 38.0 38.0 37.0 38.0 55-59 37.21105 38.0 38.0 38.0 37.0 38.0 60-64 37.245900000000006 38.0 38.0 38.0 36.8 38.0 65-69 37.18965 38.0 38.0 38.0 36.4 38.0 70-74 37.09925 38.0 38.0 38.0 36.0 38.0 75-79 37.0005 38.0 38.0 38.0 36.0 38.0 80-84 36.96334999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.698 38.0 38.0 38.0 34.6 38.0 90-94 36.8434 38.0 38.0 38.0 35.2 38.0 95-99 36.7611 38.0 38.0 38.0 35.0 38.0 100-104 36.687200000000004 38.0 38.0 38.0 34.6 38.0 105-109 36.271950000000004 38.0 38.0 38.0 33.6 38.0 110-114 36.21755 38.0 38.0 38.0 33.6 38.0 115-119 36.29105 38.0 38.0 38.0 34.0 38.0 120-124 36.20145 38.0 38.0 38.0 33.6 38.0 125-129 35.803999999999995 38.0 36.6 38.0 31.8 38.0 130-134 35.350750000000005 38.0 36.0 38.0 29.4 38.0 135-139 35.153 38.0 35.8 38.0 28.6 38.0 140-144 35.1688 38.0 35.4 38.0 29.8 38.0 145-149 34.771100000000004 38.0 35.2 38.0 29.4 38.0 150-151 31.230875 35.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 2.0 18 1.0 19 1.0 20 3.0 21 0.0 22 3.0 23 4.0 24 6.0 25 8.0 26 17.0 27 16.0 28 23.0 29 25.0 30 32.0 31 54.0 32 74.0 33 95.0 34 160.0 35 280.0 36 632.0 37 2555.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.841996379622444 15.722782518748385 11.792086889061288 39.64313421256788 2 19.42211055276382 20.175879396984925 40.0251256281407 20.376884422110553 3 17.75 27.3 27.400000000000002 27.55 4 21.45 35.05 21.275 22.225 5 20.025000000000002 36.1 24.9 18.975 6 16.725 36.3 27.025 19.950000000000003 7 13.100000000000001 20.674999999999997 46.225 20.0 8 17.0 23.65 30.675 28.675 9 18.65 21.099999999999998 32.15 28.1 10-14 19.835 29.385 27.334999999999997 23.445 15-19 19.265 28.835 28.105000000000004 23.794999999999998 20-24 19.97 28.815 28.235 22.98 25-29 20.055 28.765 28.07 23.11 30-34 20.005 28.64 27.67 23.685000000000002 35-39 20.349999999999998 28.165000000000003 28.575 22.91 40-44 19.7 28.96 27.865000000000002 23.474999999999998 45-49 20.505000000000003 28.205000000000002 27.935 23.355 50-54 20.335 28.235 27.88 23.549999999999997 55-59 20.405 28.37 27.889999999999997 23.335 60-64 20.515 28.505000000000003 27.74 23.24 65-69 19.919999999999998 28.249999999999996 28.294999999999998 23.535 70-74 20.724999999999998 28.895 26.83 23.549999999999997 75-79 20.07 28.865000000000002 28.310000000000002 22.755 80-84 19.98 28.610000000000003 27.834999999999997 23.575 85-89 19.97 28.299999999999997 28.360000000000003 23.369999999999997 90-94 20.599999999999998 28.24 27.71 23.45 95-99 20.16 28.249999999999996 27.99 23.599999999999998 100-104 20.205000000000002 28.53 27.92 23.345 105-109 20.09 28.435 27.555000000000003 23.919999999999998 110-114 20.415 28.794999999999998 27.865000000000002 22.925 115-119 20.715 28.060000000000002 27.765 23.46 120-124 20.87 27.944999999999997 27.825 23.36 125-129 20.369999999999997 28.07 27.785 23.775 130-134 20.615 27.775 28.194999999999997 23.415 135-139 21.185000000000002 27.825 27.18 23.810000000000002 140-144 21.265 27.68 27.455000000000002 23.599999999999998 145-149 20.895 28.244999999999997 27.51 23.35 150-151 20.6375 28.875 27.400000000000002 23.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 5.5 26 7.5 27 9.0 28 10.5 29 11.5 30 20.0 31 26.0 32 27.5 33 36.5 34 57.0 35 71.5 36 90.0 37 119.0 38 142.5 39 167.5 40 212.0 41 245.0 42 264.0 43 287.5 44 281.5 45 276.0 46 277.5 47 253.5 48 213.0 49 184.5 50 159.5 51 133.0 52 106.5 53 79.0 54 60.0 55 44.0 56 31.5 57 21.0 58 13.5 59 11.5 60 9.0 61 5.0 62 3.0 63 3.0 64 5.0 65 3.