Starting /dee2/code/volunteer_pipeline.sh SRR7172669 current disk space = 3058882945024 free memory = 1516743024 SRR7172669 SRAfilesize 65aa23cc0e71cbb52641dda9d64009cb SRR7172669.sra SRR7172669.sra file validated SRR7172669 is paired end SRR7172669 is conventional basespace SRR7172669 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172669_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.03575 32.0 28.0 33.0 18.0 34.0 2 31.385 33.0 32.0 33.0 27.0 34.0 3 31.77875 33.0 31.0 33.0 28.0 34.0 4 32.13625 33.0 32.0 33.0 31.0 34.0 5 32.346 33.0 33.0 33.0 31.0 34.0 6 37.15275 38.0 37.0 38.0 36.0 38.0 7 37.48 38.0 38.0 38.0 37.0 38.0 8 37.5995 38.0 38.0 38.0 38.0 38.0 9 37.634 38.0 38.0 38.0 38.0 38.0 10-14 37.63415 38.0 38.0 38.0 38.0 38.0 15-19 37.602 38.0 38.0 38.0 38.0 38.0 20-24 37.558949999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.57965 38.0 38.0 38.0 38.0 38.0 30-34 37.548 38.0 38.0 38.0 38.0 38.0 35-39 37.549800000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.47625 38.0 38.0 38.0 38.0 38.0 45-49 37.435249999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.3952 38.0 38.0 38.0 37.6 38.0 55-59 37.32424999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.273900000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.205 38.0 38.0 38.0 36.8 38.0 70-74 37.13485 38.0 38.0 38.0 36.8 38.0 75-79 37.049299999999995 38.0 38.0 38.0 36.2 38.0 80-84 36.926750000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.831900000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.822199999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.821349999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.7378 38.0 38.0 38.0 35.0 38.0 105-109 36.56165 38.0 38.0 38.0 34.0 38.0 110-114 36.2984 38.0 38.0 38.0 33.8 38.0 115-119 36.076499999999996 38.0 37.6 38.0 33.4 38.0 120-124 36.13985 38.0 37.8 38.0 33.4 38.0 125-129 35.9335 38.0 37.0 38.0 32.2 38.0 130-134 35.328649999999996 38.0 36.2 38.0 29.4 38.0 135-139 35.047900000000006 38.0 36.0 38.0 28.6 38.0 140-144 34.82245 38.0 35.4 38.0 27.8 38.0 145-149 34.362350000000006 38.0 35.0 38.0 26.8 38.0 150-151 30.2915 35.5 28.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 1.0 18 2.0 19 0.0 20 4.0 21 3.0 22 4.0 23 5.0 24 6.0 25 11.0 26 11.0 27 22.0 28 26.0 29 31.0 30 42.0 31 36.0 32 54.0 33 83.0 34 146.0 35 254.0 36 580.0 37 2670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.54517453798768 13.75770020533881 12.602669404517453 42.09445585215606 2 17.893401015228427 19.77157360406091 40.27918781725888 22.055837563451778 3 18.975 24.525 27.150000000000002 29.349999999999998 4 24.75 31.3 22.0 21.95 5 21.05 34.25 25.05 19.650000000000002 6 16.475 35.925000000000004 25.85 21.75 7 13.3 20.925 47.025 18.75 8 18.6 21.6 31.0 28.799999999999997 9 17.25 22.975 33.675 26.1 10-14 19.689999999999998 29.215000000000003 27.57 23.525 15-19 19.595000000000002 27.975 28.625 23.805 20-24 19.265 28.754999999999995 27.985 23.995 25-29 19.81 28.575 28.360000000000003 23.255 30-34 19.505 28.155 29.005 23.335 35-39 20.04 28.249999999999996 28.525 23.185 40-44 19.685 28.910000000000004 27.944999999999997 23.46 45-49 19.705000000000002 29.09 27.26 23.945 50-54 20.155 28.044999999999998 