Starting /dee2/code/volunteer_pipeline.sh SRR7172670 current disk space = 3058874474496 free memory = 1494730028 SRR7172670 SRAfilesize e7f91b5b612a18dd9840d92cfa19a99e SRR7172670.sra SRR7172670.sra file validated SRR7172670 is paired end SRR7172670 is conventional basespace SRR7172670 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172670_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.1465 18.0 18.0 27.0 18.0 32.0 2 24.10025 25.0 18.0 29.0 18.0 31.0 3 27.81125 29.0 27.0 31.0 18.0 33.0 4 30.32775 31.0 29.0 33.0 27.0 33.0 5 31.979 33.0 32.0 33.0 31.0 33.0 6 36.5905 38.0 37.0 38.0 34.0 38.0 7 37.311 38.0 38.0 38.0 36.0 38.0 8 37.37825 38.0 38.0 38.0 37.0 38.0 9 37.50175 38.0 38.0 38.0 37.0 38.0 10-14 37.56585 38.0 38.0 38.0 37.8 38.0 15-19 37.58155 38.0 38.0 38.0 37.8 38.0 20-24 37.5343 38.0 38.0 38.0 38.0 38.0 25-29 37.594500000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.59275 38.0 38.0 38.0 38.0 38.0 35-39 37.528749999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.4231 38.0 38.0 38.0 37.4 38.0 45-49 37.4533 38.0 38.0 38.0 37.4 38.0 50-54 37.39479999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.33075 38.0 38.0 38.0 37.0 38.0 60-64 37.25435 38.0 38.0 38.0 37.0 38.0 65-69 37.2816 38.0 38.0 38.0 37.0 38.0 70-74 37.19930000000001 38.0 38.0 38.0 36.4 38.0 75-79 37.095299999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.035799999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.87465 38.0 38.0 38.0 35.4 38.0 90-94 36.87665 38.0 38.0 38.0 35.4 38.0 95-99 36.8354 38.0 38.0 38.0 35.0 38.0 100-104 36.68015 38.0 38.0 38.0 34.8 38.0 105-109 36.503949999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.3611 38.0 38.0 38.0 34.0 38.0 115-119 36.371449999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.25410000000001 38.0 37.2 38.0 33.8 38.0 125-129 35.8565 38.0 36.8 38.0 32.2 38.0 130-134 35.1217 38.0 35.6 38.0 28.4 38.0 135-139 35.146100000000004 38.0 35.6 38.0 29.2 38.0 140-144 34.93035 38.0 35.0 38.0 28.0 38.0 145-149 34.47555 38.0 35.0 38.0 27.2 38.0 150-151 31.002625000000002 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 1.0 21 1.0 22 1.0 23 5.0 24 7.0 25 8.0 26 16.0 27 17.0 28 18.0 29 29.0 30 37.0 31 53.0 32 67.0 33 97.0 34 158.0 35 286.0 36 828.0 37 2362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.5859872611465 19.0828025477707 11.694267515923567 36.63694267515923 2 19.225936164865544 21.337019351595877 34.70721286755466 24.729831615983915 3 18.425 26.375 25.45 29.75 4 21.05 35.375 21.7 21.875 5 21.725 35.8 24.4 18.075 6 18.325 35.6 26.05 20.025000000000002 7 14.05 21.4 43.875 20.674999999999997 8 17.925 22.125 31.075000000000003 28.875 9 18.875 22.05 31.7 27.375 10-14 20.29 29.160000000000004 26.56 23.990000000000002 15-19 20.055 28.060000000000002 27.67 24.215 20-24 20.26 28.194999999999997 27.99 23.555 25-29 19.505 28.405 28.095 23.995 30-34 19.81 27.97 28.33 23.89 35-39 19.814999999999998 28.285 27.750000000000004 24.15 40-44 19.71 28.244999999999997 28.305000000000003 23.74 45-49 20.14 28.73 27.6 23.53 50-54 20.175 28.235 27.845 23.745 55-59 20.53 28.04 27.905 23.525 60-64 20.325 28.68 27.584999999999997 23.41 65-69 20.085 28.09 28.084999999999997 23.74 70-74 20.064999999999998 28.355000000000004 27.82 23.76 75-79 20.415 27.685 28.005000000000003 23.895 80-84 20.544999999999998 28.694999999999997 27.575 23.185 85-89 20.424999999999997 28.1 27.939999999999998 23.535 90-94 20.22 28.13 27.93 23.72 95-99 20.285 27.765 27.839999999999996 24.11 100-104 20.075000000000003 27.975 28.7 23.25 105-109 20.255000000000003 28.42 28.044999999999998 23.28 110-114 20.830000000000002 27.97 27.625 23.575 115-119 20.915 28.225 27.555000000000003 23.305 120-124 20.635 27.689999999999998 28.12 