Starting /dee2/code/volunteer_pipeline.sh SRR7172673 current disk space = 3058680016896 free memory = 1374798808 SRR7172673 SRAfilesize 56adad50ad6b50fde9ac60706b80b3f8 SRR7172673.sra SRR7172673.sra file validated SRR7172673 is paired end SRR7172673 is conventional basespace SRR7172673 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172673_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.08175 32.0 28.0 33.0 18.0 34.0 2 31.4515 33.0 32.0 33.0 27.0 34.0 3 31.755 33.0 31.0 33.0 28.0 34.0 4 32.62275 33.0 33.0 34.0 32.0 34.0 5 32.991 33.0 33.0 34.0 32.0 34.0 6 37.288 38.0 38.0 38.0 36.0 38.0 7 37.5845 38.0 38.0 38.0 37.0 38.0 8 37.65275 38.0 38.0 38.0 38.0 38.0 9 37.645 38.0 38.0 38.0 38.0 38.0 10-14 37.6723 38.0 38.0 38.0 38.0 38.0 15-19 37.63125 38.0 38.0 38.0 38.0 38.0 20-24 37.596000000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5911 38.0 38.0 38.0 38.0 38.0 30-34 37.6057 38.0 38.0 38.0 38.0 38.0 35-39 37.588750000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.5457 38.0 38.0 38.0 38.0 38.0 45-49 37.5053 38.0 38.0 38.0 38.0 38.0 50-54 37.47955 38.0 38.0 38.0 38.0 38.0 55-59 37.37615 38.0 38.0 38.0 37.0 38.0 60-64 37.3157 38.0 38.0 38.0 37.0 38.0 65-69 37.253499999999995 38.0 38.0 38.0 36.8 38.0 70-74 37.23625 38.0 38.0 38.0 36.8 38.0 75-79 37.11135 38.0 38.0 38.0 36.4 38.0 80-84 37.012750000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.96555 38.0 38.0 38.0 35.6 38.0 90-94 36.945350000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.91055 38.0 38.0 38.0 35.8 38.0 100-104 36.75035 38.0 38.0 38.0 35.0 38.0 105-109 36.52375 38.0 38.0 38.0 34.2 38.0 110-114 36.413 38.0 38.0 38.0 34.0 38.0 115-119 36.17495 38.0 38.0 38.0 34.0 38.0 120-124 36.283 38.0 38.0 38.0 33.8 38.0 125-129 36.0303 38.0 37.4 38.0 33.2 38.0 130-134 35.5623 38.0 36.2 38.0 31.0 38.0 135-139 35.26205 38.0 35.8 38.0 30.0 38.0 140-144 35.044 38.0 36.0 38.0 28.8 38.0 145-149 34.653299999999994 38.0 35.4 38.0 28.6 38.0 150-151 30.725875000000002 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 4.0 19 3.0 20 1.0 21 2.0 22 6.0 23 3.0 24 10.0 25 10.0 26 13.0 27 20.0 28 16.0 29 28.0 30 25.0 31 46.0 32 47.0 33 79.0 34 127.0 35 234.0 36 654.0 37 2669.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.63841807909605 14.48382126348228 13.662044170518747 40.21571648690293 2 19.832189168573606 20.36613272311213 37.147215865751335 22.65446224256293 3 19.525000000000002 27.150000000000002 25.2 28.125 4 22.475 32.775 22.875 21.875 5 21.825 35.575 24.25 18.35 6 17.25 36.95 25.2 20.599999999999998 7 13.65 21.425 45.1 19.825 8 18.275 22.325 30.9 28.499999999999996 9 18.95 23.275000000000002 32.725 25.05 10-14 19.49 29.115000000000002 27.255000000000003 24.14 15-19 19.39 28.715000000000003 27.71 24.185000000000002 20-24 20.724999999999998 28.225 27.589999999999996 23.46 25-29 19.75 28.389999999999997 27.650000000000002 24.21 30-34 19.869999999999997 28.884999999999998 27.845 23.400000000000002 35-39 20.005 28.549999999999997 27.939999999999998 23.505000000000003 40-44 20.39 28.560000000000002 27.875 