Starting /dee2/code/volunteer_pipeline.sh SRR7172668 current disk space = 3058674110464 free memory = 1440391392 SRR7172668 SRAfilesize bde89ab456f5bb2564d139fa6b5b9c67 SRR7172668.sra SRR7172668.sra file validated SRR7172668 is paired end SRR7172668 is conventional basespace SRR7172668 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172668_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.29675 18.0 18.0 32.0 18.0 33.0 2 30.73225 32.0 32.0 33.0 27.0 33.0 3 31.1215 32.0 32.0 33.0 27.0 33.0 4 32.03575 33.0 32.0 33.0 31.0 33.0 5 32.3845 33.0 33.0 33.0 32.0 34.0 6 36.9655 38.0 37.0 38.0 36.0 38.0 7 37.42375 38.0 38.0 38.0 37.0 38.0 8 37.473 38.0 38.0 38.0 37.0 38.0 9 37.51925 38.0 38.0 38.0 38.0 38.0 10-14 37.54469999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.525 38.0 38.0 38.0 38.0 38.0 20-24 37.48155 38.0 38.0 38.0 38.0 38.0 25-29 37.48375 38.0 38.0 38.0 37.8 38.0 30-34 37.48955 38.0 38.0 38.0 38.0 38.0 35-39 37.443149999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.39865 38.0 38.0 38.0 37.6 38.0 45-49 37.251850000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.299749999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.22855 38.0 38.0 38.0 36.8 38.0 60-64 37.1565 38.0 38.0 38.0 36.4 38.0 65-69 37.177949999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.1078 38.0 38.0 38.0 36.2 38.0 75-79 37.004450000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.94445 38.0 38.0 38.0 36.0 38.0 85-89 36.819100000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.7882 38.0 38.0 38.0 35.2 38.0 95-99 36.8146 38.0 38.0 38.0 35.2 38.0 100-104 36.6443 38.0 38.0 38.0 34.6 38.0 105-109 36.459250000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.2929 38.0 37.8 38.0 33.8 38.0 115-119 36.265249999999995 38.0 37.6 38.0 33.8 38.0 120-124 36.08135 38.0 37.2 38.0 32.8 38.0 125-129 35.8365 38.0 36.8 38.0 32.2 38.0 130-134 35.362199999999994 38.0 36.0 38.0 29.6 38.0 135-139 35.12215 38.0 36.0 38.0 28.2 38.0 140-144 34.91465000000001 38.0 35.4 38.0 28.0 38.0 145-149 34.5669 38.0 35.2 38.0 27.8 38.0 150-151 30.39725 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 1.0 19 3.0 20 2.0 21 2.0 22 3.0 23 10.0 24 8.0 25 11.0 26 10.0 27 18.0 28 27.0 29 32.0 30 32.0 31 37.0 32 77.0 33 84.0 34 158.0 35 293.0 36 693.0 37 2491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.03465851172273 12.181447502548421 12.359836901121305 39.42405708460755 2 20.246169304194925 18.6887716654107 40.49233860838985 20.57272042200452 3 19.7 25.05 26.825 28.425 4 22.900000000000002 34.675 20.925 21.5 5 21.15 36.775000000000006 23.7 18.375 6 17.075000000000003 35.525 26.924999999999997 20.474999999999998 7 13.450000000000001 22.25 44.824999999999996 19.475 8 18.575 21.5 31.075000000000003 28.849999999999998 9 17.0 21.975 32.425 28.599999999999998 10-14 19.439999999999998 28.939999999999998 27.495000000000005 24.125 15-19 19.564999999999998 28.525 28.310000000000002 23.599999999999998 20-24 19.835 28.02 28.439999999999998 23.705000000000002 25-29 19.93 28.994999999999997 27.83 23.244999999999997 30-34 19.830000000000002 27.98 28.23 23.96 35-39 20.05 28.185 27.985 23.78 40-44 20.53 28.599999999999998 28.060000000000002 22.81 45-49 20.26 28.27 27.62 23.849999999999998 50-54 20.055 28.225 27.900000000000002 23.82 55-59 19.994999999999997 28.455000000000002 27.46 24.09 60-64 19.875 28.605000000000004 27.37 24.15 65-69 20.625 27.495000000000005 28.505000000000003 23.375 70-74 20.54 28.549999999999997 27.38 23.53 75-79 19.975 28.215 28.189999999999998 23.62 80-84 20.36 28.754999999999995 27.384999999999998 23.5 85-89 19.67 28.410000000000004 28.095 23.825 90-94 19.915 28.29 27.98 23.815 95-99 20.705000000000002 28.275 27.47 23.549999999999997 