Starting /dee2/code/volunteer_pipeline.sh SRR7172674 current disk space = 3058649968640 free memory = 1388279032 SRR7172674 SRAfilesize 14fdd115d800645608fee29ece9123ec SRR7172674.sra SRR7172674.sra file validated SRR7172674 is paired end SRR7172674 is conventional basespace SRR7172674 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172674_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07725 33.0 33.0 34.0 32.0 34.0 2 32.629 33.0 33.0 34.0 32.0 34.0 3 32.14375 33.0 32.0 33.0 31.0 34.0 4 32.7005 33.0 33.0 34.0 31.0 34.0 5 32.85725 33.0 33.0 34.0 32.0 34.0 6 37.06125 38.0 37.0 38.0 36.0 38.0 7 37.5105 38.0 38.0 38.0 37.0 38.0 8 37.59375 38.0 38.0 38.0 38.0 38.0 9 37.63875 38.0 38.0 38.0 38.0 38.0 10-14 37.66844999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.6616 38.0 38.0 38.0 38.0 38.0 20-24 37.6015 38.0 38.0 38.0 38.0 38.0 25-29 37.6558 38.0 38.0 38.0 38.0 38.0 30-34 37.652300000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.6196 38.0 38.0 38.0 38.0 38.0 40-44 37.5187 38.0 38.0 38.0 38.0 38.0 45-49 37.520399999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.429500000000004 38.0 38.0 38.0 37.8 38.0 55-59 37.356700000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.3455 38.0 38.0 38.0 37.0 38.0 65-69 37.30239999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.216899999999995 38.0 38.0 38.0 36.6 38.0 75-79 37.140100000000004 38.0 38.0 38.0 36.2 38.0 80-84 37.0401 38.0 38.0 38.0 36.0 38.0 85-89 36.819500000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.922 38.0 38.0 38.0 35.6 38.0 95-99 36.9687 38.0 38.0 38.0 35.8 38.0 100-104 36.742599999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.385000000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.2582 38.0 37.8 38.0 33.2 38.0 115-119 36.22840000000001 38.0 37.6 38.0 33.6 38.0 120-124 36.36355 38.0 38.0 38.0 34.0 38.0 125-129 36.13405 38.0 37.4 38.0 33.2 38.0 130-134 35.704049999999995 38.0 36.8 38.0 31.2 38.0 135-139 35.2753 38.0 36.0 38.0 29.0 38.0 140-144 35.486450000000005 38.0 36.0 38.0 31.0 38.0 145-149 35.127300000000005 38.0 36.0 38.0 30.4 38.0 150-151 31.795875000000002 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 0.0 20 0.0 21 3.0 22 6.0 23 4.0 24 5.0 25 7.0 26 6.0 27 14.0 28 19.0 29 27.0 30 29.0 31 59.0 32 66.0 33 80.0 34 127.0 35 222.0 36 546.0 37 2775.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.83690112130479 11.824668705402651 12.945973496432211 40.39245667686034 2 19.724310776942357 18.922305764411025 40.07518796992481 21.278195488721803 3 20.1 24.25 26.55 29.099999999999998 4 22.95 32.85 21.65 22.55 5 22.15 34.125 24.65 19.075 6 17.4 36.275 26.424999999999997 19.900000000000002 7 13.950000000000001 22.525000000000002 44.525 19.0 8 17.9 21.925 30.725 29.45 9 18.575 22.95 31.0 27.474999999999998 10-14 20.02 28.92 27.195000000000004 23.865 15-19 20.669999999999998 28.12 27.400000000000002 23.810000000000002 20-24 20.605 27.775 28.08 23.54 25-29 20.18 28.275 28.07 23.474999999999998 30-34 20.435 28.000000000000004 27.994999999999997 23.57 35-39 20.935000000000002 28.225 27.525 23.315 40-44 20.155 28.17 28.115000000000002 23.56 45-49 19.81 28.095 27.805000000000003 24.29 50-54 20.015 28.22 27.944999999999997 23.82 55-59 20.32 27.785 27.615000000000002 24.279999999999998 60-64 20.175 28.560000000000002 27.07 24.195 65-69 20.595 27.534999999999997 28.075 23.794999999999998 70-74 20.125 27.339999999999996 28.355000000000004 24.18 75-79 20.29 27.485 28.360000000000003 23.865 80-84 20.635 27.515 28.09 23.76 85-89 20.905 27.500000000000004 27.74 23.855 90-94 20.810000000000002 28.26 27.625 23.305 95-99 20.59 27.42 27.66 24.33 100-104 20.65 28.000000000000004 27.825 23.525 105-109 20.805 27.92 27.625 23.65 110-114 21.34134134134134 27.64764764764765 27.42242242242242 23.58858858858859 115-119 21.035 28.015 27.415 