23.175 45-49 20.22 28.720000000000002 27.474999999999998 23.585 50-54 20.405 28.68 27.595 23.32 55-59 20.28 28.9 27.365000000000002 23.455000000000002 60-64 20.119999999999997 28.349999999999998 27.834999999999997 23.695 65-69 20.405 28.235 27.62 23.74 70-74 20.11 28.645 27.474999999999998 23.77 75-79 20.72 27.839999999999996 27.694999999999997 23.745 80-84 20.28 28.105000000000004 27.515 24.099999999999998 85-89 20.330000000000002 27.91 27.85 23.91 90-94 20.785 27.92 27.76 23.535 95-99 20.765 27.925 27.675 23.635 100-104 20.265 27.965 27.93 23.84 105-109 20.915 27.565 27.815 23.705000000000002 110-114 20.688619757782003 27.790011009908916 27.58482634370934 23.93654288859974 115-119 20.7460142384438 28.226210769076506 27.780006016243856 23.247768976235836 120-124 20.73 28.199999999999996 27.689999999999998 23.380000000000003 125-129 21.13 27.68 27.095000000000002 24.095 130-134 21.09 27.860000000000003 27.474999999999998 23.575 135-139 21.14 27.82 27.555000000000003 23.485 140-144 21.13 27.785 27.045 24.04 145-149 21.75 28.389999999999997 26.745 23.115 150-151 20.9875 28.762500000000003 27.2625 22.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 4.5 26 5.0 27 4.5 28 8.5 29 14.0 30 24.5 31 32.0 32 35.5 33 47.5 34 64.5 35 73.0 36 78.5 37 97.5 38 137.5 39 183.0 40 196.0 41 207.0 42 235.0 43 271.0 44 290.0 45 287.5 46 268.0 47 224.5 48 202.0 49 188.0 50 160.5 51 138.5 52 111.5 53 88.0 54 68.5 55 54.5 56 46.0 57 26.5 58 22.0 59 24.5 60 18.0 61 15.5 62 13.5 63 10.0 64 6.5 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 1.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.27 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.9249999999999998 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 4.025 0.0125 0.0 0.0 0.0 138-139 4.375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCTT 15 9.3156224E-5 152.42105 1 >>END_MODULE SRR7172673 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172673_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18525 34.0 33.0 34.0 33.0 34.0 2 33.27675 34.0 33.0 34.0 33.0 34.0 3 33.19325 34.0 33.0 34.0 33.0 34.0 4 33.24825 34.0 33.0 34.0 33.0 34.0 5 33.27925 34.0 33.0 34.0 33.0 34.0 6 37.41375 38.0 38.0 38.0 38.0 38.0 7 37.387 38.0 38.0 38.0 38.0 38.0 8 37.394 38.0 38.0 38.0 38.0 38.0 9 37.388 38.0 38.0 38.0 38.0 38.0 10-14 37.37405 38.0 38.0 38.0 38.0 38.0 15-19 37.35504999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.36055 38.0 38.0 38.0 38.0 38.0 25-29 37.016000000000005 38.0 38.0 38.0 37.4 38.0 30-34 36.376099999999994 38.0 38.0 38.0 36.6 38.0 35-39 36.6575 38.0 38.0 38.0 36.8 38.0 40-44 37.20795 38.0 38.0 38.0 37.4 38.0 45-49 37.25795 38.0 38.0 38.0 37.2 38.0 50-54 37.245099999999994 38.0 38.0 38.0 37.2 38.0 55-59 37.16855 38.0 38.0 38.0 37.0 38.0 60-64 37.02785 38.0 38.0 38.0 37.0 38.0 65-69 36.969899999999996 38.0 38.0 38.0 36.8 38.0 70-74 36.9385 38.0 38.0 38.0 36.0 38.0 75-79 36.964 38.0 38.0 38.0 36.2 38.0 80-84 36.89515 38.0 38.0 38.0 36.0 38.0 85-89 36.7826 38.0 38.0 38.0 36.0 38.0 90-94 