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGTT 10 0.0068343505 144.975 8 >>END_MODULE SRR7172665 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172665_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04775 34.0 33.0 34.0 32.0 34.0 2 33.0705 34.0 33.0 34.0 32.0 34.0 3 33.132 34.0 33.0 34.0 33.0 34.0 4 33.11275 34.0 33.0 34.0 33.0 34.0 5 33.069 34.0 33.0 34.0 33.0 34.0 6 37.22775 38.0 38.0 38.0 37.0 38.0 7 37.139 38.0 38.0 38.0 37.0 38.0 8 37.186 38.0 38.0 38.0 37.0 38.0 9 37.1775 38.0 38.0 38.0 37.0 38.0 10-14 37.165350000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.164550000000006 38.0 38.0 38.0 37.4 38.0 20-24 37.151700000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.79275 38.0 38.0 38.0 36.8 38.0 30-34 35.95905 38.0 38.0 38.0 35.0 38.0 35-39 36.3609 38.0 38.0 38.0 35.4 38.0 40-44 36.9413 38.0 38.0 38.0 36.6 38.0 45-49 37.022 38.0 38.0 38.0 37.0 38.0 50-54 36.99405 38.0 38.0 38.0 37.0 38.0 55-59 36.87275 38.0 38.0 38.0 36.2 38.0 60-64 36.73235 38.0 38.0 38.0 35.8 38.0 65-69 36.515049999999995 38.0 38.0 38.0 34.6 38.0 70-74 36.65295 38.0 38.0 38.0 35.2 38.0 75-79 36.65495 38.0 38.0 38.0 35.0 38.0 80-84 36.595 38.0 38.0 38.0 35.0 38.0 85-89 36.49405 38.0 38.0 38.0 34.8 38.0 90-94 36.3666 38.0 38.0 38.0 34.0 38.0 95-99 36.2427 38.0 38.0 38.0 34.0 38.0 100-104 36.171 38.0 38.0 38.0 34.0 38.0 105-109 35.95215 38.0 38.0 38.0 33.2 38.0 110-114 35.624649999999995 38.0 37.2 38.0 31.6 38.0 115-119 35.42909999999999 38.0 37.0 38.0 31.0 38.0 120-124 35.11725 38.0 36.2 38.0 28.4 38.0 125-129 34.9698 38.0 36.0 38.0 28.4 38.0 130-134 34.65205 38.0 36.0 38.0 27.0 38.0 135-139 34.0655 38.0 33.6 38.0 24.0 38.0 140-144 33.350049999999996 38.0 33.0 38.0 20.2 38.0 145-149 32.15169999999999 38.0 32.6 38.0 11.0 38.0 150-151 27.18175 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 6.0 4 3.0 5 3.0 6 2.0 7 1.0 8 1.0 9 1.0 10 3.0 11 1.0 12 3.0 13 1.0 14 6.0 15 6.0 16 6.0 17 3.0 18 2.0 19 6.0 20 6.0 21 9.0 22 7.0 23 8.0 24 8.0 25 9.0 26 22.0 27 23.0 28 22.0 29 36.0 30 54.0 31 72.0 32 87.0 33 118.0 34 192.0 35 312.0 36 612.0 37 2339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.475 16.075 16.225 32.225 2 23.775 24.224999999999998 35.949999999999996 16.05 3 21.575 27.224999999999998 30.475 20.724999999999998 4 24.25 35.099999999999994 20.849999999999998 19.8 5 23.799999999999997 37.65 21.575 16.975 6 18.575 37.475 24.675 19.275000000000002 7 18.4 17.25 42.125 22.225 8 20.225 22.325 27.400000000000002 30.049999999999997 9 21.3 25.8 28.549999999999997 24.349999999999998 10-14 23.135 28.89 26.895000000000003 21.08 15-19 23.064999999999998 27.825 28.065 21.044999999999998 20-24 23.080000000000002 28.910000000000004 27.169999999999998 20.84 25-29 22.730709137644272 28.410866387782875 27.71533692858223 21.143087545990625 30-34 22.88833951380305 28.54861969509683 27.894519983518745 20.668520807581377 35-39 22.933685118473793 28.58592521183216 27.71830128367751 20.762088386016543 40-44 23.02 28.685 27.725 20.57 45-49 23.29 28.744999999999997 27.485 20.48 50-54 22.75 28.785 27.875 20.59 55-59 23.085 27.87 28.125 20.919999999999998 60-64 23.365 27.785 28.375 20.474999999999998 65-69 23.405 27.935 28.060000000000002 20.599999999999998 70-74 23.46 27.83 28.33 20.380000000000003 75-79 23.25 28.22 27.765 20.765 80-84 23.49 27.87 28.09 20.549999999999997 85-89 24.355 28.065 27.939999999999998 19.64 90-94 24.175 27.91 27.925 19.99 95-99 23.205000000000002 28.03 