23.535 120-124 20.985 27.694999999999997 27.389999999999997 23.93 125-129 21.075 28.225 26.83 23.87 130-134 21.16 28.544999999999998 26.56 23.735 135-139 21.15 28.22 26.889999999999997 23.74 140-144 21.92 28.08 25.935000000000002 24.065 145-149 21.795 28.084999999999997 26.345000000000002 23.775 150-151 21.224999999999998 28.075 26.775 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 3.5 26 4.5 27 4.0 28 5.5 29 5.5 30 14.0 31 22.0 32 24.5 33 35.0 34 44.0 35 50.5 36 69.5 37 94.5 38 121.0 39 162.0 40 195.5 41 217.5 42 253.0 43 293.0 44 296.0 45 274.5 46 274.5 47 269.0 48 240.0 49 196.5 50 165.0 51 149.0 52 129.0 53 106.0 54 74.5 55 47.0 56 37.5 57 32.5 58 23.5 59 17.5 60 12.5 61 6.5 62 4.5 63 5.5 64 4.0 65 4.5 66 3.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.1 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.225 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.8875 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.1625 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCTTC 10 0.006832588 144.9875 5 >>END_MODULE SRR7172674 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172674_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.205 34.0 33.0 34.0 33.0 34.0 2 33.3 34.0 33.0 34.0 33.0 34.0 3 33.276 34.0 33.0 34.0 33.0 34.0 4 33.28375 34.0 33.0 34.0 33.0 34.0 5 33.23 34.0 33.0 34.0 33.0 34.0 6 37.42725 38.0 38.0 38.0 38.0 38.0 7 37.44825 38.0 38.0 38.0 38.0 38.0 8 37.3885 38.0 38.0 38.0 38.0 38.0 9 37.32775 38.0 38.0 38.0 38.0 38.0 10-14 37.39845 38.0 38.0 38.0 38.0 38.0 15-19 37.381 38.0 38.0 38.0 38.0 38.0 20-24 37.3153 38.0 38.0 38.0 38.0 38.0 25-29 37.02675 38.0 38.0 38.0 37.4 38.0 30-34 36.4176 38.0 38.0 38.0 36.8 38.0 35-39 36.68075 38.0 38.0 38.0 36.4 38.0 40-44 37.15675 38.0 38.0 38.0 37.0 38.0 45-49 37.23065 38.0 38.0 38.0 37.4 38.0 50-54 37.21945 38.0 38.0 38.0 37.2 38.0 55-59 37.059549999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.00055 38.0 38.0 38.0 36.6 38.0 65-69 36.92875 38.0 38.0 38.0 36.2 38.0 70-74 36.89905 38.0 38.0 38.0 36.0 38.0 75-79 36.7984 38.0 38.0 38.0 35.8 38.0 80-84 36.8215 38.0 38.0 38.0 36.0 38.0 85-89 36.78245 38.0 38.0 38.0 36.0 38.0 90-94 36.6635 38.0 38.0 38.0 35.2 38.0 95-99 36.59654999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.577000000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.53715 38.0 38.0 38.0 34.8 38.0 110-114 36.3577 38.0 38.0 38.0 34.0 38.0 115-119 36.14355 38.0 38.0 38.0 33.8 38.0 120-124 35.87225 38.0 37.4 38.0 32.4 38.0 125-129 35.55155 38.0 37.0 38.0 31.0 38.0 130-134 35.347500000000004 38.0 36.2 38.0 30.6 38.0 135-139 35.149350000000005 38.0 36.0 38.0 30.6 38.0 140-144 34.589299999999994 38.0 35.8 38.0 27.8 38.0 145-149 33.58795 38.0 33.2 38.0 21.2 38.0 150-151 29.404625000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 7.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 2.0 20 3.0 21 5.0 22 11.0 23 10.0 24 8.0 25 9.0 26 22.0 27 14.0 28 21.0 29 25.0 30 39.0 31 50.0 32 87.0 33 75.0 34 149.0 35 273.0 36 464.0 37 2700.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.65 14.625 18.45 32.275 2 23.75 22.7 35.575 17.974999999999998 3 20.674999999999997 26.974999999999998 30.775000000000002 21.575 4 25.124999999999996 33.4 20.849999999999998 20.625 5 23.974999999999998 37.45 22.0 16.575 6 18.775 37.0 23.9 20.325 7 19.125 16.400000000000002 43.175000000000004 21.3 8 20.5 22.375 29.125 28.000000000000004 9 23.25 23.7 28.749999999999996 24.3 10-14 23.375 28.9 26.11 21.615000000000002 15-19 22.6 27.375 28.285 21.740000000000002 20-24 23.035 27.74 27.43 21.795 25-29 22.511454609536276 28.986455868284576 26.680428981420874 21.82166054075827 30-34 23.278201648829945 27.71775308515541 27.456603000665673 21.547442265348966 35-39 22.8003640776699 27.791262135922327 27.95813106796117 21.450242718446603 40-44 23.265 28.63 27.334999999999997 