36.757349999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.61355 38.0 38.0 38.0 34.8 38.0 100-104 36.503699999999995 38.0 38.0 38.0 34.6 38.0 105-109 36.43985 38.0 38.0 38.0 34.2 38.0 110-114 36.21635 38.0 38.0 38.0 34.0 38.0 115-119 36.0658 38.0 38.0 38.0 33.6 38.0 120-124 35.8463 38.0 37.4 38.0 32.6 38.0 125-129 35.69475 38.0 37.2 38.0 32.0 38.0 130-134 35.342499999999994 38.0 36.2 38.0 30.4 38.0 135-139 35.1256 38.0 36.0 38.0 29.4 38.0 140-144 34.7643 38.0 35.8 38.0 29.0 38.0 145-149 33.8506 38.0 33.8 38.0 23.0 38.0 150-151 29.703875000000004 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 3.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 4.0 18 4.0 19 5.0 20 8.0 21 9.0 22 8.0 23 10.0 24 7.0 25 12.0 26 20.0 27 15.0 28 27.0 29 22.0 30 39.0 31 42.0 32 58.0 33 85.0 34 157.0 35 257.0 36 480.0 37 2711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.125 16.0 17.299999999999997 31.574999999999996 2 25.174999999999997 23.875 34.699999999999996 16.25 3 21.275 27.375 29.575000000000003 21.775 4 24.725 32.925 22.7 19.650000000000002 5 25.424999999999997 35.725 22.05 16.8 6 18.825 39.050000000000004 22.275 19.85 7 18.2 17.525 42.65 21.625 8 21.25 23.150000000000002 27.525 28.075 9 22.05 24.3 28.599999999999998 25.05 10-14 22.785 28.78 26.39 22.045 15-19 23.255 28.139999999999997 27.29 21.315 20-24 22.835 28.610000000000003 27.425 21.13 25-29 23.166548976092 28.911530313729443 26.83849490567941 21.083425804499143 30-34 22.55218751602811 28.573626711801815 27.640149766630763 21.234036005539313 35-39 23.156506745105997 28.339588193528755 27.2593569327518 21.24454812861345 40-44 23.29 28.34 27.705000000000002 20.665 45-49 22.965 28.134999999999998 27.49 21.41 50-54 23.11 28.189999999999998 27.55 21.15 55-59 23.095 27.985 27.145000000000003 21.775 60-64 23.265 28.38 27.43 20.925 65-69 23.189999999999998 28.065 27.355 21.39 70-74 22.755 28.24 27.750000000000004 21.255 75-79 23.44 28.205000000000002 27.279999999999998 21.075 80-84 23.615 28.18 27.18 21.025 85-89 24.0 27.139999999999997 27.884999999999998 20.974999999999998 90-94 23.205000000000002 28.444999999999997 27.58 20.77 95-99 23.26 28.16 27.229999999999997 21.349999999999998 100-104 23.745 28.18 26.88 21.195 105-109 23.705000000000002 28.28 27.389999999999997 20.625 110-114 24.26 28.205000000000002 27.205000000000002 20.330000000000002 115-119 23.435 27.884999999999998 27.750000000000004 20.93 120-124 23.825 27.755000000000003 28.015 20.405 125-129 24.01 28.035 27.73 20.225 130-134 25.119999999999997 27.11 27.589999999999996 20.18 135-139 24.11 27.755000000000003 27.615000000000002 20.52 140-144 24.66 28.12 27.245 19.975 145-149 24.560000000000002 28.535 27.165 19.74 150-151 24.85 27.775 27.287499999999998 20.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.5 19 1.0 20 0.5 21 1.5 22 1.5 23 1.5 24 1.5 25 2.0 26 5.0 27 5.0 28 4.0 29 8.5 30 10.5 31 13.5 32 18.5 33 27.5 34 45.0 35 60.5 36 77.0 37 97.5 38 134.5 39 178.5 40 201.5 41 230.0 42 258.5 43 276.0 44 282.5 45 273.5 46 260.0 47 246.5 48 236.5 49 209.5 50 171.5 51 132.0 52 108.0 53 89.5 54 66.0 55 57.0 56 47.5 57 38.0 58 28.0 59 17.5 60 17.0 61 16.5 62 11.5 63 8.5 64 5.0 65 2.5 66 2.5 67 2.