Starting /dee2/code/volunteer_pipeline.sh SRR7172676 current disk space = 3058694668288 free memory = 1429373180 SRR7172676 SRAfilesize 3522514d1cd780277253cc71ba4b537a SRR7172676.sra SRR7172676.sra file validated SRR7172676 is paired end SRR7172676 is conventional basespace SRR7172676 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172676_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4775 33.0 32.0 33.0 28.0 34.0 2 32.3695 33.0 33.0 34.0 31.0 34.0 3 32.6955 33.0 33.0 34.0 32.0 34.0 4 32.4895 33.0 33.0 34.0 31.0 34.0 5 32.9055 33.0 33.0 34.0 32.0 34.0 6 37.14075 38.0 37.0 38.0 36.0 38.0 7 37.449 38.0 38.0 38.0 37.0 38.0 8 37.53175 38.0 38.0 38.0 38.0 38.0 9 37.61175 38.0 38.0 38.0 38.0 38.0 10-14 37.5696 38.0 38.0 38.0 38.0 38.0 15-19 37.5182 38.0 38.0 38.0 38.0 38.0 20-24 37.5246 38.0 38.0 38.0 38.0 38.0 25-29 37.49215 38.0 38.0 38.0 38.0 38.0 30-34 37.513349999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.489999999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.44245 38.0 38.0 38.0 37.2 38.0 45-49 37.2855 38.0 38.0 38.0 37.0 38.0 50-54 37.3383 38.0 38.0 38.0 37.0 38.0 55-59 37.2727 38.0 38.0 38.0 37.0 38.0 60-64 37.22375 38.0 38.0 38.0 36.4 38.0 65-69 37.20290000000001 38.0 38.0 38.0 36.8 38.0 70-74 37.1549 38.0 38.0 38.0 36.0 38.0 75-79 37.003699999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.973749999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.76705 38.0 38.0 38.0 35.2 38.0 90-94 36.77235 38.0 38.0 38.0 34.8 38.0 95-99 36.80745 38.0 38.0 38.0 35.0 38.0 100-104 36.72625 38.0 38.0 38.0 34.8 38.0 105-109 36.530899999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.26885 38.0 37.8 38.0 33.6 38.0 115-119 36.23649999999999 38.0 37.6 38.0 33.4 38.0 120-124 36.007400000000004 38.0 37.0 38.0 32.8 38.0 125-129 35.8437 38.0 37.0 38.0 32.0 38.0 130-134 35.34685 38.0 36.2 38.0 29.8 38.0 135-139 34.97995 38.0 35.6 38.0 27.8 38.0 140-144 34.7639 38.0 35.2 38.0 27.0 38.0 145-149 34.44995 38.0 34.8 38.0 27.4 38.0 150-151 30.289625 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 0.0 19 1.0 20 5.0 21 1.0 22 0.0 23 9.0 24 6.0 25 13.0 26 15.0 27 14.0 28 28.0 29 30.0 30 40.0 31 43.0 32 64.0 33 101.0 34 149.0 35 263.0 36 596.0 37 2615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.54598429186724 14.31466936914112 14.492019255130478 35.64732708386116 2 21.137393054856567 18.973326623049825 38.651233014594865 21.238047307498743 3 20.95 26.650000000000002 25.95 26.450000000000003 4 22.175 34.699999999999996 21.925 21.2 5 21.25 36.125 24.65 17.974999999999998 6 16.375 36.75 25.924999999999997 20.95 7 12.2 21.325 46.75 19.725 8 18.95 21.325 29.375 30.349999999999998 9 18.325 20.9 34.225 26.55 10-14 19.615 29.099999999999998 26.93 24.355 15-19 20.294999999999998 27.415 27.96 24.33 20-24 19.595000000000002 28.23 28.035 24.14 25-29 19.755 29.154999999999998 27.71 23.380000000000003 30-34 20.07 27.839999999999996 28.449999999999996 23.64 35-39 19.285 29.425 27.450000000000003 23.84 40-44 20.14 28.49 28.01 23.36 45-49 20.255000000000003 28.155 28.13 23.46 50-54 19.84 28.15 27.900000000000002 24.11 55-59 20.8 28.425 27.310000000000002 23.465 60-64 20.325 28.345 27.93 23.400000000000002 65-69 20.105 28.244999999999997 27.944999999999997 23.705000000000002 70-74 20.52 28.475 27.345000000000002 23.66 75-79 19.875 28.605000000000004 27.415 24.104999999999997 80-84 20.4 28.575 27.36 23.665 85-89 20.1 28.22 28.244999999999997 23.435 90-94 19.7 28.799999999999997 27.700000000000003 23.799999999999997 95-99 20.28 27.589999999999996 27.884999999999998 24.245 100-104 20.075000000000003 28.165000000000003 27.694999999999997 24.065 105-109 20.794999999999998 27.715 27.685 23.805 110-114 20.86813021953293 28.059208881332196 27.714157123568533 23.358503775566337 115-119 20.13 28.435 27.365000000000002 24.07 120-124 20.275000000000002 28.64 27.500000000000004 23.585 125-129 20.49 28.185 27.400000000000002 23.925 130-134 20.785 28.87 26.83 23.515 135-139 20.3 28.32 27.694999999999997 23.685000000000002 140-144 20.875 28.46 27.12 23.544999999999998 145-149 20.64 28.1 27.245 24.015 150-151 20.549999999999997 28.1625 26.487500000000004 24.