20.77 45-49 23.765 27.884999999999998 27.74 20.61 50-54 23.26 27.865000000000002 27.915 20.96 55-59 23.65 27.76 27.525 21.065 60-64 23.515 27.665 27.845 20.974999999999998 65-69 23.335 27.82 27.405 21.44 70-74 23.494999999999997 28.33 27.275 20.9 75-79 23.810000000000002 28.09 27.675 20.424999999999997 80-84 24.365000000000002 27.875 27.779999999999998 19.98 85-89 24.005000000000003 27.950000000000003 27.139999999999997 20.905 90-94 23.84 28.17 27.224999999999998 20.765 95-99 24.065 27.98 26.979999999999997 20.974999999999998 100-104 24.035 27.975 27.325 20.665 105-109 23.645 27.76 27.939999999999998 20.655 110-114 24.145 27.810000000000002 27.095000000000002 20.95 115-119 24.44 28.360000000000003 26.595000000000002 20.605 120-124 24.29 27.700000000000003 27.495000000000005 20.515 125-129 24.495 28.055000000000003 27.065 20.385 130-134 25.324999999999996 27.765 26.534999999999997 20.375 135-139 24.740000000000002 28.4 27.384999999999998 19.475 140-144 25.814999999999998 27.765 27.200000000000003 19.220000000000002 145-149 26.14 27.810000000000002 26.51 19.54 150-151 25.525 28.1 26.3125 20.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 3.5 26 3.5 27 1.5 28 1.5 29 3.5 30 7.0 31 9.0 32 11.0 33 19.0 34 33.5 35 42.0 36 61.5 37 91.5 38 131.5 39 161.5 40 183.5 41 231.5 42 279.0 43 304.5 44 306.0 45 303.5 46 302.0 47 269.0 48 237.5 49 210.0 50 177.0 51 146.5 52 111.0 53 86.5 54 63.5 55 51.0 56 41.5 57 30.0 58 22.0 59 17.0 60 13.0 61 9.5 62 5.5 63 4.0 64 4.5 65 2.5 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.695 30-34 2.355 35-39 1.1199999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.275 0.0 0.0 0.0 0.0 120-121 3.6375 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.675 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.237500000000001 0.0 0.0 0.0 0.0 134-135 7.85 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGATT 10 0.0068768123 144.675 1 GAAAAAG 10 0.0068768123 144.675 1 CTTCCAT 10 0.0068768123 144.675 1 >>END_MODULE Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727480 spots for SRR7172674.sra Written 727480 spots for SRR7172674.sra Read 727499 spots for SRR7172674.sra Written 727499 spots for SRR7172674.sra SRR ids: ['SRR7172674.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7aa5zroe SRR7172674.sra spots: 14549619 blocks: [[1, 727480], [727481, 1454960], [1454961, 2182440], [2182441, 2909920], [2909921, 3637400], [3637401, 4364880], [4364881, 5092360], [5092361, 5819840], [5819841, 6547320], [6547321, 7274800], [7274801, 8002280], [8002281, 8729760], [8729761, 9457240], [9457241, 10184720], [10184721, 10912200], [10912201, 11639680], [11639681, 12367160], [12367161, 13094640], [13094641, 13822120], [13822121, 14549619]] SRR7172674 file size 4908688 SRR7172674 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172674 SRR7172674_1.fastq SRR7172674_2.fastq Input file: SRR7172674_1.fastq Paired file: SRR7172674_2.fastq trimmed: SRR7172674-trimmed-pair1.fastq, SRR7172674-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:34:57 2025 >> started Mon Feb 10 12:35:22 2025 >> done (24.709s) 14549619 read pairs processed; of these: 12761 ( 0.09%) short read pairs filtered out after trimming by size control 9517 ( 0.07%) empty read pairs filtered out after trimming by size control 14527341 (99.85%) read pairs available; of these: 7606041 (52.36%) trimmed read pairs available after processing 6921300 (47.