23.555 125-129 20.34 27.48 28.144999999999996 24.035 130-134 20.755000000000003 28.24 27.345000000000002 23.66 135-139 21.015 27.93 26.805 24.25 140-144 21.08 28.13 27.534999999999997 23.255 145-149 21.425 28.4 26.995 23.18 150-151 21.1625 27.712500000000002 26.937499999999996 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 3.5 26 1.5 27 3.5 28 6.5 29 10.0 30 16.0 31 18.0 32 24.0 33 42.0 34 56.0 35 70.5 36 83.0 37 108.0 38 142.5 39 180.0 40 220.0 41 226.5 42 249.0 43 288.0 44 294.5 45 291.0 46 278.5 47 236.5 48 203.0 49 190.0 50 156.0 51 113.0 52 93.0 53 83.0 54 72.5 55 50.0 56 33.5 57 31.5 58 25.5 59 21.5 60 16.5 61 11.5 62 10.0 63 8.0 64 6.0 65 6.0 66 3.5 67 2.0 68 2.0 69 2.5 70 1.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.2249999999999996 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAAT 10 0.0068343505 144.975 7 >>END_MODULE SRR7172670 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172670_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9695 34.0 33.0 34.0 32.0 34.0 2 33.06025 34.0 33.0 34.0 32.0 34.0 3 33.112 34.0 33.0 34.0 33.0 34.0 4 32.9945 34.0 33.0 34.0 33.0 34.0 5 32.98325 34.0 33.0 34.0 32.0 34.0 6 37.05675 38.0 38.0 38.0 37.0 38.0 7 37.1135 38.0 38.0 38.0 37.0 38.0 8 37.1625 38.0 38.0 38.0 37.0 38.0 9 37.15675 38.0 38.0 38.0 37.0 38.0 10-14 37.014300000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.07385 38.0 38.0 38.0 37.0 38.0 20-24 37.08024999999999 38.0 38.0 38.0 37.0 38.0 25-29 36.916199999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.4767 38.0 38.0 38.0 36.2 38.0 35-39 36.62115 38.0 38.0 38.0 36.0 38.0 40-44 36.8497 38.0 38.0 38.0 36.2 38.0 45-49 36.917649999999995 38.0 38.0 38.0 36.8 38.0 50-54 36.86365 38.0 38.0 38.0 36.2 38.0 55-59 36.8132 38.0 38.0 38.0 36.0 38.0 60-64 36.6877 38.0 38.0 38.0 35.8 38.0 65-69 36.5903 38.0 38.0 38.0 35.2 38.0 70-74 36.55145 38.0 38.0 38.0 35.0 38.0 75-79 36.4335 38.0 38.0 38.0 34.8 38.0 80-84 36.349849999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.27185 38.0 38.0 38.0 34.0 38.0 90-94 36.23635 38.0 38.0 38.0 34.0 38.0 95-99 36.1988 38.0 38.0 38.0 34.0 38.0 100-104 36.149950000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.020799999999994 38.0 38.0 38.0 33.4 38.0 110-114 35.8537 38.0 37.8 38.0 32.6 38.0 115-119 35.4855 38.0 37.0 38.0 30.6 38.0 120-124 35.32945 38.0 36.6 38.0 30.2 38.0 125-129 34.9137 38.0 36.0 38.0 28.0 38.0 130-134 34.458450000000006 38.0 35.4 38.0 25.0 38.0 135-139 34.2362 38.0 34.4 38.0 24.8 38.0 140-144 33.704899999999995 38.0 33.2 38.0 22.2 38.0 145-149 32.74995 38.0 33.0 38.0 14.6 38.0 150-151 28.372999999999998 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 5.0 5 1.0 6 2.0 7 3.0 8 1.0 9 2.0 10 2.0 11 5.0 12 4.0 13 2.0 14 3.0 15 1.0 16 3.0 17 7.0 18 3.0 19 5.0 20 6.0 21 9.0 22 8.0 23 13.0 24 11.0 25 15.0 26 16.0 27 25.0 28 34.0 29 26.0 30 31.0 31 61.0 32 85.0 33 116.0 34 173.0 35 286.0 36 603.0 37 2416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.7 16.775000000000002 17.474999999999998 28.050000000000004 2 24.975 22.375 34.25 18.4 3 20.474999999999998 27.525 30.75 21.25 4 24.3 33.95 23.05 18.7 5 23.125 36.15 22.85 17.875 6 19.425 36.75 24.224999999999998 19.6 7 19.025 17.925 42.425000000000004 20.625 8 21.275 22.025 27.975 28.725 9 22.25 25.324999999999996 27.875 24.55 10-14 23.335 28.865000000000002 26.38 21.42 15-19 22.96 28.48 27.49 21.07 20-24 23.65 28.275 27.735 20.34 25-29 22.953451043338685 28.39586677367576 27.788924558587482 20.861757624398074 30-34 23.578060784413214 28.39311989446446 27.337764473083364 20.691054848038966 35-39 23.32109261029227 28.20564414708989 27.944061572513707 20.52920167010413 40-44 23.265 27.83 28.134999999999998 20.77 45-49 23.064999999999998 