100-104 20.349999999999998 27.57 28.405 23.674999999999997 105-109 20.419999999999998 27.515 27.91 24.154999999999998 110-114 20.595 28.34 28.175 22.89 115-119 20.525 28.310000000000002 27.634999999999998 23.53 120-124 20.32 27.62 28.21 23.849999999999998 125-129 20.560000000000002 27.625 28.09 23.724999999999998 130-134 20.705000000000002 28.365000000000002 27.37 23.56 135-139 20.244999999999997 28.005000000000003 27.52 24.23 140-144 20.515 28.005000000000003 27.54 23.94 145-149 20.695 28.03 27.145000000000003 24.13 150-151 20.5875 27.5875 28.000000000000004 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 2.0 26 3.0 27 3.5 28 6.5 29 14.5 30 17.5 31 20.5 32 25.5 33 37.5 34 48.5 35 60.5 36 87.0 37 104.0 38 129.5 39 164.5 40 202.0 41 232.0 42 269.0 43 299.5 44 295.5 45 282.5 46 267.5 47 256.0 48 236.0 49 198.5 50 165.5 51 139.5 52 107.0 53 87.0 54 68.5 55 42.5 56 32.5 57 27.0 58 16.0 59 12.5 60 9.0 61 5.5 62 5.0 63 3.0 64 2.0 65 1.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9875 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.5999999999999996 0.0 0.0 0.0 0.0 132-133 2.9000000000000004 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172668 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172668_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0045 34.0 33.0 34.0 32.0 34.0 2 33.05025 34.0 33.0 34.0 32.0 34.0 3 33.14175 34.0 33.0 34.0 33.0 34.0 4 33.08325 34.0 33.0 34.0 33.0 34.0 5 33.1325 34.0 33.0 34.0 33.0 34.0 6 37.33975 38.0 38.0 38.0 37.0 38.0 7 37.2885 38.0 38.0 38.0 38.0 38.0 8 37.23375 38.0 38.0 38.0 37.0 38.0 9 37.20375 38.0 38.0 38.0 37.0 38.0 10-14 37.1255 38.0 38.0 38.0 36.8 38.0 15-19 37.19375 38.0 38.0 38.0 37.0 38.0 20-24 37.2336 38.0 38.0 38.0 37.2 38.0 25-29 36.88345 38.0 38.0 38.0 36.8 38.0 30-34 36.10795 38.0 38.0 38.0 35.4 38.0 35-39 36.455650000000006 38.0 38.0 38.0 35.8 38.0 40-44 37.033249999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.029 38.0 38.0 38.0 36.8 38.0 50-54 37.0403 38.0 38.0 38.0 37.0 38.0 55-59 36.8879 38.0 38.0 38.0 36.0 38.0 60-64 36.67845 38.0 38.0 38.0 35.2 38.0 65-69 36.5405 38.0 38.0 38.0 34.8 38.0 70-74 36.6899 38.0 38.0 38.0 35.2 38.0 75-79 36.678399999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.5539 38.0 38.0 38.0 34.8 38.0 85-89 36.494550000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.376050000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.2157 38.0 38.0 38.0 34.0 38.0 100-104 36.22155 38.0 38.0 38.0 33.8 38.0 105-109 36.067750000000004 38.0 38.0 38.0 33.6 38.0 110-114 35.85545 38.0 37.4 38.0 32.4 38.0 115-119 35.68294999999999 38.0 37.0 38.0 31.4 38.0 120-124 35.287400000000005 38.0 36.2 38.0 28.8 38.0 125-129 35.22505 38.0 36.0 38.0 29.0 38.0 130-134 34.96965 38.0 35.8 38.0 28.0 38.0 135-139 34.3416 38.0 35.0 38.0 24.6 38.0 140-144 33.75675 38.0 33.0 38.0 23.0 38.0 145-149 32.63735 38.0 33.0 38.0 14.6 38.0 150-151 27.656875 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 4.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 2.0 13 2.0 14 0.0 15 2.0 16 5.0 17 1.0 18 3.0 19 5.0 20 5.0 21 6.0 22 6.0 23 11.0 24 16.0 25 18.0 26 21.0 27 31.0 28 30.0 29 37.0 30 47.0 31 57.0 32 74.0 33 119.0 34 180.0 35 326.0 36 575.