Starting /dee2/code/volunteer_pipeline.sh SRR7172667 current disk space = 3058899521536 free memory = 1224592944 SRR7172667 SRAfilesize 127ac4b8f3250928d1ba54e20f9f5250 SRR7172667.sra SRR7172667.sra file validated SRR7172667 is paired end SRR7172667 is conventional basespace SRR7172667 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172667_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.7475 18.0 18.0 32.0 18.0 33.0 2 27.03075 27.0 25.0 32.0 18.0 33.0 3 30.42125 32.0 28.0 33.0 27.0 33.0 4 30.701 32.0 32.0 33.0 25.0 33.0 5 32.097 33.0 32.0 33.0 32.0 33.0 6 36.758 38.0 37.0 38.0 35.0 38.0 7 37.02325 38.0 38.0 38.0 35.0 38.0 8 37.395 38.0 38.0 38.0 37.0 38.0 9 37.49475 38.0 38.0 38.0 37.0 38.0 10-14 37.587900000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5934 38.0 38.0 38.0 38.0 38.0 20-24 37.5509 38.0 38.0 38.0 38.0 38.0 25-29 37.5533 38.0 38.0 38.0 38.0 38.0 30-34 37.54775 38.0 38.0 38.0 38.0 38.0 35-39 37.4678 38.0 38.0 38.0 38.0 38.0 40-44 37.45754999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.3098 38.0 38.0 38.0 37.0 38.0 50-54 37.35385 38.0 38.0 38.0 37.0 38.0 55-59 37.312349999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1918 38.0 38.0 38.0 36.6 38.0 65-69 37.23285 38.0 38.0 38.0 37.0 38.0 70-74 37.169850000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.035900000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.01174999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.8284 38.0 38.0 38.0 35.2 38.0 90-94 36.7741 38.0 38.0 38.0 34.8 38.0 95-99 36.84544999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.7469 38.0 38.0 38.0 34.8 38.0 105-109 36.5073 38.0 38.0 38.0 34.0 38.0 110-114 36.2768 38.0 37.8 38.0 33.4 38.0 115-119 36.177499999999995 38.0 37.4 38.0 33.4 38.0 120-124 36.101 38.0 37.4 38.0 33.0 38.0 125-129 35.91394999999999 38.0 37.0 38.0 32.6 38.0 130-134 35.351150000000004 38.0 36.0 38.0 29.4 38.0 135-139 35.082550000000005 38.0 35.8 38.0 28.2 38.0 140-144 34.85305 38.0 35.4 38.0 27.6 38.0 145-149 34.55065 38.0 35.0 38.0 28.0 38.0 150-151 30.834874999999997 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 3.0 20 0.0 21 4.0 22 3.0 23 6.0 24 10.0 25 13.0 26 10.0 27 21.0 28 23.0 29 26.0 30 35.0 31 46.0 32 64.0 33 96.0 34 154.0 35 308.0 36 743.0 37 2431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.79229989868288 13.323201621073963 11.778115501519757 35.1063829787234 2 22.434127979924718 18.318695106649937 37.66624843161857 21.580928481806776 3 20.175 26.3 27.525 26.0 4 23.549999999999997 33.225 23.075000000000003 20.150000000000002 5 21.5 35.5 25.15 17.849999999999998 6 18.0 35.75 25.25 21.0 7 13.975000000000001 20.674999999999997 45.25 20.1 8 17.974999999999998 22.975 29.75 29.299999999999997 9 17.825 23.325000000000003 32.074999999999996 26.775 10-14 19.96 29.86 26.529999999999998 23.65 15-19 20.150000000000002 27.625 28.335 23.89 20-24 20.195 27.855 28.33 23.62 25-29 19.220000000000002 28.37 28.435 23.974999999999998 30-34 19.93 28.325 28.645 23.1 35-39 19.535 28.205000000000002 28.03 24.23 40-44 19.71 28.46 28.18 23.65 45-49 19.55 28.225 28.139999999999997 24.085 50-54 19.695 28.01 28.17 24.125 55-59 20.369999999999997 28.15 27.534999999999997 23.945 60-64 19.785 28.265 28.025 23.925 65-69 19.395 28.09 28.360000000000003 24.154999999999998 70-74 20.055 28.82 27.33 23.794999999999998 75-79 20.3 27.725 27.665 24.310000000000002 80-84 20.035 28.345 27.584999999999997 24.035 85-89 20.185 27.98 27.839999999999996 23.995 90-94 20.31 28.205000000000002 27.744999999999997 23.74 95-99 19.725 28.910000000000004 28.050000000000004 23.315 100-104 20.150000000000002 28.000000000000004 28.555000000000003 23.294999999999998 105-109 20.14 27.950000000000003 28.175 23.735 110-114 20.051002550127507 