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 3 0.00% 36 1 0.00% 37 2 0.00% 38 3 0.00% 39 2 0.00% 40 2 0.00% 41 8 0.00% 42 5 0.00% 43 3 0.00% 44 6 0.00% 45 13 0.00% 46 5 0.00% 47 17 0.00% 48 21 0.00% 49 23 0.00% 50 22 0.00% 51 22 0.00% 52 27 0.00% 53 44 0.00% 54 40 0.00% 55 40 0.00% 56 38 0.00% 57 55 0.00% 58 60 0.00% 59 71 0.00% 60 122 0.00% 61 117 0.00% 62 123 0.00% 63 156 0.00% 64 169 0.00% 65 179 0.00% 66 233 0.00% 67 251 0.00% 68 314 0.00% 69 360 0.00% 70 407 0.00% 71 426 0.00% 72 573 0.00% 73 688 0.00% 74 688 0.00% 75 798 0.01% 76 998 0.01% 77 1178 0.01% 78 1308 0.01% 79 1483 0.01% 80 1610 0.01% 81 2060 0.01% 82 2239 0.02% 83 2676 0.02% 84 3516 0.02% 85 4258 0.03% 86 4494 0.03% 87 4819 0.03% 88 5341 0.04% 89 5877 0.04% 90 6491 0.04% 91 6774 0.05% 92 7427 0.05% 93 8099 0.06% 94 8848 0.06% 95 9716 0.07% 96 10521 0.07% 97 11264 0.08% 98 11807 0.08% 99 12878 0.09% 100 13879 0.10% 101 14963 0.10% 102 16006 0.11% 103 16896 0.12% 104 18166 0.13% 105 19509 0.13% 106 20223 0.14% 107 21403 0.15% 108 22422 0.15% 109 23580 0.16% 110 24639 0.17% 111 25736 0.18% 112 27302 0.19% 113 28548 0.20% 114 29967 0.21% 115 31805 0.22% 116 32462 0.22% 117 33884 0.23% 118 35140 0.24% 119 36272 0.25% 120 37472 0.26% 121 39286 0.27% 122 40233 0.28% 123 42166 0.29% 124 43857 0.30% 125 45177 0.31% 126 46360 0.32% 127 48641 0.33% 128 49344 0.34% 129 51234 0.35% 130 53036 0.37% 131 55331 0.38% 132 56711 0.39% 133 59693 0.41% 134 61761 0.43% 135 63576 0.44% 136 67511 0.46% 137 69511 0.48% 138 72358 0.50% 139 76961 0.53% 140 81517 0.56% 141 86210 0.59% 142 94682 0.65% 143 101830 0.70% 144 114123 0.79% 145 130220 0.90% 146 158967 1.09% 147 205462 1.41% 148 312772 2.15% 149 715775 4.93% 150 3889622 26.77% 151 6921300 47.64% 14527341 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.60 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=465.10 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=34.2 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.97 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=3.1 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=61.51 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.4 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7172674 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:36:24 Started mapping on | Feb 10 12:36:25 Finished on | Feb 10 12:38:33 Mapping speed, Million of reads per hour | 408.58 Number of input reads | 14527341 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13839220 Uniquely mapped reads % | 95.26% Average mapped length | 292.86 Number of splices: Total | 13936921 Number of splices: Annotated (sjdb) | 13717974 Number of splices: GT/AG | 13721724 Number of splices: GC/AG | 170559 Number of splices: AT/AC | 10363 Number of splices: Non-canonical | 34275 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364447 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 48617 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.83% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 335308 335308 335308 N_multimapping 364447 364447 364447 N_noFeature 259422 13730404 304798 N_ambiguous 120307 1280 55811 UnstrandedReadsAssigned:13459491 PositiveStrandReadsAssigned:107536 NegativeStrandReadsAssigned:13478611 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172674 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172674-trimmed-pair1.fastq SRR7172674-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,527,341 reads, 13,408,412 reads pseudoaligned [quant] estimated average fragment length: 221.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7172674.ke.tsv 34699 SRR7172674.se.tsv 87100 total ==> SRR7172674.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.62 816 33.292 Potri.005G024800.1.v4.1 1035 814.621 395 35.5622 Potri.004G059700.1.v4.1 961 740.633 35 3.46587 Potri.007G009000.2.v4.1 1416 1195.62 0 0 Potri.003G141000.2.v4.1 2943 2722.62 474 12.7685 Potri.016G087400.1.v4.1 270 86.8862 1361 1148.83 Potri.015G069301.1.v4.1 564 345.623 0 0 Potri.010G195200.1.v4.1 1773 1552.62 168 7.93581 Potri.012G127500.1.v4.1 977 756.627 2303 223.233 ==> SRR7172674.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 107 SRR7172674 completed mapping pipeline successfully