27.744999999999997 28.375 20.815 50-54 23.35 28.59 27.650000000000002 20.41 55-59 23.25 28.34 27.584999999999997 20.825 60-64 23.54 27.905 28.17 20.385 65-69 23.395 27.639999999999997 27.855 21.11 70-74 23.505000000000003 28.18 27.565 20.75 75-79 23.72 28.244999999999997 27.445000000000004 20.59 80-84 23.325000000000003 28.89 26.840000000000003 20.945 85-89 23.405 27.805000000000003 27.939999999999998 20.849999999999998 90-94 23.724999999999998 28.244999999999997 27.700000000000003 20.330000000000002 95-99 23.565 28.595 27.994999999999997 19.845 100-104 23.585 27.965 27.54 20.91 105-109 23.375 28.26 28.199999999999996 20.165 110-114 23.645 27.735 27.79 20.830000000000002 115-119 24.215 27.855 27.625 20.305 120-124 23.189999999999998 28.249999999999996 27.725 20.835 125-129 24.05 27.265 28.42 20.265 130-134 24.565 28.155 26.61 20.669999999999998 135-139 23.955000000000002 28.115000000000002 27.3 20.630000000000003 140-144 24.055 28.310000000000002 27.195000000000004 20.44 145-149 24.27 27.500000000000004 27.985 20.244999999999997 150-151 25.35 26.900000000000002 27.487499999999997 20.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 4.0 26 5.0 27 5.5 28 6.0 29 5.5 30 6.0 31 12.0 32 20.0 33 30.5 34 43.0 35 62.0 36 83.5 37 104.0 38 140.5 39 175.0 40 196.0 41 236.0 42 287.5 43 301.5 44 299.5 45 301.5 46 290.5 47 251.0 48 218.0 49 194.5 50 156.5 51 116.0 52 90.5 53 79.0 54 63.5 55 45.0 56 29.5 57 23.5 58 17.0 59 19.0 60 18.0 61 14.5 62 12.5 63 8.0 64 4.5 65 1.5 66 1.5 67 2.5 68 3.5 69 3.5 70 2.0 71 0.5 72 1.5 73 1.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.32 30-34 1.455 35-39 0.605 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0374999999999996 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.8499999999999996 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728288 spots for SRR7172670.sra Written 728288 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra Read 728283 spots for SRR7172670.sra Written 728283 spots for SRR7172670.sra SRR ids: ['SRR7172670.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o42bvanl SRR7172670.sra spots: 14565665 blocks: [[1, 728283], [728284, 1456566], [1456567, 2184849], [2184850, 2913132], [2913133, 3641415], [3641416, 4369698], [4369699, 5097981], [5097982, 5826264], [5826265, 6554547], [6554548, 7282830], [7282831, 8011113], [8011114, 8739396], [8739397, 9467679], [9467680, 10195962], [10195963, 10924245], [10924246, 11652528], [11652529, 12380811], [12380812, 13109094], [13109095, 13837377], [13837378, 14565665]] SRR7172670 file size 4914125 SRR7172670 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172670 SRR7172670_1.fastq SRR7172670_2.fastq Input file: SRR7172670_1.fastq Paired file: SRR7172670_2.fastq trimmed: SRR7172670-trimmed-pair1.fastq, SRR7172670-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:01:16 2025 >> started Mon Feb 10 12:01:31 2025 >> done (15.193s) 14565665 read pairs processed; of these: 19270 ( 0.13%) short read pairs filtered out after trimming by size control 14814 ( 0.10%) empty read pairs filtered out after trimming by size control 14531581 (99.77%) read pairs available; of these: 5763599 (39.66%) trimmed read pairs available after processing 8767982 (60.