Starting /dee2/code/volunteer_pipeline.sh SRR7172666 current disk space = 3059016171520 free memory = 1557809548 SRR7172666 SRAfilesize 73d9bfe6c463a4f57dff284c0d75ed95 SRR7172666.sra SRR7172666.sra file validated SRR7172666 is paired end SRR7172666 is conventional basespace SRR7172666 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172666_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.7515 18.0 18.0 18.0 18.0 32.0 2 22.46375 18.0 18.0 27.0 18.0 32.0 3 27.4725 27.0 25.0 32.0 18.0 32.0 4 29.452 32.0 27.0 32.0 25.0 33.0 5 31.75975 33.0 32.0 33.0 30.0 33.0 6 36.056 37.0 36.0 38.0 33.0 38.0 7 36.94475 38.0 37.0 38.0 35.0 38.0 8 37.34975 38.0 38.0 38.0 37.0 38.0 9 37.49525 38.0 38.0 38.0 37.0 38.0 10-14 37.52685 38.0 38.0 38.0 37.8 38.0 15-19 37.5263 38.0 38.0 38.0 38.0 38.0 20-24 37.535849999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4957 38.0 38.0 38.0 38.0 38.0 30-34 37.50145 38.0 38.0 38.0 38.0 38.0 35-39 37.48515 38.0 38.0 38.0 38.0 38.0 40-44 37.4635 38.0 38.0 38.0 38.0 38.0 45-49 37.3371 38.0 38.0 38.0 37.0 38.0 50-54 37.34095000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.3021 38.0 38.0 38.0 37.0 38.0 60-64 37.18945000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.2322 38.0 38.0 38.0 37.0 38.0 70-74 37.16975 38.0 38.0 38.0 36.2 38.0 75-79 37.105399999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.00860000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.76755 38.0 38.0 38.0 35.2 38.0 90-94 36.831999999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.833749999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.745050000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.463350000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2639 38.0 38.0 38.0 33.8 38.0 115-119 36.2716 38.0 38.0 38.0 34.0 38.0 120-124 36.1298 38.0 37.6 38.0 33.4 38.0 125-129 35.927499999999995 38.0 37.0 38.0 32.2 38.0 130-134 35.33115 38.0 36.2 38.0 29.4 38.0 135-139 35.14795 38.0 36.0 38.0 28.2 38.0 140-144 34.92765000000001 38.0 35.6 38.0 28.2 38.0 145-149 34.6268 38.0 35.0 38.0 28.0 38.0 150-151 30.570125 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 4.0 19 3.0 20 1.0 21 6.0 22 4.0 23 3.0 24 6.0 25 7.0 26 18.0 27 20.0 28 23.0 29 29.0 30 34.0 31 61.0 32 88.0 33 100.0 34 141.0 35 280.0 36 801.0 37 2368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.767394616556626 21.07668867445404 7.135601828339258 40.020314880650076 2 18.695106649937266 21.90715181932246 33.29987452948557 26.097867001254706 3 19.075 25.55 25.474999999999998 29.9 4 22.35 32.300000000000004 21.425 23.925 5 21.525 35.425000000000004 23.9 19.15 6 17.375 35.875 26.125 20.625 7 13.450000000000001 22.175 44.3 20.075000000000003 8 16.975 24.375 30.575000000000003 28.075 9 17.125 23.5 32.775 26.6 10-14 19.685 28.925 27.435 23.955000000000002 15-19 18.875 28.71 27.965 24.45 20-24 19.38 28.49 28.04 24.09 25-29 19.715 28.07 28.050000000000004 24.165 30-34 19.365 28.63 28.470000000000002 23.535 35-39 19.580000000000002 28.67 27.82 23.93 40-44 19.435 28.02 28.48 24.065 45-49 19.78 28.244999999999997 27.900000000000002 24.075 50-54 20.115 28.03 27.650000000000002 24.205 55-59 19.814999999999998 28.185 28.015 23.985 60-64 19.945 28.110000000000003 28.110000000000003 23.835 65-69 20.115 27.67 28.139999999999997 24.075 70-74 19.99 28.084999999999997 28.599999999999998 23.325000000000003 75-79 19.735 27.944999999999997 28.04 24.279999999999998 80-84 19.84 28.08 28.110000000000003 23.97 85-89 20.0 27.675 28.51 23.815 90-94 20.385 27.96 27.48 24.175 95-99 19.435 27.994999999999997 28.285 24.285 100-104 19.905 28.044999999999998 28.23 23.82 105-109 20.04 27.534999999999997 28.29 24.135 110-114 20.43908781756351 28.425685137027408 27.700540108021602 23.43468693738748 115-119 20.599999999999998 