Starting /dee2/code/volunteer_pipeline.sh SRR7172672 current disk space = 3058759507968 free memory = 1487126276 SRR7172672 SRAfilesize fdde8e57b143c5034c33492f6d43d6cc SRR7172672.sra SRR7172672.sra file validated SRR7172672 is paired end SRR7172672 is conventional basespace SRR7172672 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172672_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.05175 28.0 18.0 33.0 18.0 33.0 2 30.67675 31.0 29.0 33.0 27.0 34.0 3 30.65025 31.0 29.0 33.0 27.0 33.0 4 32.34325 33.0 32.0 33.0 32.0 33.0 5 32.82125 33.0 33.0 33.0 32.0 34.0 6 36.07725 38.0 36.0 38.0 33.0 38.0 7 36.39525 38.0 36.0 38.0 34.0 38.0 8 37.224 38.0 38.0 38.0 36.0 38.0 9 37.444 38.0 38.0 38.0 37.0 38.0 10-14 37.53435 38.0 38.0 38.0 37.4 38.0 15-19 37.56445000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.61705 38.0 38.0 38.0 38.0 38.0 25-29 37.59310000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.5187 38.0 38.0 38.0 38.0 38.0 35-39 37.48475 38.0 38.0 38.0 38.0 38.0 40-44 37.4352 38.0 38.0 38.0 37.4 38.0 45-49 37.406850000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.4125 38.0 38.0 38.0 37.2 38.0 55-59 37.320949999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.27675000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.13315 38.0 38.0 38.0 36.6 38.0 70-74 37.203399999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.158550000000005 38.0 38.0 38.0 36.4 38.0 80-84 37.067099999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.032799999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.947950000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.77995 38.0 38.0 38.0 35.4 38.0 100-104 36.65795 38.0 38.0 38.0 34.8 38.0 105-109 36.596199999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.392250000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.297450000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.1366 38.0 37.8 38.0 33.8 38.0 125-129 35.98845 38.0 37.0 38.0 33.0 38.0 130-134 35.70844999999999 38.0 36.6 38.0 32.4 38.0 135-139 35.426 38.0 36.0 38.0 31.4 38.0 140-144 35.1023 38.0 36.0 38.0 30.2 38.0 145-149 34.564350000000005 38.0 35.6 38.0 28.4 38.0 150-151 31.424750000000003 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 1.0 19 5.0 20 3.0 21 2.0 22 7.0 23 6.0 24 12.0 25 12.0 26 16.0 27 15.0 28 19.0 29 22.0 30 24.0 31 30.0 32 61.0 33 84.0 34 110.0 35 214.0 36 640.0 37 2705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.4184168012924 12.331717824448035 13.354873451803984 34.894991922455574 2 20.915686765073804 17.413059794846134 37.20290217663248 24.468351263447584 3 20.95 22.375 26.6 30.075000000000003 4 22.325 30.45 22.35 24.875 5 22.825 31.974999999999998 24.65 20.549999999999997 6 18.85 34.225 26.35 20.575 7 13.575000000000001 23.275000000000002 44.425 18.725 8 17.1 23.025000000000002 33.2 26.674999999999997 9 17.2 24.725 32.800000000000004 25.275 10-14 20.005 29.32 27.41 23.265 15-19 19.93 28.04 28.110000000000003 23.919999999999998 20-24 19.759999999999998 28.78 27.815 23.645 25-29 19.79 28.54 28.03 23.64 30-34 19.965 28.244999999999997 28.000000000000004 23.79 35-39 19.96 28.13 27.92 23.990000000000002 40-44 19.689999999999998 28.285 28.51 23.515 45-49 19.395 28.305000000000003 28.360000000000003 23.94 50-54 19.6 28.249999999999996 28.24 23.91 55-59 20.349999999999998 27.96 28.110000000000003 23.580000000000002 60-64 20.31 28.24 27.639999999999997 23.810000000000002 65-69 19.84 28.405 28.115000000000002 23.64 70-74 20.155 27.915 27.860000000000003 24.07 75-79 19.98 28.000000000000004 28.09 23.93 80-84 20.54 27.700000000000003 27.68 24.08 85-89 20.655 28.02 27.634999999999998 23.69 90-94 19.735 28.33 27.955000000000002 23.98 95-99 20.474999999999998 28.465 27.13 23.93 100-104 20.49 28.07 