27.92 23.880000000000003 55-59 19.6 28.33 27.725 24.345 60-64 20.1 28.48 27.584999999999997 23.835 65-69 20.025000000000002 28.07 28.125 23.78 70-74 19.84 28.065 28.405 23.69 75-79 19.46 28.54 28.249999999999996 23.75 80-84 20.3 27.744999999999997 27.55 24.404999999999998 85-89 19.634999999999998 27.985 28.634999999999998 23.745 90-94 20.69 27.51 28.155 23.645 95-99 20.345 28.09 28.084999999999997 23.48 100-104 20.11 27.655 28.255000000000003 23.98 105-109 20.395 28.23 28.4 22.975 110-114 20.765574180635475 27.88591443582687 27.790843132349263 23.55766825118839 115-119 20.462294424388286 27.84797432811873 28.16385880465303 23.52587244283995 120-124 20.255000000000003 28.345 27.73 23.669999999999998 125-129 20.705000000000002 28.189999999999998 27.355 23.75 130-134 20.805 28.53 27.229999999999997 23.435 135-139 20.405 28.610000000000003 27.255000000000003 23.73 140-144 21.055 27.450000000000003 27.275 24.22 145-149 20.05 28.625 27.145000000000003 24.18 150-151 20.45 28.625 27.287499999999998 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 2.0 19 3.0 20 2.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 3.5 27 4.5 28 6.0 29 11.5 30 16.5 31 22.5 32 33.0 33 46.5 34 61.5 35 74.5 36 98.5 37 119.5 38 138.0 39 179.5 40 204.5 41 217.0 42 259.5 43 272.5 44 261.5 45 274.5 46 267.5 47 247.0 48 221.5 49 186.5 50 163.5 51 147.5 52 116.0 53 82.0 54 62.5 55 49.5 56 41.0 57 32.0 58 18.5 59 10.5 60 8.0 61 6.5 62 6.5 63 4.5 64 2.0 65 0.5 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.27999999999999997 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.8375000000000004 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172669 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172669_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06375 34.0 33.0 34.0 32.0 34.0 2 33.1515 34.0 33.0 34.0 33.0 34.0 3 33.05625 34.0 33.0 34.0 32.0 34.0 4 33.16025 34.0 33.0 34.0 33.0 34.0 5 33.14975 34.0 33.0 34.0 33.0 34.0 6 37.3375 38.0 38.0 38.0 37.0 38.0 7 37.317 38.0 38.0 38.0 38.0 38.0 8 37.223 38.0 38.0 38.0 37.0 38.0 9 37.223 38.0 38.0 38.0 37.0 38.0 10-14 37.21855 38.0 38.0 38.0 37.0 38.0 15-19 37.20185 38.0 38.0 38.0 37.0 38.0 20-24 37.21255000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.87975 38.0 38.0 38.0 36.8 38.0 30-34 36.28485 38.0 38.0 38.0 36.0 38.0 35-39 36.52335 38.0 38.0 38.0 36.0 38.0 40-44 37.0988 38.0 38.0 38.0 36.8 38.0 45-49 37.11465 38.0 38.0 38.0 37.0 38.0 50-54 37.08655 38.0 38.0 38.0 37.0 38.0 55-59 36.959950000000006 38.0 38.0 38.0 36.4 38.0 60-64 36.8347 38.0 38.0 38.0 36.0 38.0 65-69 36.768299999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.74825 38.0 38.0 38.0 35.8 38.0 75-79 36.7531 38.0 38.0 38.0 35.8 38.0 80-84 36.6357 38.0 38.0 38.0 35.0 38.0 85-89 36.52835 38.0 38.0 38.0 34.8 38.0 90-94 36.445550000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.37765 38.0 38.0 38.0 34.0 38.0 100-104 36.23695 38.0 38.0 38.0 34.0 38.0 105-109 36.1854 38.0 38.0 38.0 33.8 38.0 110-114 36.0321 38.0 38.0 38.0 33.6 38.0 115-119 35.80575 38.0 37.4 38.0 32.2 38.0 120-124 35.569100000000006 38.0 37.0 38.0 31.2 38.0 125-129 35.3228 38.0 36.6 38.0 30.0 38.0 130-134 34.84635 38.0 36.0 38.0 27.4 38.0 