27.685 21.08 100-104 23.025000000000002 28.055000000000003 28.144999999999996 20.775 105-109 23.669999999999998 28.310000000000002 27.889999999999997 20.13 110-114 23.985 27.85 27.589999999999996 20.575 115-119 23.455000000000002 28.63 27.495000000000005 20.419999999999998 120-124 23.724999999999998 27.625 27.87 20.78 125-129 23.849999999999998 27.93 27.644999999999996 20.575 130-134 23.43 28.62 27.57 20.380000000000003 135-139 23.794999999999998 27.79 28.060000000000002 20.355 140-144 23.565 27.985 27.505000000000003 20.945 145-149 25.045 28.025 27.165 19.765 150-151 24.762500000000003 27.35 27.237499999999997 20.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 0.5 24 1.5 25 2.5 26 1.0 27 3.0 28 7.5 29 7.5 30 7.5 31 11.0 32 20.5 33 28.5 34 39.5 35 62.5 36 76.0 37 98.0 38 136.0 39 180.0 40 223.5 41 253.0 42 284.0 43 299.5 44 311.0 45 303.0 46 263.0 47 251.5 48 238.0 49 196.5 50 166.0 51 133.5 52 100.0 53 79.5 54 60.0 55 38.5 56 29.5 57 25.0 58 17.0 59 12.5 60 7.5 61 7.0 62 4.5 63 2.5 64 1.5 65 0.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.795 30-34 2.92 35-39 1.455 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.325 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGGC 10 0.0068803662 144.65 2 CTAAAGG 10 0.0068803662 144.65 6 >>END_MODULE Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877535 spots for SRR7172665.sra Written 877535 spots for SRR7172665.sra Read 877544 spots for SRR7172665.sra Written 877544 spots for SRR7172665.sra SRR ids: ['SRR7172665.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lbdj2vrj SRR7172665.sra spots: 17550709 blocks: [[1, 877535], [877536, 1755070], [1755071, 2632605], [2632606, 3510140], [3510141, 4387675], [4387676, 5265210], [5265211, 6142745], [6142746, 7020280], [7020281, 7897815], [7897816, 8775350], [8775351, 9652885], [9652886, 10530420], [10530421, 11407955], [11407956, 12285490], [12285491, 13163025], [13163026, 14040560], [14040561, 14918095], [14918096, 15795630], [15795631, 16673165], [16673166, 17550709]] SRR7172665 file size 5925659 SRR7172665 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172665 SRR7172665_1.fastq SRR7172665_2.fastq Input file: SRR7172665_1.fastq Paired file: SRR7172665_2.fastq trimmed: SRR7172665-trimmed-pair1.fastq, SRR7172665-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:33:51 2025 >> started Mon Feb 10 11:34:09 2025 >> done (18.260s) 17550709 read pairs processed; of these: 16101 ( 0.09%) short read pairs filtered out after trimming by size control 12897 ( 0.07%) empty read pairs filtered out after trimming by size control 17521711 (99.83%) read pairs available; of these: 7732077 (44.13%) trimmed read pairs available after processing 9789634 (55.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 4 0.00% 37 7 0.00% 38 5 0.00% 39 5 0.00% 40 8 0.00% 41 3 0.00% 42 4 0.00% 43 4 0.00% 44 6 0.00% 45 8 0.00% 46 13 0.00% 47 9 0.00% 48 16 0.00% 49 14 0.00% 50 20 0.00% 51 23 0.00% 52 25 0.00% 53 26 0.00% 54 24 0.00% 55 32 0.00% 56 41 0.00% 57 43 0.00% 58 42 0.00% 59 51 0.00% 60 62 0.00% 61 79 0.00% 62 86 0.00% 63 92 0.00% 64 78 0.00% 65 96 0.00% 66 138 0.00% 67 150 0.00% 68 179 0.00% 69 186 0.00% 70 204 0.00% 71 264 0.00% 72 284 0.00% 73 375 0.00% 74 393 0.00% 75 463 0.00% 76 560 0.00% 77 550 0.00% 78 642 0.00% 79 759 0.00% 80 939 0.01% 81 1023 0.01% 82 1175 0.01% 83 1349 0.01% 84 2265 0.01% 85 3022 0.02% 86 3135 0.02% 87 3297 0.02% 88 3473 0.02% 89 3736 0.02% 90 3757 0.02% 