Starting /dee2/code/volunteer_pipeline.sh SRR7172675 current disk space = 3058773291008 free memory = 1397516532 SRR7172675 SRAfilesize a81869d9924c51454a9efe0b69a04ca1 SRR7172675.sra SRR7172675.sra file validated SRR7172675 is paired end SRR7172675 is conventional basespace SRR7172675 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172675_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.976 28.0 18.0 33.0 18.0 33.0 2 23.50375 18.0 18.0 30.0 18.0 33.0 3 27.323 29.0 25.0 31.0 18.0 33.0 4 31.697 32.0 32.0 33.0 27.0 33.0 5 31.87325 33.0 32.0 33.0 31.0 33.0 6 35.85425 37.0 36.0 38.0 31.0 38.0 7 36.73 38.0 37.0 38.0 34.0 38.0 8 36.82375 38.0 37.0 38.0 34.0 38.0 9 37.2205 38.0 38.0 38.0 36.0 38.0 10-14 37.464600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.534 38.0 38.0 38.0 37.2 38.0 20-24 37.64465 38.0 38.0 38.0 38.0 38.0 25-29 37.6245 38.0 38.0 38.0 38.0 38.0 30-34 37.57815 38.0 38.0 38.0 38.0 38.0 35-39 37.5961 38.0 38.0 38.0 38.0 38.0 40-44 37.53 38.0 38.0 38.0 38.0 38.0 45-49 37.5195 38.0 38.0 38.0 37.2 38.0 50-54 37.490449999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.415600000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.41345 38.0 38.0 38.0 37.0 38.0 65-69 37.39375 38.0 38.0 38.0 37.0 38.0 70-74 37.32745 38.0 38.0 38.0 37.0 38.0 75-79 37.259550000000004 38.0 38.0 38.0 36.6 38.0 80-84 37.16685 38.0 38.0 38.0 36.2 38.0 85-89 37.16985000000001 38.0 38.0 38.0 36.0 38.0 90-94 37.05325 38.0 38.0 38.0 36.0 38.0 95-99 37.0077 38.0 38.0 38.0 36.0 38.0 100-104 36.8673 38.0 38.0 38.0 35.6 38.0 105-109 36.766450000000006 38.0 38.0 38.0 35.0 38.0 110-114 36.6375 38.0 38.0 38.0 34.6 38.0 115-119 36.51875 38.0 38.0 38.0 34.0 38.0 120-124 36.39825 38.0 37.8 38.0 34.0 38.0 125-129 36.335750000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.00305 38.0 37.0 38.0 33.0 38.0 135-139 35.8005 38.0 36.4 38.0 32.6 38.0 140-144 35.5341 38.0 36.0 38.0 31.4 38.0 145-149 34.9606 38.0 35.8 38.0 30.0 38.0 150-151 31.968374999999998 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 2.0 19 1.0 20 0.0 21 1.0 22 2.0 23 7.0 24 7.0 25 4.0 26 12.0 27 9.0 28 13.0 29 19.0 30 25.0 31 33.0 32 45.0 33 61.0 34 129.0 35 270.0 36 781.0 37 2571.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.597255212457114 15.175508049617314 12.53628925837952 38.690947479546054 2 17.775 25.0 34.725 22.5 3 18.4 28.475 25.35 27.775 4 21.325 34.825 23.05 20.8 5 19.575 36.675000000000004 25.174999999999997 18.575 6 17.474999999999998 36.95 25.974999999999998 19.6 7 13.0 21.375 46.1 19.525000000000002 8 18.9 21.55 30.825000000000003 28.725 9 18.475 23.275000000000002 33.0 25.25 10-14 19.46 29.665000000000003 26.985 23.89 15-19 20.085 28.294999999999998 28.360000000000003 23.26 20-24 19.935 28.655 28.255000000000003 23.155 25-29 19.13 29.020000000000003 28.455000000000002 23.395 30-34 19.935 28.560000000000002 28.345 23.16 35-39 19.46 29.244999999999997 27.944999999999997 23.35 40-44 19.67 28.970000000000002 27.800000000000004 23.56 45-49 19.86 28.615000000000002 28.075 23.45 50-54 19.265 28.625 28.660000000000004 23.45 55-59 19.515 29.28 27.794999999999998 23.41 60-64 19.625 28.134999999999998 28.57 23.669999999999998 65-69 19.465 28.955 28.04 23.54 70-74 19.895 28.37 28.15 23.585 75-79 19.470000000000002 28.299999999999997 28.595 23.635 80-84 19.535 29.099999999999998 27.905 23.46 85-89 19.735 28.634999999999998 28.33 23.3 90-94 20.41 28.63 27.505000000000003 23.455000000000002 95-99 19.865 29.205 27.58 23.35 100-104 19.88 28.58 28.285 23.255 105-109 20.0 28.08 28.435 23.485 110-114 19.725 28.194999999999997 28.535 23.544999999999998 115-119 19.830000000000002 