28.091404570228512 28.291414570728534 23.566178308915443 115-119 20.345 28.075 28.005000000000003 23.575 120-124 20.96 28.17 27.74 23.13 125-129 20.705000000000002 27.76 27.584999999999997 23.95 130-134 20.4 28.275 27.66 23.665 135-139 20.765 28.720000000000002 27.375 23.14 140-144 20.415 27.57 28.005000000000003 24.01 145-149 20.86 27.955000000000002 27.35 23.835 150-151 21.1125 27.525 26.575 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 3.0 23 2.0 24 3.5 25 4.0 26 2.5 27 7.5 28 12.0 29 13.0 30 12.0 31 15.5 32 23.0 33 32.5 34 49.5 35 71.5 36 89.5 37 112.0 38 134.0 39 161.5 40 197.5 41 224.5 42 263.5 43 281.0 44 283.5 45 306.0 46 286.5 47 253.0 48 230.0 49 200.5 50 168.5 51 133.0 52 94.0 53 70.0 54 67.0 55 48.0 56 29.5 57 22.5 58 21.0 59 14.0 60 10.0 61 14.0 62 10.5 63 4.5 64 3.0 65 2.0 66 1.0 67 3.0 68 3.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6749999999999998 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.275 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138-139 3.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGAT 10 0.006577216 146.82278 1 TACATTT 10 0.006832588 144.9875 3 >>END_MODULE SRR7172667 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172667_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0415 34.0 33.0 34.0 32.0 34.0 2 33.11475 34.0 33.0 34.0 32.0 34.0 3 33.122 34.0 33.0 34.0 33.0 34.0 4 33.1085 34.0 33.0 34.0 33.0 34.0 5 33.06575 34.0 33.0 34.0 33.0 34.0 6 37.24125 38.0 38.0 38.0 37.0 38.0 7 37.20725 38.0 38.0 38.0 37.0 38.0 8 37.12075 38.0 38.0 38.0 37.0 38.0 9 37.185 38.0 38.0 38.0 37.0 38.0 10-14 37.13435 38.0 38.0 38.0 37.0 38.0 15-19 37.13735 38.0 38.0 38.0 37.0 38.0 20-24 37.16855 38.0 38.0 38.0 37.0 38.0 25-29 36.89695 38.0 38.0 38.0 36.8 38.0 30-34 36.2485 38.0 38.0 38.0 35.6 38.0 35-39 36.510450000000006 38.0 38.0 38.0 35.6 38.0 40-44 36.96695 38.0 38.0 38.0 36.4 38.0 45-49 36.91355 38.0 38.0 38.0 36.2 38.0 50-54 36.957100000000004 38.0 38.0 38.0 36.4 38.0 55-59 36.84615 38.0 38.0 38.0 36.0 38.0 60-64 36.58415 38.0 38.0 38.0 35.2 38.0 65-69 36.578649999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.613099999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.5313 38.0 38.0 38.0 34.8 38.0 80-84 36.45925 38.0 38.0 38.0 34.4 38.0 85-89 36.397299999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.24785 38.0 38.0 38.0 34.0 38.0 95-99 36.1334 38.0 38.0 38.0 33.8 38.0 100-104 36.08445 38.0 38.0 38.0 33.6 38.0 105-109 35.8262 38.0 37.4 38.0 32.8 38.0 110-114 35.702 38.0 37.2 38.0 31.6 38.0 115-119 35.41005 38.0 37.0 38.0 31.0 38.0 120-124 35.0653 38.0 36.0 38.0 28.2 38.0 125-129 34.933749999999996 38.0 36.0 38.0 28.0 38.0 130-134 34.70455 38.0 35.8 38.0 27.6 38.0 135-139 33.9869 38.0 34.4 38.0 22.8 38.0 140-144 33.50865 38.0 33.0 38.0 21.0 38.0 145-149 32.4867 38.0 33.0 38.0 11.2 38.0 150-151 27.254125000000002 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 9.0 4 2.0 5 2.0 6 3.0 7 1.0 8 0.0 9 1.0 10 6.0 11 1.0 12 0.0 13 2.0 14 2.0 15 3.0 16 4.0 17 4.0 18 1.0 19 9.0 20 13.0 21 11.0 22 8.0 23 10.0 24 9.0 25 15.0 26 21.0 27 23.0 28 19.0 29 35.0 30 53.0 31 65.0 32 95.0 33 113.0 34 177.0 35 306.0 36 661.0 37 2309.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.4 15.575 18.15 27.875 2 25.224999999999998 23.625 34.475 16.675 3 20.05 28.65 31.0 20.3 4 24.15 35.525 21.224999999999998 19.1 5 23.375 37.275000000000006 22.125 17.224999999999998 6 18.475 38.975 23.724999999999998 18.825 7 18.35 17.825 41.075 22.75 8 20.825 23.35 27.825 28.000000000000004 9 22.3 25.15 27.775 24.775 10-14 22.525000000000002 29.385 26.229999999999997 21.86 15-19 22.955000000000002 28.255000000000003 27.834999999999997 20.955 20-24 23.27 28.48 27.74 20.51 25-29 23.143029450196 28.28927530405066 27.776660970951855 