27.925 27.915 23.56 120-124 20.11 27.625 27.865000000000002 24.4 125-129 20.585 27.735 27.925 23.755000000000003 130-134 20.655 28.315 27.555000000000003 23.474999999999998 135-139 20.625 27.66 27.72 23.995 140-144 21.04 27.334999999999997 27.955000000000002 23.669999999999998 145-149 21.02 28.13 27.0 23.849999999999998 150-151 21.0375 28.212500000000002 27.2625 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.0 27 5.5 28 8.0 29 11.5 30 19.5 31 26.5 32 31.0 33 35.5 34 50.0 35 69.0 36 81.0 37 104.0 38 145.0 39 179.5 40 208.0 41 235.5 42 255.5 43 279.5 44 284.0 45 279.5 46 271.0 47 236.0 48 210.0 49 198.0 50 175.5 51 140.5 52 117.5 53 88.5 54 56.0 55 48.0 56 33.5 57 23.5 58 19.5 59 16.0 60 13.0 61 9.0 62 9.0 63 7.5 64 3.5 65 0.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.3375000000000004 0.0 0.0 0.0 0.0 128-129 3.9 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.9125 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCAA 10 0.006836113 144.9625 4 >>END_MODULE SRR7172666 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172666_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9305 34.0 33.0 34.0 32.0 34.0 2 33.0065 34.0 33.0 34.0 32.0 34.0 3 33.022 34.0 33.0 34.0 32.0 34.0 4 32.99 34.0 33.0 34.0 32.0 34.0 5 33.0285 34.0 33.0 34.0 32.0 34.0 6 37.05475 38.0 38.0 38.0 37.0 38.0 7 37.089 38.0 38.0 38.0 37.0 38.0 8 37.053 38.0 38.0 38.0 37.0 38.0 9 37.0635 38.0 38.0 38.0 37.0 38.0 10-14 37.03175 38.0 38.0 38.0 36.6 38.0 15-19 37.041500000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.07025 38.0 38.0 38.0 37.0 38.0 25-29 36.80915 38.0 38.0 38.0 36.8 38.0 30-34 36.0548 38.0 38.0 38.0 34.8 38.0 35-39 36.3514 38.0 38.0 38.0 35.0 38.0 40-44 36.86569999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.9 38.0 38.0 38.0 36.2 38.0 50-54 36.9221 38.0 38.0 38.0 36.2 38.0 55-59 36.763 38.0 38.0 38.0 36.0 38.0 60-64 36.5756 38.0 38.0 38.0 34.8 38.0 65-69 36.394800000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.5195 38.0 38.0 38.0 35.0 38.0 75-79 36.495450000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.3806 38.0 38.0 38.0 34.6 38.0 85-89 36.330400000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.223 38.0 38.0 38.0 34.0 38.0 95-99 36.1138 38.0 38.0 38.0 33.8 38.0 100-104 35.902499999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.8232 38.0 37.8 38.0 32.8 38.0 110-114 35.62925 38.0 37.4 38.0 31.8 38.0 115-119 35.37035 38.0 37.0 38.0 30.2 38.0 120-124 34.91675 38.0 36.0 38.0 27.8 38.0 125-129 34.921049999999994 38.0 36.0 38.0 28.0 38.0 130-134 34.66335 38.0 35.8 38.0 26.6 38.0 135-139 33.97475 38.0 34.8 38.0 22.6 38.0 140-144 33.5144 38.0 33.0 38.0 21.4 38.0 145-149 32.45145 38.0 33.0 38.0 10.8 38.0 150-151 27.333 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 1.0 5 6.0 6 1.0 7 3.0 8 3.0 9 1.0 10 4.0 11 1.0 12 3.0 13 4.0 14 3.0 15 4.0 16 4.0 17 2.0 18 8.0 19 10.0 20 4.0 21 12.0 22 9.0 23 14.0 24 11.0 25 24.0 26 21.0 27 33.0 28 34.0 29 39.0 30 49.0 31 63.0 32 65.0 33 110.0 34 171.0 35 299.0 36 587.0 37 2384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.7 16.7 18.625 26.974999999999998 2 25.35 24.0 33.425 17.224999999999998 3 21.525 26.224999999999998 32.074999999999996 20.175 4 26.0 34.025 22.0 17.974999999999998 5 24.8 37.15 20.849999999999998 17.2 6 18.875 39.775 22.2 19.15 7 19.175 18.275 41.9 20.65 8 22.025 22.900000000000002 27.474999999999998 27.6 9 22.400000000000002 24.425 28.849999999999998 24.325 10-14 23.380000000000003 29.01 26.19 21.42 15-19 23.165 28.57 27.1 21.165 20-24 22.645 28.970000000000002 27.37 21.015 25-29 23.26002717528056 29.02722560515324 26.893462835287608 20.819284384278596 30-34 22.885138254758118 28.15369619863541 27.809983070845945 21.15118247576053 35-39 23.325740318906607 28.909136927360162 