28.235 28.37 23.565 120-124 19.86 28.26 28.134999999999998 23.745 125-129 19.455 28.415000000000003 28.355000000000004 23.775 130-134 20.435 28.625 28.060000000000002 22.88 135-139 20.995 27.91 27.48 23.615 140-144 20.715 27.99 28.095 23.200000000000003 145-149 20.32 28.63 27.61 23.44 150-151 21.25 27.2625 28.3625 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.5 21 2.0 22 2.5 23 3.0 24 3.0 25 6.0 26 10.0 27 10.0 28 11.5 29 15.5 30 17.5 31 29.5 32 39.0 33 41.0 34 55.5 35 82.5 36 106.0 37 123.5 38 145.5 39 189.0 40 226.5 41 246.0 42 267.5 43 269.0 44 265.5 45 278.5 46 280.0 47 254.0 48 212.5 49 169.5 50 140.5 51 121.0 52 97.5 53 72.5 54 56.0 55 43.5 56 29.5 57 22.0 58 17.0 59 9.0 60 4.5 61 5.0 62 3.5 63 3.0 64 3.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.9875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.6125 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.9874999999999998 0.0 0.0 0.0 0.0 132-133 2.2875 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTCT 10 0.006841402 144.925 3 >>END_MODULE SRR7172675 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172675_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.165 33.0 33.0 34.0 33.0 34.0 2 33.29825 34.0 33.0 34.0 33.0 34.0 3 33.33325 34.0 33.0 34.0 33.0 34.0 4 33.32725 34.0 33.0 34.0 33.0 34.0 5 33.31825 34.0 33.0 34.0 33.0 34.0 6 37.487 38.0 38.0 38.0 38.0 38.0 7 37.493 38.0 38.0 38.0 38.0 38.0 8 37.51175 38.0 38.0 38.0 38.0 38.0 9 37.428 38.0 38.0 38.0 38.0 38.0 10-14 37.4801 38.0 38.0 38.0 38.0 38.0 15-19 37.47575 38.0 38.0 38.0 38.0 38.0 20-24 37.48615 38.0 38.0 38.0 38.0 38.0 25-29 37.45735 38.0 38.0 38.0 38.0 38.0 30-34 37.441 38.0 38.0 38.0 37.8 38.0 35-39 37.44610000000001 38.0 38.0 38.0 37.6 38.0 40-44 37.397949999999994 38.0 38.0 38.0 37.6 38.0 45-49 37.34485 38.0 38.0 38.0 37.2 38.0 50-54 37.3433 38.0 38.0 38.0 37.0 38.0 55-59 37.28175 38.0 38.0 38.0 37.0 38.0 60-64 37.23135 38.0 38.0 38.0 37.0 38.0 65-69 37.19065 38.0 38.0 38.0 36.8 38.0 70-74 37.1222 38.0 38.0 38.0 36.4 38.0 75-79 37.1204 38.0 38.0 38.0 36.6 38.0 80-84 37.10895 38.0 38.0 38.0 36.6 38.0 85-89 36.950149999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.88535 38.0 38.0 38.0 36.0 38.0 95-99 36.7815 38.0 38.0 38.0 35.6 38.0 100-104 36.7321 38.0 38.0 38.0 35.2 38.0 105-109 36.55055 38.0 38.0 38.0 34.6 38.0 110-114 36.474599999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.358000000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.2301 38.0 38.0 38.0 33.8 38.0 125-129 35.947250000000004 38.0 37.2 38.0 33.2 38.0 130-134 35.67905 38.0 36.8 38.0 31.8 38.0 135-139 35.246449999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.92045 38.0 35.8 38.0 28.8 38.0 145-149 34.2744 38.0 35.0 38.0 25.2 38.0 150-151 30.744374999999998 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 2.0 14 3.0 15 1.0 16 2.0 17 5.0 18 4.0 19 3.0 20 5.0 21 5.0 22 4.0 23 4.0 24 10.0 25 4.0 26 11.0 27 14.0 28 14.0 29 24.0 30 36.0 31 36.0 32 50.0 33 77.0 34 109.0 35 220.0 36 524.0 37 2825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.625 17.4 16.425 30.55 2 26.125 23.0 33.775 17.1 3 20.349999999999998 28.9 29.875 20.875 4 24.675 35.699999999999996 20.75 18.875 5 23.625 37.175000000000004 22.025 17.175 6 18.5 38.800000000000004 22.825 19.875 7 17.8 16.075 44.125 22.0 8 20.875 22.0 27.6 29.525000000000002 9 21.425 24.0 29.025000000000002 25.55 10-14 22.79 29.349999999999998 26.71 21.15 15-19 22.689999999999998 28.64 27.915 20.755000000000003 20-24 22.785 29.435 27.16 20.62 25-29 22.89 28.29 28.449999999999996 20.369999999999997 30-34 22.475 28.215 28.515 20.794999999999998 35-39 23.14 28.42 