135-139 34.71625 38.0 36.0 38.0 27.6 38.0 140-144 34.216100000000004 38.0 34.6 38.0 24.8 38.0 145-149 33.2761 38.0 33.6 38.0 18.4 38.0 150-151 29.113875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.0 10 2.0 11 1.0 12 1.0 13 4.0 14 1.0 15 1.0 16 7.0 17 2.0 18 3.0 19 3.0 20 9.0 21 4.0 22 7.0 23 19.0 24 16.0 25 20.0 26 24.0 27 21.0 28 23.0 29 37.0 30 31.0 31 55.0 32 86.0 33 101.0 34 159.0 35 229.0 36 512.0 37 2604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.35 14.149999999999999 18.025 32.475 2 22.125 22.8 38.525 16.55 3 19.6 27.175 31.55 21.675 4 23.175 35.375 21.85 19.6 5 24.4 36.225 22.8 16.575 6 18.125 39.425 23.9 18.55 7 18.7 17.525 42.35 21.425 8 21.15 21.099999999999998 30.275000000000002 27.474999999999998 9 22.475 24.275 29.625 23.625 10-14 22.919999999999998 28.87 26.915 21.295 15-19 22.365 28.470000000000002 28.03 21.135 20-24 23.3 27.810000000000002 27.88 21.01 25-29 23.510134113139053 28.622567308661896 27.165473429464555 20.701825148734496 30-34 23.19827895302976 28.64313886185525 27.55724017825129 20.6013420068637 35-39 23.306823362544957 28.66622764804215 27.29345017982878 20.733498809584113 40-44 23.095 28.82 26.82 21.265 45-49 23.07 28.105000000000004 28.1 20.724999999999998 50-54 23.365 28.035 27.779999999999998 20.82 55-59 23.145 27.975 27.810000000000002 21.07 60-64 23.724999999999998 27.650000000000002 27.775 20.849999999999998 65-69 22.945 27.805000000000003 28.08 21.17 70-74 23.055 28.294999999999998 28.16 20.49 75-79 23.244999999999997 27.750000000000004 28.235 20.77 80-84 23.400000000000002 28.33 27.639999999999997 20.630000000000003 85-89 23.330000000000002 27.485 28.720000000000002 20.465 90-94 23.275000000000002 28.749999999999996 27.58 20.395 95-99 24.03 28.73 27.465 19.775000000000002 100-104 23.669999999999998 28.060000000000002 27.675 20.595 105-109 23.485 28.305000000000003 27.939999999999998 20.27 110-114 23.75 28.65 27.42 20.18 115-119 23.65 28.595 27.224999999999998 20.53 120-124 24.355 28.24 27.589999999999996 19.814999999999998 125-129 24.26 28.655 27.384999999999998 19.7 130-134 24.465 27.985 27.625 19.925 135-139 24.099999999999998 28.87 27.365000000000002 19.665 140-144 24.81 28.305000000000003 27.384999999999998 19.5 145-149 24.905 28.134999999999998 27.400000000000002 19.56 150-151 26.0625 27.525 27.224999999999998 19.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.0 23 0.5 24 0.5 25 1.5 26 3.0 27 4.0 28 7.5 29 10.0 30 10.5 31 14.0 32 23.0 33 34.0 34 45.0 35 62.5 36 85.0 37 114.5 38 146.5 39 172.0 40 199.5 41 244.5 42 280.5 43 287.5 44 297.5 45 295.5 46 274.5 47 252.5 48 213.0 49 174.0 50 162.0 51 148.0 52 106.0 53 73.0 54 57.5 55 42.5 56 35.0 57 26.5 58 23.0 59 22.0 60 13.0 61 6.0 62 5.0 63 5.5 64 3.5 65 2.0 66 1.