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 2.5 25 2.5 26 3.0 27 3.5 28 4.0 29 8.0 30 18.0 31 22.0 32 25.0 33 38.0 34 54.5 35 65.0 36 82.0 37 117.5 38 152.5 39 188.0 40 216.5 41 224.0 42 229.5 43 243.0 44 266.0 45 284.5 46 278.0 47 280.0 48 250.0 49 187.0 50 155.0 51 147.5 52 121.0 53 79.5 54 58.0 55 46.5 56 37.0 57 29.0 58 23.0 59 13.0 60 7.5 61 7.0 62 6.5 63 4.5 64 4.0 65 3.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.65 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.95 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.9250000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACAT 10 0.006830828 145.0 7 CTGCACA 10 0.006830828 145.0 6 >>END_MODULE SRR7172676 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172676_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02575 34.0 33.0 34.0 32.0 34.0 2 33.083 34.0 33.0 34.0 32.0 34.0 3 33.13025 34.0 33.0 34.0 32.0 34.0 4 33.066 34.0 33.0 34.0 33.0 34.0 5 33.075 34.0 33.0 34.0 33.0 34.0 6 37.19875 38.0 38.0 38.0 37.0 38.0 7 37.194 38.0 38.0 38.0 37.0 38.0 8 37.16875 38.0 38.0 38.0 37.0 38.0 9 37.23675 38.0 38.0 38.0 37.0 38.0 10-14 37.117050000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.127050000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.102999999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.854850000000006 38.0 38.0 38.0 36.8 38.0 30-34 36.318599999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.544850000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.93044999999999 38.0 38.0 38.0 36.4 38.0 45-49 36.909099999999995 38.0 38.0 38.0 36.4 38.0 50-54 36.935900000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.795899999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.59955000000001 38.0 38.0 38.0 35.2 38.0 65-69 36.4979 38.0 38.0 38.0 34.6 38.0 70-74 36.563700000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.4595 38.0 38.0 38.0 34.6 38.0 80-84 36.3762 38.0 38.0 38.0 34.2 38.0 85-89 36.337849999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.211600000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.11335 38.0 38.0 38.0 34.0 38.0 100-104 35.931799999999996 38.0 38.0 38.0 33.2 38.0 105-109 35.7774 38.0 37.8 38.0 32.6 38.0 110-114 35.621050000000004 38.0 37.2 38.0 32.0 38.0 115-119 35.3991 38.0 37.0 38.0 31.0 38.0 120-124 35.04 38.0 36.2 38.0 28.4 38.0 125-129 34.96005 38.0 36.0 38.0 28.2 38.0 130-134 34.657450000000004 38.0 35.8 38.0 27.0 38.0 135-139 34.024649999999994 38.0 34.6 38.0 23.2 38.0 140-144 33.576499999999996 38.0 33.0 38.0 21.8 38.0 145-149 32.3882 38.0 32.6 38.0 10.8 38.0 150-151 27.0945 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 3.0 5 4.0 6 3.0 7 2.0 8 1.0 9 1.0 10 2.0 11 3.0 12 4.0 13 4.0 14 3.0 15 3.0 16 6.0 17 5.0 18 5.0 19 3.0 20 7.0 21 7.0 22 14.0 23 11.0 24 10.0 25 18.0 26 16.0 27 23.0 28 32.0 29 39.0 30 38.0 31 66.0 32 87.0 33 115.0 34 168.0 35 297.0 36 608.0 37 2376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.375 15.875 17.325 29.425 2 24.375 23.799999999999997 34.375 17.45 3 20.849999999999998 25.275 31.85 22.025 4 24.15 34.300000000000004 22.0 19.55 5 23.45 37.125 22.1 17.325 6 17.8 37.65 25.1 19.45 7 18.175 16.650000000000002 44.65 20.525 8 20.5 21.55 27.875 30.075000000000003 9 21.85 24.349999999999998 28.325 25.474999999999998 10-14 22.7 28.28 27.339999999999996 21.68 15-19 22.919999999999998 27.22 