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.8699999999999999 30-34 2.5149999999999997 35-39 1.41 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTACTG 10 0.006882143 144.6375 3 CTACTGC 10 0.006882143 144.6375 4 >>END_MODULE Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647443 spots for SRR7172673.sra Written 647443 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra Read 647429 spots for SRR7172673.sra Written 647429 spots for SRR7172673.sra SRR ids: ['SRR7172673.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9mql00fv SRR7172673.sra spots: 12948594 blocks: [[1, 647429], [647430, 1294858], [1294859, 1942287], [1942288, 2589716], [2589717, 3237145], [3237146, 3884574], [3884575, 4532003], [4532004, 5179432], [5179433, 5826861], [5826862, 6474290], [6474291, 7121719], [7121720, 7769148], [7769149, 8416577], [8416578, 9064006], [9064007, 9711435], [9711436, 10358864], [10358865, 11006293], [11006294, 11653722], [11653723, 12301151], [12301152, 12948594]] SRR7172673 file size 4366153 SRR7172673 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172673 SRR7172673_1.fastq SRR7172673_2.fastq Input file: SRR7172673_1.fastq Paired file: SRR7172673_2.fastq trimmed: SRR7172673-trimmed-pair1.fastq, SRR7172673-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:29:48 2025 >> started Mon Feb 10 12:30:02 2025 >> done (13.580s) 12948594 read pairs processed; of these: 9580 ( 0.07%) short read pairs filtered out after trimming by size control 6792 ( 0.05%) empty read pairs filtered out after trimming by size control 12932222 (99.87%) read pairs available; of these: 5001082 (38.67%) trimmed read pairs available after processing 7931140 (61.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 1 0.00% 33 3 0.00% 34 3 0.00% 35 3 0.00% 36 2 0.00% 37 2 0.00% 38 1 0.00% 39 2 0.00% 40 3 0.00% 41 5 0.00% 42 5 0.00% 43 6 0.00% 44 8 0.00% 45 6 0.00% 46 5 0.00% 47 3 0.00% 48 10 0.00% 49 7 0.00% 50 13 0.00% 51 11 0.00% 52 9 0.00% 53 18 0.00% 54 18 0.00% 55 20 0.00% 56 28 0.00% 57 20 0.00% 58 29 0.00% 59 33 0.00% 60 50 0.00% 61 37 0.00% 62 55 0.00% 63 44 0.00% 64 64 0.00% 65 100 0.00% 66 74 0.00% 67 76 0.00% 68 85 0.00% 69 121 0.00% 70 140 0.00% 71 159 0.00% 72 188 0.00% 73 235 0.00% 74 247 0.00% 75 325 0.00% 76 335 0.00% 77 425 0.00% 78 402 0.00% 79 519 0.00% 80 543 0.00% 81 596 0.00% 82 753 0.01% 83 846 0.01% 84 1347 0.01% 85 1865 0.01% 86 2024 0.02% 87 2232 0.02% 88 2379 0.02% 89 2393 0.02% 90 2527 0.02% 91 2770 0.02% 92 2891 0.02% 93 3067 0.02% 94 3446 0.03% 95 3685 0.03% 96 3910 0.03% 97 4152 0.03% 98 4444 0.03% 99 4762 0.04% 100 5198 0.04% 101 5599 0.04% 102 5908 0.05% 103 6570 0.05% 104 6919 0.05% 105 7463 0.06% 106 7916 0.06% 107 8330 0.06% 108 9033 0.07% 109 9476 0.07% 110 9955 0.08% 111 10645 0.08% 112 11225 0.09% 113 12006 0.09% 114 13091 0.10% 115 13754 0.11% 116 14631 0.11% 117 14817 0.11% 118 15649 0.12% 119 16217 0.13% 120 16937 0.13% 121 18005 0.14% 122 18829 0.15% 123 