27.147557580359404 20.61756517337383 40-44 23.32 28.74 27.005000000000003 20.935000000000002 45-49 23.145 27.79 28.065 21.0 50-54 23.79 28.325 27.57 20.315 55-59 23.849999999999998 28.33 27.224999999999998 20.595 60-64 23.45 28.28 27.48 20.79 65-69 24.205 27.634999999999998 27.860000000000003 20.3 70-74 23.77 28.48 27.435 20.315 75-79 23.26 27.884999999999998 28.23 20.625 80-84 24.245 28.825 26.87 20.06 85-89 23.91 28.095 27.57 20.424999999999997 90-94 23.535 28.79 27.034999999999997 20.64 95-99 23.93 27.935 27.694999999999997 20.44 100-104 24.04 28.389999999999997 27.555000000000003 20.015 105-109 23.855 28.044999999999998 27.485 20.615 110-114 24.195 28.005000000000003 27.48 20.32 115-119 24.104999999999997 29.03 26.865 20.0 120-124 24.8 28.384999999999998 26.965 19.85 125-129 24.32 27.815 27.644999999999996 20.22 130-134 24.97 28.23 26.979999999999997 19.82 135-139 24.485 27.855 27.884999999999998 19.775000000000002 140-144 25.21 28.335 27.175 19.28 145-149 25.72 28.04 26.805 19.435 150-151 26.2875 27.150000000000002 27.325 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 3.0 26 4.0 27 3.0 28 3.5 29 9.5 30 14.0 31 13.0 32 20.5 33 30.0 34 41.0 35 61.0 36 79.5 37 101.5 38 134.5 39 167.0 40 199.5 41 226.0 42 264.0 43 278.5 44 283.0 45 311.0 46 296.0 47 250.0 48 231.5 49 208.0 50 165.5 51 139.0 52 116.0 53 96.5 54 66.5 55 46.0 56 40.0 57 26.0 58 17.0 59 9.5 60 7.5 61 9.5 62 5.5 63 4.0 64 4.0 65 2.5 66 2.5 67 2.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.645 30-34 2.535 35-39 1.225 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.9499999999999997 0.0 0.0 0.0 0.0 130-131 4.325 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.00743067 18.217884 20-24 >>END_MODULE Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728551 spots for SRR7172666.sra Written 728551 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra Read 728543 spots for SRR7172666.sra Written 728543 spots for SRR7172666.sra SRR ids: ['SRR7172666.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0gz12vam SRR7172666.sra spots: 14570868 blocks: [[1, 728543], [728544, 1457086], [1457087, 2185629], [2185630, 2914172], [2914173, 3642715], [3642716, 4371258], [4371259, 5099801], [5099802, 5828344], [5828345, 6556887], [6556888, 7285430], [7285431, 8013973], [8013974, 8742516], [8742517, 9471059], [9471060, 10199602], [10199603, 10928145], [10928146, 11656688], [11656689, 12385231], [12385232, 13113774], [13113775, 13842317], [13842318, 14570868]] SRR7172666 file size 4915888 SRR7172666 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172666 SRR7172666_1.fastq SRR7172666_2.fastq Input file: SRR7172666_1.fastq Paired file: SRR7172666_2.fastq trimmed: SRR7172666-trimmed-pair1.fastq, SRR7172666-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:41:42 2025 >> started Mon Feb 10 11:41:57 2025 >> done (15.184s) 14570868 read pairs processed; of these: 23091 ( 0.16%) short read pairs filtered out after trimming by size control 16538 ( 0.11%) empty read pairs filtered out after trimming by size control 14531239 (99.73%) read pairs available; of these: 7679735 (52.85%) trimmed read pairs available after processing 6851504 (47.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 5 0.00% 21 0 0.00% 22 4 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 2 0.00% 27 4 0.00% 28 3 0.00% 29 5 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 3 0.00% 34 2 0.00% 35 5 0.00% 36 8 0.00% 37 4 0.00% 38 8 0.00% 39 5 0.00% 40 2 0.00% 41 7 0.00% 42 7 0.00% 43 6 0.00% 44 6 0.00% 45 12 0.00% 46 4 0.00% 47 8 0.00% 48 10 0.00% 49 16 0.00% 50 18 0.00% 51 16 0.00% 52 16 0.00% 53 24 0.00% 54 32 0.00% 55 29 0.00% 56 35 0.00% 57 36 0.00% 58 50 0.00% 59 39 0.00% 60 60 0.00% 61 76 0.00% 62 93 0.00% 63 89 0.00% 