20.791034274801486 30-34 22.922094508301406 28.35249042145594 27.816091954022987 20.909323116219667 35-39 22.926558238205878 28.669562582079 27.447216890595012 20.95666228912011 40-44 23.625 28.444999999999997 27.250000000000004 20.68 45-49 23.055 28.000000000000004 28.485 20.46 50-54 23.26 28.525 27.474999999999998 20.74 55-59 23.405 27.705000000000002 27.765 21.125 60-64 22.97 28.15 27.915 20.965 65-69 23.56 28.005000000000003 28.095 20.34 70-74 22.79 28.945 27.73 20.535 75-79 23.794999999999998 28.305000000000003 27.675 20.225 80-84 23.095 28.625 27.500000000000004 20.78 85-89 23.43 28.299999999999997 28.015 20.255000000000003 90-94 23.61 27.55 28.29 20.549999999999997 95-99 23.330000000000002 28.189999999999998 28.144999999999996 20.335 100-104 24.285 28.075 27.500000000000004 20.14 105-109 23.73 28.360000000000003 27.58 20.330000000000002 110-114 23.645 28.105000000000004 27.925 20.325 115-119 24.01 27.875 27.900000000000002 20.215 120-124 23.849999999999998 28.16 27.47 20.52 125-129 24.285 28.610000000000003 27.005000000000003 20.1 130-134 23.7 28.125 27.63 20.544999999999998 135-139 24.14 28.42 27.405 20.035 140-144 24.615000000000002 28.065 27.265 20.055 145-149 23.825 28.935 27.189999999999998 20.05 150-151 24.4875 27.9375 27.575 20.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.0 24 1.0 25 2.0 26 2.5 27 2.5 28 3.5 29 6.0 30 8.0 31 11.5 32 16.0 33 24.0 34 38.5 35 55.0 36 73.0 37 105.0 38 152.5 39 193.0 40 227.5 41 254.5 42 275.0 43 323.5 44 332.5 45 293.0 46 272.5 47 251.5 48 215.5 49 171.5 50 137.5 51 119.5 52 105.5 53 84.5 54 60.5 55 44.0 56 29.5 57 20.5 58 17.5 59 12.5 60 11.0 61 8.0 62 6.5 63 8.0 64 5.0 65 4.0 66 3.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.51 30-34 2.125 35-39 1.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.7000000000000002 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673915 spots for SRR7172667.sra Written 673915 spots for SRR7172667.sra Read 673927 spots for SRR7172667.sra Written 673927 spots for SRR7172667.sra SRR ids: ['SRR7172667.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_62xdq4jy SRR7172667.sra spots: 13478312 blocks: [[1, 673915], [673916, 1347830], [1347831, 2021745], [2021746, 2695660], [2695661, 3369575], [3369576, 4043490], [4043491, 4717405], [4717406, 5391320], [5391321, 6065235], [6065236, 6739150], [6739151, 7413065], [7413066, 8086980], [8086981, 8760895], [8760896, 9434810], [9434811, 10108725], [10108726, 10782640], [10782641, 11456555], [11456556, 12130470], [12130471, 12804385], [12804386, 13478312]] SRR7172667 file size 4545657 SRR7172667 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172667 SRR7172667_1.fastq SRR7172667_2.fastq Input file: SRR7172667_1.fastq Paired file: SRR7172667_2.fastq trimmed: SRR7172667-trimmed-pair1.fastq, SRR7172667-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:04:11 2025 >> started Mon Feb 10 12:04:34 2025 >> done (22.562s) 13478312 read pairs processed; of these: 17810 ( 0.13%) short read pairs filtered out after trimming by size control 12957 ( 0.10%) empty read pairs filtered out after trimming by size control 13447545 (99.77%) read pairs available; of these: 6913021 (51.41%) trimmed read pairs available after processing 6534524 (48.