20038 0.15% 124 21121 0.16% 125 22004 0.17% 126 23024 0.18% 127 24182 0.19% 128 25299 0.20% 129 26172 0.20% 130 27661 0.21% 131 28804 0.22% 132 30710 0.24% 133 32752 0.25% 134 34445 0.27% 135 35989 0.28% 136 38281 0.30% 137 40630 0.31% 138 43436 0.34% 139 46282 0.36% 140 49767 0.38% 141 54378 0.42% 142 59864 0.46% 143 67043 0.52% 144 76285 0.59% 145 89928 0.70% 146 110139 0.85% 147 148458 1.15% 148 227661 1.76% 149 455456 3.52% 150 2828495 21.87% 151 7931140 61.33% 12932222 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=122.65 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.8 sequence=CCAAACTTCGCACATCATCTAAAGCCTTGTACTCGTAAACCACAAAATCGAAAAAAAAGCGCCTCAATTCATCATCTCCATGCTTCAGCTTCAAGCTTGAGTTTTGGCCATGTGAGCTATCAAGTCAATCACGCGTGAACTGTAGCCCCATTCATTGTCATACCAAGAGACAAGTTTGACGAAGTTATCGTTCAAGGCAATTCCAGCCTTGGCATCGAATATGCTTGACCTGCTGTCACCAATG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=93.65 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=2.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7172673 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:30:57 Started mapping on | Feb 10 12:30:57 Finished on | Feb 10 12:33:54 Mapping speed, Million of reads per hour | 263.03 Number of input reads | 12932222 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11559256 Uniquely mapped reads % | 89.38% Average mapped length | 296.64 Number of splices: Total | 11928257 Number of splices: Annotated (sjdb) | 11714340 Number of splices: GT/AG | 11729635 Number of splices: GC/AG | 157045 Number of splices: AT/AC | 9263 Number of splices: Non-canonical | 32314 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346502 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 27045 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.65% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1035656 1035656 1035656 N_multimapping 346502 346502 346502 N_noFeature 281346 11458685 323299 N_ambiguous 119091 683 60102 UnstrandedReadsAssigned:11158819 PositiveStrandReadsAssigned:99888 NegativeStrandReadsAssigned:11175855 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172673 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172673-trimmed-pair1.fastq SRR7172673-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,932,222 reads, 11,130,583 reads pseudoaligned [quant] estimated average fragment length: 248.978 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7172673.ke.tsv 34699 SRR7172673.se.tsv 87100 total ==> SRR7172673.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.02 991 47.4303 Potri.005G024800.1.v4.1 1035 787.022 270 29.0628 Potri.004G059700.1.v4.1 961 713.033 61 7.24738 Potri.007G009000.2.v4.1 1416 1168.02 0 0 Potri.003G141000.2.v4.1 2943 2695.02 447.188 14.0569 Potri.016G087400.1.v4.1 270 73.9667 939 1075.45 Potri.015G069301.1.v4.1 564 320.415 0 0 Potri.010G195200.1.v4.1 1773 1525.02 314.873 17.4912 Potri.012G127500.1.v4.1 977 729.027 5427 630.633 ==> SRR7172673.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 468 SRR7172673 completed mapping pipeline successfully