28.084999999999997 20.355 40-44 23.055 28.134999999999998 28.475 20.335 45-49 23.03 28.015 28.52 20.435 50-54 22.720000000000002 27.834999999999997 28.38 21.065 55-59 23.325000000000003 27.834999999999997 28.470000000000002 20.369999999999997 60-64 23.080000000000002 28.525 28.12 20.275000000000002 65-69 23.255 28.24 28.04 20.465 70-74 23.285 28.18 28.075 20.46 75-79 23.189999999999998 28.33 27.92 20.560000000000002 80-84 23.575 28.185 28.175 20.064999999999998 85-89 23.189999999999998 28.310000000000002 27.72 20.78 90-94 23.27 28.439999999999998 28.215 20.075000000000003 95-99 23.47 28.360000000000003 28.299999999999997 19.869999999999997 100-104 23.325000000000003 28.115000000000002 27.994999999999997 20.565 105-109 23.35 27.87 28.4 20.380000000000003 110-114 23.845 28.075 27.810000000000002 20.27 115-119 23.674999999999997 28.244999999999997 28.12 19.96 120-124 23.515 28.28 28.03 20.175 125-129 24.044999999999998 28.410000000000004 27.91 19.634999999999998 130-134 24.485 28.18 28.22 19.115 135-139 24.349999999999998 28.15 27.700000000000003 19.8 140-144 23.665 27.85 28.59 19.895 145-149 24.445 27.894999999999996 28.084999999999997 19.575 150-151 24.6875 28.037499999999998 27.55 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.0 26 1.5 27 4.0 28 10.0 29 12.0 30 12.0 31 20.0 32 26.0 33 35.5 34 56.0 35 67.0 36 91.0 37 128.0 38 150.5 39 174.0 40 198.5 41 239.0 42 277.5 43 283.5 44 281.5 45 277.5 46 276.0 47 263.0 48 229.5 49 197.0 50 160.5 51 125.0 52 104.5 53 82.0 54 57.5 55 46.0 56 30.5 57 19.5 58 17.0 59 10.0 60 11.0 61 9.0 62 3.0 63 2.0 64 1.5 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.8250000000000002 0.0 0.0 0.0 0.0 130-131 2.0625 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525754 spots for SRR7172675.sra Written 525754 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra Read 525738 spots for SRR7172675.sra Written 525738 spots for SRR7172675.sra SRR ids: ['SRR7172675.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oktnnn88 SRR7172675.sra spots: 10514776 blocks: [[1, 525738], [525739, 1051476], [1051477, 1577214], [1577215, 2102952], [2102953, 2628690], [2628691, 3154428], [3154429, 3680166], [3680167, 4205904], [4205905, 4731642], [4731643, 5257380], [5257381, 5783118], [5783119, 6308856], [6308857, 6834594], [6834595, 7360332], [7360333, 7886070], [7886071, 8411808], [8411809, 8937546], [8937547, 9463284], [9463285, 9989022], [9989023, 10514776]] SRR7172675 file size 3541412 SRR7172675 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172675 SRR7172675_1.fastq SRR7172675_2.fastq Input file: SRR7172675_1.fastq Paired file: SRR7172675_2.fastq trimmed: SRR7172675-trimmed-pair1.fastq, SRR7172675-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:22:24 2025 >> started Mon Feb 10 12:22:36 2025 >> done (12.607s) 10514776 read pairs processed; of these: 6393 ( 0.06%) short read pairs filtered out after trimming by size control 4018 ( 0.04%) empty read pairs filtered out after trimming by size control 10504365 (99.90%) read pairs available; of these: 4603401 (43.82%) trimmed read pairs available after processing 5900964 (56.