91 4225 0.02% 92 4371 0.02% 93 4882 0.03% 94 5302 0.03% 95 5636 0.03% 96 6108 0.03% 97 6258 0.04% 98 6850 0.04% 99 7364 0.04% 100 7876 0.04% 101 8505 0.05% 102 9128 0.05% 103 9881 0.06% 104 10706 0.06% 105 11477 0.07% 106 12011 0.07% 107 12753 0.07% 108 13639 0.08% 109 14168 0.08% 110 15087 0.09% 111 15722 0.09% 112 16856 0.10% 113 17874 0.10% 114 19094 0.11% 115 20083 0.11% 116 21103 0.12% 117 22328 0.13% 118 23252 0.13% 119 23713 0.14% 120 25252 0.14% 121 26747 0.15% 122 27941 0.16% 123 29408 0.17% 124 30937 0.18% 125 32968 0.19% 126 34392 0.20% 127 36261 0.21% 128 37534 0.21% 129 39571 0.23% 130 41574 0.24% 131 43919 0.25% 132 46089 0.26% 133 49300 0.28% 134 52357 0.30% 135 56054 0.32% 136 60016 0.34% 137 63829 0.36% 138 68502 0.39% 139 73321 0.42% 140 79121 0.45% 141 88425 0.50% 142 98707 0.56% 143 111088 0.63% 144 129526 0.74% 145 153792 0.88% 146 188918 1.08% 147 253924 1.45% 148 381375 2.18% 149 755767 4.31% 150 4225937 24.12% 151 9789634 55.87% 17521711 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=82.18 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.6 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGAT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=5.21 fanout-score-rank=17 prefix-density=0.56 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=97.48 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.6 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172665 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:34:52 Started mapping on | Feb 10 11:34:52 Finished on | Feb 10 11:36:52 Mapping speed, Million of reads per hour | 525.65 Number of input reads | 17521711 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16449953 Uniquely mapped reads % | 93.88% Average mapped length | 295.92 Number of splices: Total | 16693004 Number of splices: Annotated (sjdb) | 16415421 Number of splices: GT/AG | 16427872 Number of splices: GC/AG | 214272 Number of splices: AT/AC | 11365 Number of splices: Non-canonical | 39495 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463150 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 42284 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624501 624501 624501 N_multimapping 463150 463150 463150 N_noFeature 373664 16318302 424449 N_ambiguous 167887 674 86620 UnstrandedReadsAssigned:15908402 PositiveStrandReadsAssigned:130977 NegativeStrandReadsAssigned:15938884 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172665 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172665-trimmed-pair1.fastq SRR7172665-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,521,711 reads, 15,814,667 reads pseudoaligned [quant] estimated average fragment length: 245.113 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7172665.ke.tsv 34699 SRR7172665.se.tsv 87100 total ==> SRR7172665.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.89 1312 46.3169 Potri.005G024800.1.v4.1 1035 790.887 348 27.5547 Potri.004G059700.1.v4.1 961 716.898 18 1.57234 Potri.007G009000.2.v4.1 1416 1171.89 0 0 Potri.003G141000.2.v4.1 2943 2698.89 502.147 11.6514 Potri.016G087400.1.v4.1 270 75.3578 1183 983.079 Potri.015G069301.1.v4.1 564 323.618 0 0 Potri.010G195200.1.v4.1 1773 1528.89 373 15.2779 Potri.012G127500.1.v4.1 977 732.887 4265 364.429 ==> SRR7172665.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 418 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 143 SRR7172665 completed mapping pipeline successfully