Starting /dee2/code/volunteer_pipeline.sh SRR7172671 current disk space = 3058674339840 free memory = 1458450832 SRR7172671 SRAfilesize 0e063bd4a6f1d3430c311ebea50e7b7c SRR7172671.sra SRR7172671.sra file validated SRR7172671 is paired end SRR7172671 is conventional basespace SRR7172671 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172671_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.34475 25.0 18.0 32.0 18.0 33.0 2 27.3075 29.0 25.0 31.0 18.0 33.0 3 29.72875 31.0 29.0 33.0 25.0 33.0 4 29.476 31.0 29.0 33.0 25.0 33.0 5 32.09275 33.0 32.0 33.0 32.0 33.0 6 36.72925 38.0 37.0 38.0 34.0 38.0 7 37.40475 38.0 38.0 38.0 37.0 38.0 8 37.5495 38.0 38.0 38.0 37.0 38.0 9 37.601 38.0 38.0 38.0 38.0 38.0 10-14 37.5712 38.0 38.0 38.0 38.0 38.0 15-19 37.55995 38.0 38.0 38.0 38.0 38.0 20-24 37.55475 38.0 38.0 38.0 38.0 38.0 25-29 37.54445 38.0 38.0 38.0 38.0 38.0 30-34 37.532050000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.47645 38.0 38.0 38.0 38.0 38.0 40-44 37.36705 38.0 38.0 38.0 37.2 38.0 45-49 37.40045 38.0 38.0 38.0 37.0 38.0 50-54 37.3654 38.0 38.0 38.0 37.0 38.0 55-59 37.270250000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.24679999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.23135 38.0 38.0 38.0 37.0 38.0 70-74 37.142250000000004 38.0 38.0 38.0 36.4 38.0 75-79 37.0376 38.0 38.0 38.0 36.0 38.0 80-84 36.9517 38.0 38.0 38.0 36.0 38.0 85-89 36.826550000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.771699999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.7547 38.0 38.0 38.0 35.0 38.0 100-104 36.586 38.0 38.0 38.0 34.4 38.0 105-109 36.39215 38.0 38.0 38.0 34.0 38.0 110-114 36.1759 38.0 37.8 38.0 33.4 38.0 115-119 36.257000000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.08485 38.0 37.8 38.0 33.6 38.0 125-129 35.750299999999996 38.0 36.8 38.0 31.6 38.0 130-134 34.965700000000005 38.0 35.4 38.0 28.0 38.0 135-139 34.9653 38.0 35.8 38.0 28.0 38.0 140-144 34.949400000000004 38.0 35.2 38.0 28.8 38.0 145-149 34.36395 38.0 35.2 38.0 26.0 38.0 150-151 30.732125 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 3.0 17 4.0 18 3.0 19 3.0 20 2.0 21 1.0 22 7.0 23 5.0 24 9.0 25 9.0 26 17.0 27 8.0 28 38.0 29 20.0 30 31.0 31 65.0 32 57.0 33 94.0 34 169.0 35 274.0 36 699.0 37 2478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.73295889711514 10.977789124329844 12.662752106203728 38.62649987235129 2 21.656210790464243 16.938519447929735 39.34755332496863 22.05771643663739 3 20.849999999999998 23.35 26.025 29.775000000000002 4 24.15 30.15 22.900000000000002 22.8 5 22.375 33.2 24.75 19.675 6 18.725 34.150000000000006 27.025 20.1 7 13.600000000000001 22.5 44.2 19.7 8 18.925 23.075000000000003 30.599999999999998 27.400000000000002 9 18.6 23.45 31.974999999999998 25.974999999999998 10-14 20.1 29.744999999999997 26.775 23.380000000000003 15-19 20.349999999999998 28.425 27.87 23.355 20-24 19.865 28.615000000000002 27.68 23.84 25-29 20.32 27.96 28.265 23.455000000000002 30-34 20.345 28.395 27.925 23.335 35-39 20.369999999999997 27.800000000000004 27.87 23.96 40-44 20.205000000000002 28.63 27.785 23.380000000000003 45-49 20.385 27.939999999999998 27.639999999999997 24.035 50-54 20.31 27.939999999999998 28.46 23.29 55-59 20.13 28.000000000000004 27.825 24.044999999999998 60-64 20.064999999999998 27.744999999999997 28.16 24.03 65-69 20.044999999999998 27.834999999999997 27.555000000000003 24.565 70-74 19.91 27.965 28.49 23.635 75-79 20.505000000000003 27.265 28.08 24.15 80-84 19.925 28.53 27.605 23.94 85-89 20.205000000000002 27.595 28.34 23.86 90-94 20.79 27.915 27.445000000000004 23.849999999999998 95-99 20.7 27.52 28.16 23.62 100-104 20.745 27.97 27.48 23.805 105-109 20.275000000000002 28.23 27.694999999999997 23.799999999999997 110-114 20.805 28.12 27.800000000000004 23.275000000000002 115-119 20.785 28.299999999999997 27.665 23.25 120-124 21.165 27.689999999999998 27.405 23.74 125-129 20.79 27.61 27.295 24.305 130-134 21.385 27.62 27.33 23.665 135-139 21.29 27.82 26.97 23.919999999999998 140-144 21.395 27.560000000000002 27.47 23.575 145-149 21.435000000000002 28.044999999999998 27.0 23.52 150-151 21.837500000000002 27.737499999999997 27.224999999999998 23.