27.705000000000002 23.735 105-109 20.31 27.6 28.205000000000002 23.885 110-114 20.06 27.925 28.194999999999997 23.82 115-119 20.485 27.584999999999997 27.985 23.945 120-124 20.685000000000002 27.55 27.650000000000002 24.115000000000002 125-129 21.25 27.634999999999998 27.37 23.745 130-134 20.794999999999998 28.16 27.35 23.695 135-139 20.485 27.915 27.87 23.73 140-144 21.005 27.46 27.625 23.91 145-149 21.065 28.29 26.735 23.91 150-151 20.8 27.525 27.575 24.099999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.5 19 1.5 20 1.0 21 1.5 22 2.5 23 4.5 24 7.0 25 7.0 26 7.5 27 7.5 28 4.5 29 12.0 30 21.0 31 22.5 32 25.5 33 37.0 34 54.0 35 71.5 36 87.5 37 104.5 38 127.5 39 155.0 40 183.0 41 225.5 42 260.5 43 267.0 44 273.0 45 275.5 46 269.0 47 252.0 48 226.0 49 194.5 50 167.0 51 145.5 52 115.0 53 82.0 54 60.5 55 44.0 56 37.5 57 37.5 58 26.0 59 18.5 60 14.0 61 8.0 62 7.5 63 7.0 64 6.5 65 5.5 66 5.5 67 4.0 68 3.5 69 4.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.1499999999999995 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.325 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTGA 10 0.0068396386 144.9375 4 CACTCAG 10 0.0068396386 144.9375 5 >>END_MODULE SRR7172672 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172672_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07025 33.0 33.0 34.0 33.0 34.0 2 33.13425 34.0 33.0 34.0 33.0 34.0 3 33.24725 34.0 33.0 34.0 33.0 34.0 4 33.1525 34.0 33.0 34.0 33.0 34.0 5 33.113 34.0 33.0 34.0 33.0 34.0 6 37.275 38.0 38.0 38.0 37.0 38.0 7 37.28725 38.0 38.0 38.0 37.0 38.0 8 37.24925 38.0 38.0 38.0 37.0 38.0 9 37.23275 38.0 38.0 38.0 37.0 38.0 10-14 37.22385 38.0 38.0 38.0 37.0 38.0 15-19 37.25915 38.0 38.0 38.0 37.0 38.0 20-24 37.26405 38.0 38.0 38.0 37.2 38.0 25-29 37.1828 38.0 38.0 38.0 37.0 38.0 30-34 37.1758 38.0 38.0 38.0 37.0 38.0 35-39 37.159349999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.0693 38.0 38.0 38.0 37.0 38.0 45-49 37.0672 38.0 38.0 38.0 37.0 38.0 50-54 37.036649999999995 38.0 38.0 38.0 37.0 38.0 55-59 36.95605 38.0 38.0 38.0 36.6 38.0 60-64 36.8911 38.0 38.0 38.0 36.0 38.0 65-69 36.88005 38.0 38.0 38.0 36.0 38.0 70-74 36.790099999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.756 38.0 38.0 38.0 36.0 38.0 80-84 36.6614 38.0 38.0 38.0 35.6 38.0 85-89 36.60745 38.0 38.0 38.0 35.4 38.0 90-94 36.410399999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.27325 38.0 38.0 38.0 34.0 38.0 100-104 36.2485 38.0 38.0 38.0 34.0 38.0 105-109 36.05955 38.0 38.0 38.0 33.8 38.0 110-114 35.9211 38.0 38.0 38.0 33.6 38.0 115-119 35.80205000000001 38.0 38.0 38.0 33.4 38.0 120-124 35.693149999999996 38.0 37.4 38.0 32.2 38.0 125-129 35.2614 38.0 36.6 38.0 30.2 38.0 130-134 35.075849999999996 38.0 36.2 38.0 29.4 38.0 135-139 34.70075 38.0 36.0 38.0 27.6 38.0 140-144 34.2663 38.0 35.4 38.0 24.4 38.0 145-149 33.5751 38.0 35.0 38.0 19.2 38.0 150-151 29.931375000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 2.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 3.0 12 2.0 13 2.0 14 1.0 15 5.0 16 2.0 17 6.0 18 4.0 19 4.0 20 6.0 21 3.0 22 16.0 23 11.0 24 15.0 25 16.0 26 16.0 27 18.0 28 32.0 29 24.0 30 40.0 31 54.0 32 45.0 33 68.0 34 110.0 35 211.0 36 509.