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.83 30-34 2.385 35-39 1.295 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0125 0.025 0.0 0.0 0.0 82-83 0.037500000000000006 0.025 0.0 0.0 0.0 84-85 0.0625 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.15 0.025 0.0 0.0 0.0 94-95 0.1875 0.025 0.0 0.0 0.0 96-97 0.225 0.025 0.0 0.0 0.0 98-99 0.2375 0.025 0.0 0.0 0.0 100-101 0.2875 0.025 0.0 0.0 0.0 102-103 0.4 0.025 0.0 0.0 0.0 104-105 0.5 0.025 0.0 0.0 0.0 106-107 0.65 0.025 0.0 0.0 0.0 108-109 0.6625000000000001 0.025 0.0 0.0 0.0 110-111 0.825 0.025 0.0 0.0 0.0 112-113 1.175 0.025 0.0 0.0 0.0 114-115 1.375 0.025 0.0 0.0 0.0 116-117 1.625 0.025 0.0 0.0 0.0 118-119 1.8125 0.025 0.0 0.0 0.0 120-121 2.0125 0.025 0.0 0.0 0.0 122-123 2.3 0.025 0.0 0.0 0.0 124-125 2.725 0.025 0.0 0.0 0.0 126-127 2.9 0.025 0.0 0.0 0.0 128-129 3.0625 0.025 0.0 0.0 0.0 130-131 3.3625 0.025 0.0 0.0 0.0 132-133 3.75 0.025 0.0 0.0 0.0 134-135 4.0625 0.025 0.0 0.0 0.0 136-137 4.5125 0.025 0.0 0.0 0.0 138-139 4.9875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTGT 10 0.006883923 144.625 4 ACCCTCC 10 0.006883923 144.625 5 GTGGAAT 10 0.006883923 144.625 9 >>END_MODULE Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728394 spots for SRR7172669.sra Written 728394 spots for SRR7172669.sra Read 728403 spots for SRR7172669.sra Written 728403 spots for SRR7172669.sra SRR ids: ['SRR7172669.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iyqas9_m SRR7172669.sra spots: 14567889 blocks: [[1, 728394], [728395, 1456788], [1456789, 2185182], [2185183, 2913576], [2913577, 3641970], [3641971, 4370364], [4370365, 5098758], [5098759, 5827152], [5827153, 6555546], [6555547, 7283940], [7283941, 8012334], [8012335, 8740728], [8740729, 9469122], [9469123, 10197516], [10197517, 10925910], [10925911, 11654304], [11654305, 12382698], [12382699, 13111092], [13111093, 13839486], [13839487, 14567889]] SRR7172669 file size 4914879 SRR7172669 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172669 SRR7172669_1.fastq SRR7172669_2.fastq Input file: SRR7172669_1.fastq Paired file: SRR7172669_2.fastq trimmed: SRR7172669-trimmed-pair1.fastq, SRR7172669-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 11:56:12 2025 >> started Mon Feb 10 11:56:28 2025 >> done (15.552s) 14567889 read pairs processed; of these: 12638 ( 0.09%) short read pairs filtered out after trimming by size control 10752 ( 0.07%) empty read pairs filtered out after trimming by size control 14544499 (99.84%) read pairs available; of these: 5897818 (40.55%) trimmed read pairs available after processing 8646681 (59.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 3 0.00% 31 1 0.00% 32 0 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 5 0.00% 37 3 0.00% 38 2 0.00% 39 6 0.00% 40 0 0.00% 41 4 0.00% 42 2 0.00% 43 5 0.00% 44 4 0.00% 45 6 0.00% 46 12 0.00% 47 11 0.00% 48 16 0.00% 49 12 0.00% 50 17 0.00% 51 22 0.00% 52 14 0.00% 53 25 0.00% 54 22 0.00% 55 23 0.00% 56 29 0.00% 57 24 0.00% 58 45 0.00% 59 61 0.00% 60 47 0.00% 61 58 0.00% 62 61 0.00% 63 83 0.00% 64 108 0.00% 65 89 0.00% 66 114 0.00% 67 135 0.00% 68 155 0.00% 69 165 0.00% 70 201 0.00% 71 201 0.00% 72 278 0.00% 73 333 0.00% 74 312 0.00% 75 396 0.00% 76 476 0.00% 77 523 0.00% 78 582 0.00% 79 627 0.00% 80 745 0.01% 81 892 0.01% 82 1040 0.01% 83 1192 0.01% 84 1889 0.01% 85 2473 0.02% 86 2755 0.02% 87 3058 0.02% 88 3220 0.02% 89 3286 0.02% 90 3442 0.02% 91 3771 0.03% 92 4097 0.03% 93 4442 0.03% 94 4851 0.03% 95 5205 0.04% 96 5602 0.04% 97 5833 0.04% 98 6374 0.04% 99 6941 0.05% 100 7557 0.05% 101 8057 0.06% 102 8790 0.06% 103 9310 0.06% 104 9935 0.07% 105 10956 0.08% 106 11503 