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.5 24 3.0 25 4.5 26 7.5 27 9.5 28 9.5 29 12.0 30 19.5 31 19.0 32 23.5 33 44.0 34 56.0 35 60.5 36 81.0 37 99.0 38 113.0 39 155.0 40 192.0 41 211.0 42 231.0 43 256.5 44 286.0 45 288.5 46 269.5 47 262.0 48 237.5 49 200.5 50 179.0 51 144.5 52 115.5 53 100.0 54 77.5 55 57.0 56 40.0 57 28.0 58 27.5 59 24.5 60 14.5 61 8.5 62 6.0 63 6.0 64 3.0 65 1.0 66 3.0 67 2.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.9875 0.0 0.0 0.0 0.0 122-123 2.2375 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.9875000000000003 0.0 0.0 0.0 0.0 134-135 4.3875 0.0 0.0 0.0 0.0 136-137 4.8625 0.0 0.0 0.0 0.0 138-139 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAT 10 0.0063298983 148.6923 1 TCGGAAG 35 0.003540148 20.710714 140-144 CGGAAGA 40 0.0076626483 18.121876 140-144 >>END_MODULE SRR7172671 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172671_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08 34.0 33.0 34.0 32.0 34.0 2 33.1285 34.0 33.0 34.0 33.0 34.0 3 33.14375 34.0 33.0 34.0 33.0 34.0 4 33.1675 34.0 33.0 34.0 33.0 34.0 5 33.113 34.0 33.0 34.0 33.0 34.0 6 37.22875 38.0 38.0 38.0 37.0 38.0 7 37.28425 38.0 38.0 38.0 37.0 38.0 8 37.2555 38.0 38.0 38.0 38.0 38.0 9 37.22275 38.0 38.0 38.0 38.0 38.0 10-14 37.1905 38.0 38.0 38.0 37.0 38.0 15-19 37.248949999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.22625 38.0 38.0 38.0 37.6 38.0 25-29 37.0545 38.0 38.0 38.0 37.0 38.0 30-34 36.57245 38.0 38.0 38.0 36.6 38.0 35-39 36.75825 38.0 38.0 38.0 36.0 38.0 40-44 37.03045 38.0 38.0 38.0 37.0 38.0 45-49 37.083600000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.04155 38.0 38.0 38.0 37.0 38.0 55-59 36.95805 38.0 38.0 38.0 36.2 38.0 60-64 36.843900000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.70525 38.0 38.0 38.0 35.8 38.0 70-74 36.6772 38.0 38.0 38.0 35.2 38.0 75-79 36.665749999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.51115 38.0 38.0 38.0 35.0 38.0 85-89 36.39375 38.0 38.0 38.0 34.4 38.0 90-94 36.37365 38.0 38.0 38.0 34.2 38.0 95-99 36.376400000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.217 38.0 38.0 38.0 34.0 38.0 105-109 36.155899999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.081100000000006 38.0 38.0 38.0 33.6 38.0 115-119 35.764199999999995 38.0 37.6 38.0 32.2 38.0 120-124 35.57175 38.0 37.0 38.0 31.2 38.0 125-129 35.277699999999996 38.0 36.2 38.0 30.4 38.0 130-134 34.84905 38.0 36.0 38.0 27.6 38.0 135-139 34.556 38.0 35.6 38.0 27.0 38.0 140-144 33.9698 38.0 33.6 38.0 23.8 38.0 145-149 33.046949999999995 38.0 33.0 38.0 18.6 38.0 150-151 28.671 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 1.0 5 1.0 6 1.0 7 2.0 8 4.0 9 0.0 10 1.0 11 4.0 12 3.0 13 1.0 14 4.0 15 2.0 16 0.0 17 5.0 18 4.0 19 7.0 20 5.0 21 3.0 22 6.0 23 13.0 24 13.0 25 11.0 26 19.0 27 21.0 28 33.0 29 33.0 30 39.0 31 55.0 32 82.0 33 102.0 34 143.0 35 256.0 36 596.0 37 2517.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 15.325 16.675 32.375 2 23.575 23.674999999999997 35.25 17.5 3 21.6 27.775 29.025000000000002 21.6 4 24.675 35.099999999999994 20.424999999999997 19.8 5 24.425 36.725 21.5 17.349999999999998 6 18.65 38.800000000000004 24.775 17.775 7 18.925 17.25 41.449999999999996 22.375 8 22.25 22.575 28.775000000000002 26.400000000000002 9 22.175 25.15 28.799999999999997 23.875 10-14 23.66 28.67 26.11 21.560000000000002 15-19 23.150000000000002 27.985 27.450000000000003 21.415 20-24 23.22 28.470000000000002 27.365000000000002 20.945 25-29 23.82146439317954 27.92878635907723 26.935807422266798 21.31394182547643 30-34 22.806036892118502 28.21281569185426 27.27272727272727 