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.800000000000004 16.400000000000002 17.150000000000002 26.650000000000002 2 22.475 24.474999999999998 35.725 17.325 3 21.55 26.55 31.85 20.05 4 26.275 33.575 21.675 18.475 5 23.425 36.575 22.95 17.05 6 18.825 38.675 23.724999999999998 18.775 7 18.575 18.65 41.8 20.974999999999998 8 20.849999999999998 22.825 28.499999999999996 27.825 9 24.3 25.224999999999998 26.924999999999997 23.549999999999997 10-14 23.54 28.715000000000003 26.495 21.25 15-19 23.39 28.155 28.01 20.445 20-24 23.064999999999998 28.499999999999996 27.79 20.645 25-29 23.175 28.985 26.919999999999998 20.919999999999998 30-34 23.645 28.37 27.16 20.825 35-39 23.055 28.435 27.500000000000004 21.01 40-44 23.445 28.475 27.589999999999996 20.49 45-49 23.325000000000003 28.754999999999995 27.32 20.599999999999998 50-54 23.59 28.34 27.36 20.71 55-59 23.294999999999998 28.07 28.29 20.345 60-64 23.95 27.37 28.42 20.26 65-69 24.69 27.725 27.6 19.985 70-74 24.34 28.199999999999996 27.41 20.05 75-79 24.3 28.155 27.355 20.19 80-84 24.09 28.355000000000004 27.41 20.145 85-89 24.16 28.09 27.37 20.380000000000003 90-94 24.495 28.1 27.005000000000003 20.4 95-99 23.62 28.28 27.834999999999997 20.265 100-104 23.91 28.345 27.955000000000002 19.79 105-109 24.48 27.61 27.589999999999996 20.32 110-114 23.905 28.205000000000002 27.88 20.01 115-119 24.375 27.79 27.295 20.54 120-124 23.94 28.435 27.52 20.105 125-129 24.349999999999998 28.33 27.22 20.1 130-134 24.37 28.744999999999997 26.665 20.22 135-139 24.709999999999997 28.08 27.04 20.169999999999998 140-144 24.595 28.08 27.51 19.814999999999998 145-149 24.72 28.23 27.165 19.885 150-151 25.275 27.725 26.825 20.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 4.0 26 5.5 27 7.0 28 10.5 29 10.0 30 11.0 31 18.0 32 25.0 33 35.0 34 38.5 35 50.0 36 66.5 37 88.5 38 128.5 39 167.5 40 207.5 41 239.5 42 252.5 43 274.0 44 301.5 45 305.0 46 293.0 47 268.0 48 238.5 49 210.5 50 164.0 51 110.5 52 84.5 53 81.5 54 63.0 55 48.5 56 42.5 57 26.0 58 18.0 59 16.5 60 12.0 61 11.0 62 13.5 63 11.5 64 7.0 65 4.5 66 4.0 67 5.0 68 5.0 69 2.5 70 2.0 71 1.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8874999999999997 0.0 0.0 0.0 0.0 134-135 4.324999999999999 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 732014 spots for SRR7172672.sra Written 732014 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra Read 731999 spots for SRR7172672.sra Written 731999 spots for SRR7172672.sra SRR ids: ['SRR7172672.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_at5mj767 SRR7172672.sra spots: 14639995 blocks: [[1, 731999], [732000, 1463998], [1463999, 2195997], [2195998, 2927996], [2927997, 3659995], [3659996, 4391994], [4391995, 5123993], [5123994, 5855992], [5855993, 6587991], [6587992, 7319990], [7319991, 8051989], [8051990, 8783988], [8783989, 9515987], [9515988, 10247986], [10247987, 10979985], [10979986, 11711984], [11711985, 12443983], [12443984, 13175982], [13175983, 13907981], [13907982, 14639995]] SRR7172672 file size 4939313 SRR7172672 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172672 SRR7172672_1.fastq SRR7172672_2.fastq Input file: SRR7172672_1.fastq Paired file: SRR7172672_2.fastq trimmed: SRR7172672-trimmed-pair1.fastq, SRR7172672-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:54:37 2025 >> started Mon Feb 10 12:55:01 2025 >> done (23.502s) 14639995 read pairs processed; of these: 29280 ( 0.20%) short read pairs filtered out after trimming by size control 17465 ( 0.12%) empty read pairs filtered out after trimming by size control 14593250 (99.68%) read pairs available; of these: 6987264 (47.88%) trimmed read pairs available after processing 7605986 (52.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 5 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 17 0.00% 25 7 0.00% 26 3 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 4 0.00% 31 3 0.00% 32 9 0.00% 33 6 0.00% 34 5 0.00% 35 5 0.00% 36 5 0.00% 37 7 0.00% 38 5 0.00% 39 9 0.00% 40 4 0.00% 41 6 0.00% 42 4 0.00% 43 7 0.00% 44 9 0.00% 45 9 0.00% 46 18 0.00% 47 15 0.00% 48 12 0.00% 49 21 0.00% 50 15 0.00% 51 22 0.00% 52 21 0.00% 53 23 0.00% 54 28 0.00% 55 37 0.00% 56 35 0.00% 57 42 0.00% 58 45 0.00% 59 66 0.00% 60 51 0.00% 61 77 0.00% 62 58 0.00% 63 72 0.00% 64 76 0.00% 65 91 0.00% 66 125 0.00% 67 116 