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 0 0.00% 30 0 0.00% 31 4 0.00% 32 1 0.00% 33 6 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 0 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 3 0.00% 43 5 0.00% 44 3 0.00% 45 3 0.00% 46 8 0.00% 47 3 0.00% 48 5 0.00% 49 9 0.00% 50 8 0.00% 51 12 0.00% 52 14 0.00% 53 10 0.00% 54 14 0.00% 55 14 0.00% 56 15 0.00% 57 16 0.00% 58 19 0.00% 59 32 0.00% 60 32 0.00% 61 27 0.00% 62 30 0.00% 63 38 0.00% 64 54 0.00% 65 43 0.00% 66 43 0.00% 67 63 0.00% 68 68 0.00% 69 86 0.00% 70 80 0.00% 71 94 0.00% 72 145 0.00% 73 166 0.00% 74 166 0.00% 75 190 0.00% 76 251 0.00% 77 282 0.00% 78 260 0.00% 79 324 0.00% 80 421 0.00% 81 412 0.00% 82 465 0.00% 83 527 0.01% 84 930 0.01% 85 1135 0.01% 86 1219 0.01% 87 1421 0.01% 88 1514 0.01% 89 1546 0.01% 90 1844 0.02% 91 1785 0.02% 92 1924 0.02% 93 2142 0.02% 94 2305 0.02% 95 2337 0.02% 96 2570 0.02% 97 2766 0.03% 98 3018 0.03% 99 3264 0.03% 100 3456 0.03% 101 3751 0.04% 102 4024 0.04% 103 4267 0.04% 104 4809 0.05% 105 5096 0.05% 106 5398 0.05% 107 5674 0.05% 108 5957 0.06% 109 6263 0.06% 110 6855 0.07% 111 7138 0.07% 112 7625 0.07% 113 8276 0.08% 114 8762 0.08% 115 9343 0.09% 116 10063 0.10% 117 10217 0.10% 118 11168 0.11% 119 11583 0.11% 120 12050 0.11% 121 12809 0.12% 122 13468 0.13% 123 14101 0.13% 124 14907 0.14% 125 15739 0.15% 126 17019 0.16% 127 17613 0.17% 128 18595 0.18% 129 19695 0.19% 130 21079 0.20% 131 22261 0.21% 132 23943 0.23% 133 25402 0.24% 134 26766 0.25% 135 28641 0.27% 136 31361 0.30% 137 33495 0.32% 138 36513 0.35% 139 39399 0.38% 140 43296 0.41% 141 47828 0.46% 142 53793 0.51% 143 61108 0.58% 144 71572 0.68% 145 86574 0.82% 146 110541 1.05% 147 154296 1.47% 148 247577 2.36% 149 514025 4.89% 150 2591985 24.68% 151 5900964 56.18% 10504365 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.11 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=3.5 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=376.23 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=27.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=417.00 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=31.7 sequence=AAGAAGAAGAAA SRR7172675 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:23:25 Started mapping on | Feb 10 12:23:25 Finished on | Feb 10 12:24:51 Mapping speed, Million of reads per hour | 439.72 Number of input reads | 10504365 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 9812776 Uniquely mapped reads % | 93.42% Average mapped length | 296.73 Number of splices: Total | 9856678 Number of splices: Annotated (sjdb) | 9660216 Number of splices: GT/AG | 9691831 Number of splices: GC/AG | 130553 Number of splices: AT/AC | 7924 Number of splices: Non-canonical | 26370 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250693 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 19382 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447720 447720 447720 N_multimapping 250693 250693 250693 N_noFeature 307394 9723111 346378 N_ambiguous 105693 790 54471 UnstrandedReadsAssigned:9399689 PositiveStrandReadsAssigned:88875 NegativeStrandReadsAssigned:9411927 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172675 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172675-trimmed-pair1.fastq SRR7172675-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,504,365 reads, 9,342,844 reads pseudoaligned [quant] estimated average fragment length: 261.023 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,036 rounds 52401 SRR7172675.ke.tsv 34699 SRR7172675.se.tsv 87100 total ==> SRR7172675.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.98 847 52.9675 Potri.005G024800.1.v4.1 1035 774.977 105 14.895 Potri.004G059700.1.v4.1 961 701.029 21 3.29324 Potri.007G009000.2.v4.1 1416 1155.98 1 0.0951022 Potri.003G141000.2.v4.1 2943 2682.98 297 12.1697 Potri.016G087400.1.v4.1 270 72.331 621 943.858 Potri.015G069301.1.v4.1 564 311.51 0 0 Potri.010G195200.1.v4.1 1773 1512.98 209 15.1864 Potri.012G127500.1.v4.1 977 717.016 2859 438.354 ==> SRR7172675.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 91 SRR7172675 completed mapping pipeline successfully