21.708420143299964 35-39 23.20808812433982 28.142447562999852 27.15658166088225 21.492882651778082 40-44 23.145 28.32 27.089999999999996 21.445 45-49 23.674999999999997 28.754999999999995 26.974999999999998 20.595 50-54 24.27 27.860000000000003 27.275 20.595 55-59 23.865 28.37 26.905 20.86 60-64 23.51 27.99 27.685 20.815 65-69 23.715 28.000000000000004 27.474999999999998 20.810000000000002 70-74 24.265 27.615000000000002 27.189999999999998 20.93 75-79 23.72 27.935 27.725 20.62 80-84 23.69 28.82 27.165 20.325 85-89 23.93 28.470000000000002 26.889999999999997 20.71 90-94 23.93 27.85 27.61 20.61 95-99 23.445 28.115000000000002 27.625 20.815 100-104 23.830000000000002 28.535 27.1 20.535 105-109 24.08 28.07 27.18 20.669999999999998 110-114 23.775 28.139999999999997 27.325 20.76 115-119 24.265 28.105000000000004 27.18 20.45 120-124 23.86 28.660000000000004 26.895000000000003 20.585 125-129 23.599999999999998 28.194999999999997 27.400000000000002 20.805 130-134 23.865 28.555000000000003 26.875 20.705000000000002 135-139 24.03 28.999999999999996 26.965 20.005 140-144 24.560000000000002 28.87 26.889999999999997 19.68 145-149 24.709999999999997 28.465 26.650000000000002 20.175 150-151 25.2625 27.3625 28.1625 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 3.0 27 4.0 28 6.5 29 7.0 30 7.0 31 8.5 32 15.0 33 29.5 34 39.0 35 48.0 36 78.0 37 100.0 38 117.5 39 157.5 40 186.0 41 207.0 42 246.5 43 280.0 44 294.0 45 306.0 46 304.5 47 273.0 48 238.0 49 206.5 50 184.5 51 155.0 52 113.5 53 83.0 54 65.5 55 60.0 56 46.0 57 33.5 58 27.0 59 16.5 60 7.5 61 10.0 62 10.0 63 6.0 64 4.0 65 3.0 66 4.5 67 2.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.3 30-34 1.6049999999999998 35-39 0.5950000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.8 0.0 0.0 0.0 0.0 138-139 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCGA 10 0.0068555363 144.825 4 AACCGAG 10 0.0068555363 144.825 5 ACCGAGG 10 0.0068555363 144.825 6 GAAGGCA 10 0.0068555363 144.825 9 >>END_MODULE Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848619 spots for SRR7172671.sra Written 848619 spots for SRR7172671.sra Read 848632 spots for SRR7172671.sra Written 848632 spots for SRR7172671.sra SRR ids: ['SRR7172671.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7ltfill SRR7172671.sra spots: 16972393 blocks: [[1, 848619], [848620, 1697238], [1697239, 2545857], [2545858, 3394476], [3394477, 4243095], [4243096, 5091714], [5091715, 5940333], [5940334, 6788952], [6788953, 7637571], [7637572, 8486190], [8486191, 9334809], [9334810, 10183428], [10183429, 11032047], [11032048, 11880666], [11880667, 12729285], [12729286, 13577904], [13577905, 14426523], [14426524, 15275142], [15275143, 16123761], [16123762, 16972393]] SRR7172671 file size 5729686 SRR7172671 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172671 SRR7172671_1.fastq SRR7172671_2.fastq Input file: SRR7172671_1.fastq Paired file: SRR7172671_2.fastq trimmed: SRR7172671-trimmed-pair1.fastq, SRR7172671-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:49:23 2025 >> started Mon Feb 10 12:49:41 2025 >> done (18.975s) 16972393 read pairs processed; of these: 19948 ( 0.12%) short read pairs filtered out after trimming by size control 14541 ( 0.09%) empty read pairs filtered out after trimming by size control 16937904 (99.80%) read pairs available; of these: 6814279 (40.23%) trimmed read pairs available after processing 10123625 (59.