0.00% 68 157 0.00% 69 165 0.00% 70 190 0.00% 71 221 0.00% 72 270 0.00% 73 296 0.00% 74 328 0.00% 75 400 0.00% 76 526 0.00% 77 540 0.00% 78 581 0.00% 79 678 0.00% 80 772 0.01% 81 903 0.01% 82 1059 0.01% 83 1424 0.01% 84 2576 0.02% 85 3458 0.02% 86 3615 0.02% 87 4137 0.03% 88 4206 0.03% 89 4338 0.03% 90 4379 0.03% 91 4626 0.03% 92 4770 0.03% 93 5240 0.04% 94 5575 0.04% 95 5998 0.04% 96 6300 0.04% 97 6861 0.05% 98 7242 0.05% 99 7719 0.05% 100 8151 0.06% 101 8908 0.06% 102 9358 0.06% 103 10141 0.07% 104 11182 0.08% 105 11895 0.08% 106 12799 0.09% 107 13450 0.09% 108 14540 0.10% 109 15269 0.10% 110 16166 0.11% 111 17288 0.12% 112 18273 0.13% 113 19347 0.13% 114 20641 0.14% 115 21524 0.15% 116 23228 0.16% 117 24067 0.16% 118 25407 0.17% 119 26712 0.18% 120 27697 0.19% 121 29156 0.20% 122 30560 0.21% 123 32124 0.22% 124 33881 0.23% 125 35473 0.24% 126 36761 0.25% 127 38980 0.27% 128 40311 0.28% 129 42398 0.29% 130 44184 0.30% 131 46371 0.32% 132 48691 0.33% 133 51268 0.35% 134 54204 0.37% 135 57215 0.39% 136 60044 0.41% 137 64155 0.44% 138 68016 0.47% 139 72442 0.50% 140 77905 0.53% 141 84760 0.58% 142 92677 0.64% 143 103242 0.71% 144 119224 0.82% 145 140699 0.96% 146 176134 1.21% 147 238296 1.63% 148 368952 2.53% 149 736406 5.05% 150 3515923 24.09% 151 7605986 52.12% 14593250 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=27 prefix-density=0.76 prefix-fanout=2.6 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=197.41 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.9 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.62 fanout-score-rank=23 prefix-density=0.83 prefix-fanout=1.8 sequence=TGCAAGTGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=200.71 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=26.2 sequence=TGATGATGAAGA SRR7172672 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:55:47 Started mapping on | Feb 10 12:55:47 Finished on | Feb 10 12:57:58 Mapping speed, Million of reads per hour | 401.04 Number of input reads | 14593250 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13380685 Uniquely mapped reads % | 91.69% Average mapped length | 294.64 Number of splices: Total | 12499863 Number of splices: Annotated (sjdb) | 12212836 Number of splices: GT/AG | 12284265 Number of splices: GC/AG | 162686 Number of splices: AT/AC | 11349 Number of splices: Non-canonical | 41563 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321722 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 66248 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916931 916931 916931 N_multimapping 321722 321722 321722 N_noFeature 450397 13256966 510428 N_ambiguous 139317 857 75001 UnstrandedReadsAssigned:12790971 PositiveStrandReadsAssigned:122862 NegativeStrandReadsAssigned:12795256 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172672 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172672-trimmed-pair1.fastq SRR7172672-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,593,250 reads, 12,746,481 reads pseudoaligned [quant] estimated average fragment length: 234.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7172672.ke.tsv 34699 SRR7172672.se.tsv 87100 total ==> SRR7172672.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.39 2153 91.8823 Potri.005G024800.1.v4.1 1035 801.391 463 43.9961 Potri.004G059700.1.v4.1 961 727.416 9 0.942187 Potri.007G009000.2.v4.1 1416 1182.39 0 0 Potri.003G141000.2.v4.1 2943 2709.39 494.288 13.8927 Potri.016G087400.1.v4.1 270 79.8682 472 450.034 Potri.015G069301.1.v4.1 564 333.994 0 0 Potri.010G195200.1.v4.1 1773 1539.39 338 16.7204 Potri.012G127500.1.v4.1 977 743.401 15321 1569.43 ==> SRR7172672.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 738 SRR7172672 completed mapping pipeline successfully