64 138 0.00% 65 144 0.00% 66 157 0.00% 67 172 0.00% 68 190 0.00% 69 206 0.00% 70 293 0.00% 71 295 0.00% 72 348 0.00% 73 437 0.00% 74 519 0.00% 75 560 0.00% 76 691 0.00% 77 777 0.01% 78 843 0.01% 79 935 0.01% 80 1072 0.01% 81 1176 0.01% 82 1459 0.01% 83 1862 0.01% 84 2933 0.02% 85 3559 0.02% 86 3785 0.03% 87 4084 0.03% 88 4347 0.03% 89 4536 0.03% 90 4940 0.03% 91 5231 0.04% 92 5623 0.04% 93 6207 0.04% 94 6709 0.05% 95 7117 0.05% 96 7630 0.05% 97 8172 0.06% 98 8741 0.06% 99 9505 0.07% 100 9981 0.07% 101 10945 0.08% 102 11465 0.08% 103 12574 0.09% 104 13476 0.09% 105 14349 0.10% 106 15160 0.10% 107 16049 0.11% 108 17123 0.12% 109 17784 0.12% 110 19016 0.13% 111 20063 0.14% 112 21291 0.15% 113 22463 0.15% 114 23904 0.16% 115 24962 0.17% 116 26386 0.18% 117 27177 0.19% 118 28241 0.19% 119 29795 0.21% 120 30609 0.21% 121 32233 0.22% 122 33364 0.23% 123 35225 0.24% 124 37376 0.26% 125 38605 0.27% 126 39945 0.27% 127 42288 0.29% 128 43006 0.30% 129 45107 0.31% 130 46668 0.32% 131 47633 0.33% 132 50989 0.35% 133 52994 0.36% 134 55074 0.38% 135 58280 0.40% 136 61089 0.42% 137 63949 0.44% 138 66525 0.46% 139 70435 0.48% 140 75402 0.52% 141 80604 0.55% 142 87502 0.60% 143 96114 0.66% 144 107925 0.74% 145 125889 0.87% 146 152246 1.05% 147 202262 1.39% 148 308552 2.12% 149 760226 5.23% 150 4243262 29.20% 151 6851504 47.15% 14531239 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=28 prefix-density=0.21 prefix-fanout=2.0 sequence=GCAATGATTGTCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=363.05 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=33.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=37 prefix-density=0.29 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=312.06 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=30.4 sequence=GAAGAAGAAGAAA SRR7172666 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:43:13 Started mapping on | Feb 10 11:43:13 Finished on | Feb 10 11:45:12 Mapping speed, Million of reads per hour | 439.60 Number of input reads | 14531239 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13521625 Uniquely mapped reads % | 93.05% Average mapped length | 294.06 Number of splices: Total | 14324972 Number of splices: Annotated (sjdb) | 14067354 Number of splices: GT/AG | 14090922 Number of splices: GC/AG | 185738 Number of splices: AT/AC | 10995 Number of splices: Non-canonical | 37317 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350838 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 47873 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 677130 677130 677130 N_multimapping 350838 350838 350838 N_noFeature 317995 13409299 368284 N_ambiguous 127265 521 65056 UnstrandedReadsAssigned:13076365 PositiveStrandReadsAssigned:111805 NegativeStrandReadsAssigned:13088285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172666 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172666-trimmed-pair1.fastq SRR7172666-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,531,239 reads, 13,038,060 reads pseudoaligned [quant] estimated average fragment length: 231.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7172666.ke.tsv 34699 SRR7172666.se.tsv 87100 total ==> SRR7172666.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.63 821 34.3536 Potri.005G024800.1.v4.1 1035 804.629 134 12.4571 Potri.004G059700.1.v4.1 961 730.665 29 2.96884 Potri.007G009000.2.v4.1 1416 1185.63 0 0 Potri.003G141000.2.v4.1 2943 2712.63 359 9.89944 Potri.016G087400.1.v4.1 270 83.1223 1227 1104.16 Potri.015G069301.1.v4.1 564 336.852 0 0 Potri.010G195200.1.v4.1 1773 1542.63 259 12.5587 Potri.012G127500.1.v4.1 977 746.645 8974 899.039 ==> SRR7172666.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 211 SRR7172666 completed mapping pipeline successfully