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 4 0.00% 37 1 0.00% 38 4 0.00% 39 5 0.00% 40 5 0.00% 41 1 0.00% 42 8 0.00% 43 10 0.00% 44 5 0.00% 45 6 0.00% 46 7 0.00% 47 14 0.00% 48 11 0.00% 49 11 0.00% 50 16 0.00% 51 16 0.00% 52 24 0.00% 53 35 0.00% 54 30 0.00% 55 26 0.00% 56 31 0.00% 57 39 0.00% 58 43 0.00% 59 53 0.00% 60 49 0.00% 61 77 0.00% 62 60 0.00% 63 75 0.00% 64 83 0.00% 65 117 0.00% 66 112 0.00% 67 137 0.00% 68 161 0.00% 69 179 0.00% 70 225 0.00% 71 230 0.00% 72 281 0.00% 73 300 0.00% 74 388 0.00% 75 393 0.00% 76 483 0.00% 77 556 0.00% 78 637 0.00% 79 724 0.00% 80 807 0.00% 81 942 0.01% 82 1106 0.01% 83 1356 0.01% 84 2446 0.01% 85 3260 0.02% 86 3419 0.02% 87 3638 0.02% 88 3837 0.02% 89 3923 0.02% 90 4156 0.02% 91 4384 0.03% 92 4714 0.03% 93 5081 0.03% 94 5520 0.03% 95 5930 0.04% 96 6507 0.04% 97 7080 0.04% 98 7501 0.04% 99 8118 0.05% 100 8645 0.05% 101 9335 0.06% 102 10139 0.06% 103 10806 0.06% 104 11393 0.07% 105 12403 0.07% 106 13339 0.08% 107 14108 0.08% 108 15124 0.09% 109 16167 0.10% 110 16882 0.10% 111 18038 0.11% 112 19310 0.11% 113 20655 0.12% 114 21738 0.13% 115 23309 0.14% 116 24287 0.14% 117 25417 0.15% 118 26843 0.16% 119 27982 0.17% 120 29120 0.17% 121 30768 0.18% 122 31520 0.19% 123 33741 0.20% 124 35208 0.21% 125 36733 0.22% 126 38846 0.23% 127 40818 0.24% 128 42551 0.25% 129 44223 0.26% 130 45898 0.27% 131 47972 0.28% 132 50213 0.30% 133 52860 0.31% 134 55775 0.33% 135 58574 0.35% 136 61630 0.36% 137 65167 0.38% 138 68987 0.41% 139 73096 0.43% 140 78213 0.46% 141 83858 0.50% 142 91577 0.54% 143 100930 0.60% 144 114635 0.68% 145 133073 0.79% 146 162076 0.96% 147 213100 1.26% 148 311772 1.84% 149 617907 3.65% 150 3528074 20.83% 151 10123625 59.77% 16937904 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=6.53 fanout-score-rank=19 prefix-density=0.50 prefix-fanout=3.4 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=12 fanout-score=347.04 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=30.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.64 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.6 sequence=TGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=423.08 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=31.3 sequence=AAGAAGAAGAAA SRR7172671 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:50:31 Started mapping on | Feb 10 12:50:31 Finished on | Feb 10 12:53:43 Mapping speed, Million of reads per hour | 317.59 Number of input reads | 16937904 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15434268 Uniquely mapped reads % | 91.12% Average mapped length | 295.60 Number of splices: Total | 15410328 Number of splices: Annotated (sjdb) | 15129541 Number of splices: GT/AG | 15163048 Number of splices: GC/AG | 197017 Number of splices: AT/AC | 11909 Number of splices: Non-canonical | 38354 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418017 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 41305 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.09% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1102541 1102541 1102541 N_multimapping 418017 418017 418017 N_noFeature 337119 15305283 381439 N_ambiguous 157762 627 72929 UnstrandedReadsAssigned:14939387 PositiveStrandReadsAssigned:128358 NegativeStrandReadsAssigned:14979900 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172671 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172671-trimmed-pair1.fastq SRR7172671-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,937,904 reads, 14,915,405 reads pseudoaligned [quant] estimated average fragment length: 231.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR7172671.ke.tsv 34699 SRR7172671.se.tsv 87100 total ==> SRR7172671.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.01 834 28.2254 Potri.005G024800.1.v4.1 1035 804.008 165 12.4115 Potri.004G059700.1.v4.1 961 730.013 77 6.37913 Potri.007G009000.2.v4.1 1416 1185.01 0 0 Potri.003G141000.2.v4.1 2943 2712.01 504 11.2393 Potri.016G087400.1.v4.1 270 78.668 1324 1017.87 Potri.015G069301.1.v4.1 564 335.153 0 0 Potri.010G195200.1.v4.1 1773 1542.01 212.777 8.34524 Potri.012G127500.1.v4.1 977 746.013 8168 662.171 ==> SRR7172671.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 120 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 538 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 239 SRR7172671 completed mapping pipeline successfully