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.9 15.85 16.275000000000002 32.975 2 22.625 23.175 37.5 16.7 3 21.55 26.35 30.8 21.3 4 24.875 33.775 21.825 19.525000000000002 5 24.525 35.75 22.35 17.375 6 17.825 38.45 22.925 20.8 7 18.15 17.575 42.675000000000004 21.6 8 20.8 22.95 28.025 28.225 9 22.05 25.374999999999996 28.075 24.5 10-14 23.18 28.360000000000003 26.68 21.78 15-19 22.650000000000002 28.575 27.950000000000003 20.825 20-24 22.875 28.215 27.725 21.185000000000002 25-29 22.7881902458686 28.980249899234177 27.4385328496574 20.79302700523982 30-34 22.973320310491953 27.851745232097873 27.91857297075001 21.256361486660154 35-39 23.087445536528524 27.748505421015302 27.88529739588611 21.27875164657007 40-44 23.39 28.49 27.345000000000002 20.775 45-49 23.235 28.360000000000003 27.375 21.029999999999998 50-54 23.62 28.515 27.63 20.235 55-59 23.72 27.750000000000004 27.955000000000002 20.575 60-64 23.06 27.755000000000003 28.165000000000003 21.02 65-69 23.36 28.13 27.834999999999997 20.674999999999997 70-74 23.369999999999997 28.139999999999997 27.665 20.825 75-79 23.625 28.435 27.500000000000004 20.44 80-84 23.674999999999997 28.134999999999998 27.415 20.775 85-89 23.445 27.205000000000002 28.42 20.93 90-94 23.84 28.03 27.689999999999998 20.44 95-99 23.935000000000002 28.015 27.905 20.145 100-104 23.355 27.884999999999998 28.235 20.525 105-109 23.255 28.645 27.705000000000002 20.395 110-114 23.82 27.42 28.575 20.185 115-119 24.065 28.199999999999996 27.735 20.0 120-124 23.830000000000002 28.395 26.945000000000004 20.830000000000002 125-129 23.61 28.110000000000003 27.625 20.655 130-134 24.03 28.185 27.62 20.165 135-139 23.9 28.025 27.88 20.195 140-144 24.575 27.650000000000002 27.305 20.47 145-149 24.375 28.07 27.595 19.96 150-151 24.775 27.950000000000003 27.237499999999997 20.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 0.5 26 0.5 27 2.0 28 4.0 29 4.0 30 8.0 31 13.5 32 16.5 33 30.5 34 43.5 35 54.0 36 83.5 37 104.0 38 138.5 39 170.5 40 205.5 41 245.0 42 269.0 43 300.5 44 300.5 45 290.0 46 276.0 47 260.5 48 228.5 49 195.0 50 178.0 51 143.0 52 107.0 53 82.5 54 59.0 55 47.5 56 38.5 57 23.5 58 19.5 59 13.0 60 9.5 61 9.5 62 5.0 63 3.0 64 1.5 65 2.5 66 3.0 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.76 30-34 2.735 35-39 1.31 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.675 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735170 spots for SRR7172668.sra Written 735170 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra Read 735158 spots for SRR7172668.sra Written 735158 spots for SRR7172668.sra SRR ids: ['SRR7172668.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_90tox759 SRR7172668.sra spots: 14703172 blocks: [[1, 735158], [735159, 1470316], [1470317, 2205474], [2205475, 2940632], [2940633, 3675790], [3675791, 4410948], [4410949, 5146106], [5146107, 5881264], [5881265, 6616422], [6616423, 7351580], [7351581, 8086738], [8086739, 8821896], [8821897, 9557054], [9557055, 10292212], [10292213, 11027370], [11027371, 11762528], [11762529, 12497686], [12497687, 13232844], [13232845, 13968002], [13968003, 14703172]] SRR7172668 file size 4960722 SRR7172668 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172668 SRR7172668_1.fastq SRR7172668_2.fastq Input file: SRR7172668_1.fastq Paired file: SRR7172668_2.fastq trimmed: SRR7172668-trimmed-pair1.fastq, SRR7172668-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:33:50 2025 >> started Mon Feb 10 12:34:11 2025 >> done (21.430s) 14703172 read pairs processed; of these: 13492 ( 0.09%) short read pairs filtered out after trimming by size control 12104 ( 0.08%) empty read pairs filtered out after trimming by size control 14677576 (99.83%) read pairs available; of these: 7401234 (50.43%) trimmed read pairs available after processing 7276342 (49.