0.08% 107 12060 0.08% 108 12867 0.09% 109 13951 0.10% 110 14865 0.10% 111 15516 0.11% 112 16385 0.11% 113 17722 0.12% 114 18586 0.13% 115 20043 0.14% 116 20814 0.14% 117 21717 0.15% 118 22443 0.15% 119 23744 0.16% 120 24308 0.17% 121 25658 0.18% 122 26807 0.18% 123 28185 0.19% 124 29736 0.20% 125 31195 0.21% 126 32595 0.22% 127 34063 0.23% 128 35441 0.24% 129 36880 0.25% 130 38539 0.26% 131 39818 0.27% 132 42641 0.29% 133 44808 0.31% 134 46775 0.32% 135 49224 0.34% 136 51638 0.36% 137 54687 0.38% 138 57785 0.40% 139 61599 0.42% 140 65451 0.45% 141 70735 0.49% 142 77229 0.53% 143 84728 0.58% 144 96488 0.66% 145 111013 0.76% 146 135237 0.93% 147 179650 1.24% 148 269371 1.85% 149 522750 3.59% 150 3119515 21.45% 151 8646681 59.45% 14544499 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=27 prefix-density=0.32 prefix-fanout=2.1 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=67.01 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.5 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.68 fanout-score-rank=14 prefix-density=0.29 prefix-fanout=4.7 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=80.72 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=17.6 sequence=TTGGTGCTGAGA SRR7172669 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 11:57:37 Started mapping on | Feb 10 11:57:37 Finished on | Feb 10 11:59:41 Mapping speed, Million of reads per hour | 422.26 Number of input reads | 14544499 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13674674 Uniquely mapped reads % | 94.02% Average mapped length | 295.62 Number of splices: Total | 13762015 Number of splices: Annotated (sjdb) | 13486378 Number of splices: GT/AG | 13532744 Number of splices: GC/AG | 179169 Number of splices: AT/AC | 11262 Number of splices: Non-canonical | 38840 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352913 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 38165 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 528686 528686 528686 N_multimapping 352913 352913 352913 N_noFeature 391164 13560005 442315 N_ambiguous 133487 664 69639 UnstrandedReadsAssigned:13150023 PositiveStrandReadsAssigned:114005 NegativeStrandReadsAssigned:13162720 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172669 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172669-trimmed-pair1.fastq SRR7172669-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,544,499 reads, 13,064,949 reads pseudoaligned [quant] estimated average fragment length: 239.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7172669.ke.tsv 34699 SRR7172669.se.tsv 87100 total ==> SRR7172669.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.67 874 37.2377 Potri.005G024800.1.v4.1 1035 796.673 167 15.8946 Potri.004G059700.1.v4.1 961 722.698 36 3.7771 Potri.007G009000.2.v4.1 1416 1177.67 0 0 Potri.003G141000.2.v4.1 2943 2704.67 442.151 12.3956 Potri.016G087400.1.v4.1 270 78.4188 1051.01 1016.24 Potri.015G069301.1.v4.1 564 329.24 0 0 Potri.010G195200.1.v4.1 1773 1534.67 212.745 10.5113 Potri.012G127500.1.v4.1 977 738.691 6538 671.11 ==> SRR7172669.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 262 SRR7172669 completed mapping pipeline successfully