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 4 0.00% 34 4 0.00% 35 2 0.00% 36 2 0.00% 37 0 0.00% 38 1 0.00% 39 2 0.00% 40 4 0.00% 41 2 0.00% 42 8 0.00% 43 2 0.00% 44 6 0.00% 45 5 0.00% 46 6 0.00% 47 7 0.00% 48 6 0.00% 49 16 0.00% 50 18 0.00% 51 10 0.00% 52 12 0.00% 53 21 0.00% 54 22 0.00% 55 24 0.00% 56 31 0.00% 57 25 0.00% 58 29 0.00% 59 44 0.00% 60 42 0.00% 61 46 0.00% 62 62 0.00% 63 60 0.00% 64 75 0.00% 65 82 0.00% 66 95 0.00% 67 101 0.00% 68 122 0.00% 69 152 0.00% 70 162 0.00% 71 160 0.00% 72 188 0.00% 73 242 0.00% 74 283 0.00% 75 325 0.00% 76 420 0.00% 77 438 0.00% 78 446 0.00% 79 555 0.00% 80 588 0.00% 81 726 0.00% 82 818 0.01% 83 1019 0.01% 84 1952 0.01% 85 2557 0.02% 86 2551 0.02% 87 2800 0.02% 88 2778 0.02% 89 3095 0.02% 90 3068 0.02% 91 3292 0.02% 92 3478 0.02% 93 3774 0.03% 94 4045 0.03% 95 4361 0.03% 96 4794 0.03% 97 5016 0.03% 98 5356 0.04% 99 5805 0.04% 100 6218 0.04% 101 6771 0.05% 102 7220 0.05% 103 7709 0.05% 104 8346 0.06% 105 8840 0.06% 106 9491 0.07% 107 10124 0.07% 108 10803 0.07% 109 11523 0.08% 110 12135 0.08% 111 12864 0.09% 112 13650 0.09% 113 14374 0.10% 114 15490 0.11% 115 16299 0.11% 116 17076 0.12% 117 18242 0.13% 118 18904 0.13% 119 19801 0.14% 120 21086 0.15% 121 21917 0.15% 122 23178 0.16% 123 24255 0.17% 124 25782 0.18% 125 26746 0.18% 126 28264 0.19% 127 29568 0.20% 128 31134 0.21% 129 32241 0.22% 130 33771 0.23% 131 35911 0.25% 132 37786 0.26% 133 40053 0.28% 134 42431 0.29% 135 44435 0.31% 136 47335 0.33% 137 50340 0.35% 138 53373 0.37% 139 57048 0.39% 140 61375 0.42% 141 66930 0.46% 142 73893 0.51% 143 82621 0.57% 144 94698 0.65% 145 112183 0.77% 146 138003 0.95% 147 185002 1.27% 148 274827 1.89% 149 549305 3.78% 150 3105970 21.37% 151 8767982 60.34% 14531581 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=25 prefix-density=0.26 prefix-fanout=3.2 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=102.80 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=19.2 sequence=CCATCTTCAAGCTGCTTCCCAGCAAA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=36.00 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.3 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7172670 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:02:17 Started mapping on | Feb 10 12:02:18 Finished on | Feb 10 12:04:27 Mapping speed, Million of reads per hour | 405.53 Number of input reads | 14531581 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13078332 Uniquely mapped reads % | 90.00% Average mapped length | 296.21 Number of splices: Total | 13183137 Number of splices: Annotated (sjdb) | 12922967 Number of splices: GT/AG | 12971210 Number of splices: GC/AG | 166685 Number of splices: AT/AC | 10299 Number of splices: Non-canonical | 34943 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356620 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 297463 % of reads mapped to too many loci | 2.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.11% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1112589 1112589 1112589 N_multimapping 356620 356620 356620 N_noFeature 364164 12963048 416887 N_ambiguous 128179 1098 64843 UnstrandedReadsAssigned:12585989 PositiveStrandReadsAssigned:114186 NegativeStrandReadsAssigned:12596602 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172670 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172670-trimmed-pair1.fastq SRR7172670-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,531,581 reads, 12,710,031 reads pseudoaligned [quant] estimated average fragment length: 244.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7172670.ke.tsv 34699 SRR7172670.se.tsv 87100 total ==> SRR7172670.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.62 1314 59.2756 Potri.005G024800.1.v4.1 1035 791.62 262 26.4954 Potri.004G059700.1.v4.1 961 717.63 62 6.91635 Potri.007G009000.2.v4.1 1416 1172.62 0 0 Potri.003G141000.2.v4.1 2943 2699.62 397.15 11.7771 Potri.016G087400.1.v4.1 270 75.5586 837 886.804 Potri.015G069301.1.v4.1 564 324.625 0 0 Potri.010G195200.1.v4.1 1773 1529.62 341 17.8467 Potri.012G127500.1.v4.1 977 733.62 5217 569.293 ==> SRR7172670.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 642 SRR7172670 completed mapping pipeline successfully