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 0 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 4 0.00% 36 1 0.00% 37 0 0.00% 38 3 0.00% 39 1 0.00% 40 4 0.00% 41 5 0.00% 42 2 0.00% 43 3 0.00% 44 6 0.00% 45 5 0.00% 46 7 0.00% 47 6 0.00% 48 14 0.00% 49 9 0.00% 50 16 0.00% 51 18 0.00% 52 13 0.00% 53 21 0.00% 54 24 0.00% 55 20 0.00% 56 26 0.00% 57 30 0.00% 58 31 0.00% 59 39 0.00% 60 56 0.00% 61 38 0.00% 62 57 0.00% 63 53 0.00% 64 72 0.00% 65 65 0.00% 66 77 0.00% 67 87 0.00% 68 98 0.00% 69 139 0.00% 70 137 0.00% 71 156 0.00% 72 198 0.00% 73 216 0.00% 74 241 0.00% 75 309 0.00% 76 362 0.00% 77 382 0.00% 78 416 0.00% 79 511 0.00% 80 523 0.00% 81 657 0.00% 82 771 0.01% 83 895 0.01% 84 1658 0.01% 85 2064 0.01% 86 2251 0.02% 87 2390 0.02% 88 2526 0.02% 89 2665 0.02% 90 2851 0.02% 91 2950 0.02% 92 3139 0.02% 93 3358 0.02% 94 3787 0.03% 95 3843 0.03% 96 4180 0.03% 97 4450 0.03% 98 4921 0.03% 99 5284 0.04% 100 5570 0.04% 101 5741 0.04% 102 6486 0.04% 103 7223 0.05% 104 7560 0.05% 105 8159 0.06% 106 8715 0.06% 107 9305 0.06% 108 9654 0.07% 109 10233 0.07% 110 10999 0.07% 111 11763 0.08% 112 12463 0.08% 113 13306 0.09% 114 14199 0.10% 115 14975 0.10% 116 15970 0.11% 117 16628 0.11% 118 17116 0.12% 119 18340 0.12% 120 19297 0.13% 121 20233 0.14% 122 21086 0.14% 123 22262 0.15% 124 23620 0.16% 125 24794 0.17% 126 26036 0.18% 127 27901 0.19% 128 28924 0.20% 129 30311 0.21% 130 32145 0.22% 131 33624 0.23% 132 35613 0.24% 133 37528 0.26% 134 40172 0.27% 135 42523 0.29% 136 45195 0.31% 137 48163 0.33% 138 51076 0.35% 139 55246 0.38% 140 60066 0.41% 141 66766 0.45% 142 74309 0.51% 143 83307 0.57% 144 96329 0.66% 145 114945 0.78% 146 144508 0.98% 147 197421 1.35% 148 315041 2.15% 149 798026 5.44% 150 4501193 30.67% 151 7276342 49.57% 14677576 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=33.96 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=9.4 sequence=AGCACCAAGTGGAG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=13 prefix-density=0.48 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.16 sequence-density-rank=12 fanout-score=16.13 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172668 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:35:03 Started mapping on | Feb 10 12:35:04 Finished on | Feb 10 12:36:43 Mapping speed, Million of reads per hour | 533.73 Number of input reads | 14677576 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13924174 Uniquely mapped reads % | 94.87% Average mapped length | 296.34 Number of splices: Total | 14192944 Number of splices: Annotated (sjdb) | 13961413 Number of splices: GT/AG | 13972233 Number of splices: GC/AG | 177901 Number of splices: AT/AC | 10471 Number of splices: Non-canonical | 32339 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356543 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 40273 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 409568 409568 409568 N_multimapping 356543 356543 356543 N_noFeature 303498 13817561 343928 N_ambiguous 135383 586 68837 UnstrandedReadsAssigned:13485293 PositiveStrandReadsAssigned:106027 NegativeStrandReadsAssigned:13511409 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172668 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172668-trimmed-pair1.fastq SRR7172668-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,677,576 reads, 13,413,488 reads pseudoaligned [quant] estimated average fragment length: 247.443 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR7172668.ke.tsv 34699 SRR7172668.se.tsv 87100 total ==> SRR7172668.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.56 985.467 44.1444 Potri.005G024800.1.v4.1 1035 788.557 237 23.8509 Potri.004G059700.1.v4.1 961 714.588 38 4.22004 Potri.007G009000.2.v4.1 1416 1169.56 0 0 Potri.003G141000.2.v4.1 2943 2696.56 567.165 16.6912 Potri.016G087400.1.v4.1 270 73.7668 886 953.15 Potri.015G069301.1.v4.1 564 321.895 0 0 Potri.010G195200.1.v4.1 1773 1526.56 150 7.79771 Potri.012G127500.1.v4.1 977 730.567 2046 222.246 ==> SRR7172668.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 211 SRR7172668 completed mapping pipeline successfully