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 4 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 1 0.00% 31 1 0.00% 32 5 0.00% 33 3 0.00% 34 5 0.00% 35 4 0.00% 36 3 0.00% 37 3 0.00% 38 1 0.00% 39 2 0.00% 40 6 0.00% 41 4 0.00% 42 10 0.00% 43 9 0.00% 44 6 0.00% 45 3 0.00% 46 3 0.00% 47 7 0.00% 48 6 0.00% 49 9 0.00% 50 15 0.00% 51 9 0.00% 52 7 0.00% 53 18 0.00% 54 18 0.00% 55 11 0.00% 56 17 0.00% 57 22 0.00% 58 28 0.00% 59 35 0.00% 60 34 0.00% 61 33 0.00% 62 39 0.00% 63 54 0.00% 64 48 0.00% 65 56 0.00% 66 71 0.00% 67 79 0.00% 68 97 0.00% 69 124 0.00% 70 126 0.00% 71 146 0.00% 72 154 0.00% 73 187 0.00% 74 216 0.00% 75 226 0.00% 76 301 0.00% 77 320 0.00% 78 403 0.00% 79 428 0.00% 80 454 0.00% 81 566 0.00% 82 633 0.00% 83 844 0.01% 84 1763 0.01% 85 2254 0.02% 86 2334 0.02% 87 2431 0.02% 88 2635 0.02% 89 2533 0.02% 90 2623 0.02% 91 2782 0.02% 92 3103 0.02% 93 3208 0.02% 94 3402 0.03% 95 3659 0.03% 96 3786 0.03% 97 3964 0.03% 98 4330 0.03% 99 4762 0.04% 100 5045 0.04% 101 5388 0.04% 102 5858 0.04% 103 6315 0.05% 104 6648 0.05% 105 7360 0.05% 106 7713 0.06% 107 8234 0.06% 108 8730 0.06% 109 9268 0.07% 110 9820 0.07% 111 10365 0.08% 112 11208 0.08% 113 11990 0.09% 114 12856 0.10% 115 13535 0.10% 116 14406 0.11% 117 15049 0.11% 118 15505 0.12% 119 16415 0.12% 120 17265 0.13% 121 18152 0.13% 122 19372 0.14% 123 20655 0.15% 124 21603 0.16% 125 22577 0.17% 126 23610 0.18% 127 25070 0.19% 128 25876 0.19% 129 27919 0.21% 130 28987 0.22% 131 30895 0.23% 132 32876 0.24% 133 34255 0.25% 134 37094 0.28% 135 39185 0.29% 136 42114 0.31% 137 44531 0.33% 138 48097 0.36% 139 51618 0.38% 140 56142 0.42% 141 63175 0.47% 142 70148 0.52% 143 78595 0.58% 144 91588 0.68% 145 109434 0.81% 146 138576 1.03% 147 191825 1.43% 148 305770 2.27% 149 772183 5.74% 150 4166624 30.98% 151 6534524 48.59% 13447545 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=34 prefix-density=0.28 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=15.21 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=CACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGA criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.45 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=211.53 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=13.0 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7172667 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:05:17 Started mapping on | Feb 10 12:05:17 Finished on | Feb 10 12:07:01 Mapping speed, Million of reads per hour | 465.49 Number of input reads | 13447545 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12504105 Uniquely mapped reads % | 92.98% Average mapped length | 296.24 Number of splices: Total | 12823633 Number of splices: Annotated (sjdb) | 12587520 Number of splices: GT/AG | 12621361 Number of splices: GC/AG | 161472 Number of splices: AT/AC | 9639 Number of splices: Non-canonical | 31161 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383229 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 55511 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577067 577067 577067 N_multimapping 383229 383229 383229 N_noFeature 298707 12395185 344310 N_ambiguous 125083 654 61456 UnstrandedReadsAssigned:12080315 PositiveStrandReadsAssigned:108266 NegativeStrandReadsAssigned:12098339 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172667 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172667-trimmed-pair1.fastq SRR7172667-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,447,545 reads, 12,075,458 reads pseudoaligned [quant] estimated average fragment length: 252.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7172667.ke.tsv 34699 SRR7172667.se.tsv 87100 total ==> SRR7172667.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.8 1509 68.289 Potri.005G024800.1.v4.1 1035 783.796 332 33.8675 Potri.004G059700.1.v4.1 961 709.816 141 15.8826 Potri.007G009000.2.v4.1 1416 1164.8 0 0 Potri.003G141000.2.v4.1 2943 2691.8 477 14.1685 Potri.016G087400.1.v4.1 270 73.2909 740 807.291 Potri.015G069301.1.v4.1 564 317.878 0 0 Potri.010G195200.1.v4.1 1773 1521.8 306 16.0773 Potri.012G127500.1.v4.1 977 725.806 2017 222.194 ==> SRR7172667.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 264 SRR7172667 completed mapping pipeline successfully