28.54 21.32 20-24 23.544999999999998 27.68 27.994999999999997 20.78 25-29 22.627663852030558 27.80458383594692 28.568556493767595 20.999195818254925 30-34 22.830188679245282 28.204997450280466 27.659357470678223 21.30545639979602 35-39 22.85094139619403 27.858260562313863 28.484175458078848 20.806622583413255 40-44 23.16 28.04 27.43 21.37 45-49 23.48 28.155 27.525 20.84 50-54 22.88 28.735 27.97 20.415 55-59 23.555 27.595 27.900000000000002 20.95 60-64 23.45 27.889999999999997 27.97 20.69 65-69 23.52 28.075 27.595 20.810000000000002 70-74 23.085 27.534999999999997 28.09 21.29 75-79 23.355 28.27 27.485 20.89 80-84 23.485 27.860000000000003 27.915 20.74 85-89 23.845 27.405 28.249999999999996 20.5 90-94 23.455000000000002 28.189999999999998 28.035 20.32 95-99 23.505000000000003 27.650000000000002 27.775 21.07 100-104 24.065 27.765 27.99 20.18 105-109 23.45 27.975 27.57 21.005 110-114 23.93 27.525 28.155 20.39 115-119 24.065 27.875 27.744999999999997 20.315 120-124 23.705000000000002 27.865000000000002 27.839999999999996 20.59 125-129 24.09 27.63 27.884999999999998 20.395 130-134 24.044999999999998 27.685 27.91 20.36 135-139 24.665 27.685 27.705000000000002 19.945 140-144 24.59 27.77 27.865000000000002 19.775000000000002 145-149 24.675 27.950000000000003 27.0 20.375 150-151 25.7875 27.375 26.7625 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.5 27 3.0 28 4.0 29 9.0 30 11.5 31 15.0 32 22.0 33 27.0 34 46.0 35 67.0 36 88.5 37 104.5 38 128.0 39 170.0 40 193.0 41 221.0 42 254.0 43 278.0 44 293.0 45 288.5 46 279.5 47 274.5 48 247.5 49 201.0 50 179.5 51 153.0 52 111.5 53 81.5 54 64.5 55 51.5 56 36.5 57 25.0 58 15.0 59 12.0 60 9.0 61 6.0 62 7.0 63 5.0 64 1.5 65 1.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.52 30-34 1.95 35-39 0.9450000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7125 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.3875 0.0 0.0 0.0 0.0 132-133 2.8125 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.4 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 35 0.0035543363 20.69643 115-119 >>END_MODULE Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641837 spots for SRR7172676.sra Written 641837 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra Read 641832 spots for SRR7172676.sra Written 641832 spots for SRR7172676.sra SRR ids: ['SRR7172676.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7e61_0x4 SRR7172676.sra spots: 12836645 blocks: [[1, 641832], [641833, 1283664], [1283665, 1925496], [1925497, 2567328], [2567329, 3209160], [3209161, 3850992], [3850993, 4492824], [4492825, 5134656], [5134657, 5776488], [5776489, 6418320], [6418321, 7060152], [7060153, 7701984], [7701985, 8343816], [8343817, 8985648], [8985649, 9627480], [9627481, 10269312], [10269313, 10911144], [10911145, 11552976], [11552977, 12194808], [12194809, 12836645]] SRR7172676 file size 4328217 SRR7172676 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172676 SRR7172676_1.fastq SRR7172676_2.fastq Input file: SRR7172676_1.fastq Paired file: SRR7172676_2.fastq trimmed: SRR7172676-trimmed-pair1.fastq, SRR7172676-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:28:15 2025 >> started Mon Feb 10 12:28:28 2025 >> done (13.024s) 12836645 read pairs processed; of these: 14562 ( 0.11%) short read pairs filtered out after trimming by size control 10824 ( 0.08%) empty read pairs filtered out after trimming by size control 12811259 (99.80%) read pairs available; of these: 6492660 (50.68%) trimmed read pairs available after processing 6318599 (49.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 1 0.00% 39 7 0.00% 40 0 0.00% 41 4 0.00% 42 5 0.00% 43 2 0.00% 44 3 0.00% 45 2 0.00% 46 3 0.00% 47 11 0.00% 48 8 0.00% 49 12 0.00% 50 11 0.00% 51 12 0.00% 52 15 0.00% 53 6 0.00% 54 17 0.00% 55 23 0.00% 56 23 0.00% 57 25 0.00% 58 18 0.00% 59 37 0.00% 60 40 0.00% 61 37 0.00% 62 49 0.00% 63 55 0.00% 64 56 0.00% 65 54 0.00% 66 75 0.00% 67 70 0.00% 68 94 0.00% 69 126 0.00% 70 104 0.00% 71 140 0.00% 72 150 0.00% 73 166 0.00% 74 204 0.00% 75 246 0.00% 76 324 0.00% 77 325 0.00% 78 398 0.00% 79 419 0.00% 80 493 0.00% 81 565 0.00% 82 702 0.01% 83 878 0.01% 84 1603 0.01% 85 1935 0.02% 86 2047 0.02% 87 2115 0.02% 88 2273 0.02% 89 2296 0.02% 90 2535 0.02% 91 2678 0.02% 92 2815 0.02% 93 2986 0.02% 94 3159 0.02% 95 3335 0.03% 96 3729 0.03% 97 4022 0.03% 98 4311 0.03% 99 4525 0.04% 100 4937 0.04% 101 5034 0.04% 102 5886 0.05% 103 6206 0.05% 104 6519 0.05% 105 7044 0.05% 106 7588 0.06% 107 7787 0.06% 108 8565 0.07% 109 9195 0.07% 110 9525 0.07% 111 10451 0.08% 112 11308 0.09% 113 11675 0.09% 114 12191 0.10% 115 13321 0.10% 116 14151 0.11% 117 14632 0.11% 118 15277 0.12% 119 16197 0.13% 120 16997 0.13% 121 17886 0.14% 122 18859 0.15% 123 19892 0.16% 124 20985 0.16% 125 22270 0.17% 126 23556 0.18% 127 24731 0.19% 128 26042 0.20% 129 27494 0.21% 130 29155 0.23% 131 30441 0.24% 132 32514 0.25% 133 34315 0.27% 134 36275 0.28% 135 38512 0.30% 136 41362 0.32% 137 44005 0.34% 138 47038 0.37% 139 50722 0.40% 140 55714 0.43% 141 61461 0.48% 142 68680 0.54% 143 76008 0.59% 144 87896 0.69% 145 104787 0.82% 146 130229 1.02% 147 179202 1.40% 148 280913 2.19% 149 703570 5.49% 150 3891251 30.37% 151 6318599 49.32% 12811259 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=13 fanout-score=393.41 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=3.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=121.97 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=21.2 sequence=CAAAGAAGAAGAT SRR7172676 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:29:13 Started mapping on | Feb 10 12:29:13 Finished on | Feb 10 12:30:30 Mapping speed, Million of reads per hour | 598.97 Number of input reads | 12811259 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12180594 Uniquely mapped reads % | 95.08% Average mapped length | 296.20 Number of splices: Total | 12725113 Number of splices: Annotated (sjdb) | 12546747 Number of splices: GT/AG | 12530968 Number of splices: GC/AG | 155171 Number of splices: AT/AC | 8982 Number of splices: Non-canonical | 29992 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321728 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 24669 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322958 322958 322958 N_multimapping 321728 321728 321728 N_noFeature 229265 12087644 264678 N_ambiguous 115431 579 57479 UnstrandedReadsAssigned:11835898 PositiveStrandReadsAssigned:92371 NegativeStrandReadsAssigned:11858437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172676 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172676-trimmed-pair1.fastq SRR7172676-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,811,259 reads, 11,747,250 reads pseudoaligned [quant] estimated average fragment length: 252.59 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7172676.ke.tsv 34699 SRR7172676.se.tsv 87100 total ==> SRR7172676.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.41 612 28.343 Potri.005G024800.1.v4.1 1035 783.41 277 28.9252 Potri.004G059700.1.v4.1 961 709.456 13 1.49901 Potri.007G009000.2.v4.1 1416 1164.41 0 0 Potri.003G141000.2.v4.1 2943 2691.41 339 10.304 Potri.016G087400.1.v4.1 270 74.4422 1031 1132.99 Potri.015G069301.1.v4.1 564 318.384 0 0 Potri.010G195200.1.v4.1 1773 1521.41 88 4.73176 Potri.012G127500.1.v4.1 977 725.431 1164 131.263 ==> SRR7172676.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 204 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 76 SRR7172676 completed mapping pipeline successfully