Starting /dee2/code/volunteer_pipeline.sh SRR7172677 current disk space = 3058621345792 free memory = 1211117316 SRR7172677 SRAfilesize 4827c7811be9a582e00265bbca625999 SRR7172677.sra SRR7172677.sra file validated SRR7172677 is paired end SRR7172677 is conventional basespace SRR7172677 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172677_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.5055 32.0 18.0 33.0 18.0 33.0 2 31.00275 33.0 30.0 33.0 27.0 34.0 3 31.17625 33.0 32.0 33.0 27.0 33.0 4 30.5435 32.0 31.0 33.0 25.0 33.0 5 32.182 33.0 32.0 33.0 32.0 33.0 6 36.87125 38.0 37.0 38.0 35.0 38.0 7 37.47475 38.0 38.0 38.0 37.0 38.0 8 37.638 38.0 38.0 38.0 38.0 38.0 9 37.66425 38.0 38.0 38.0 38.0 38.0 10-14 37.670550000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.62035 38.0 38.0 38.0 38.0 38.0 20-24 37.63105 38.0 38.0 38.0 38.0 38.0 25-29 37.597049999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.64205 38.0 38.0 38.0 38.0 38.0 35-39 37.58735 38.0 38.0 38.0 38.0 38.0 40-44 37.549099999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.5307 38.0 38.0 38.0 38.0 38.0 50-54 37.467 38.0 38.0 38.0 37.8 38.0 55-59 37.3608 38.0 38.0 38.0 37.0 38.0 60-64 37.368100000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.33285 38.0 38.0 38.0 37.0 38.0 70-74 37.28215 38.0 38.0 38.0 37.0 38.0 75-79 37.20205 38.0 38.0 38.0 37.0 38.0 80-84 37.131299999999996 38.0 38.0 38.0 36.4 38.0 85-89 36.94835 38.0 38.0 38.0 36.0 38.0 90-94 36.97505 38.0 38.0 38.0 36.0 38.0 95-99 37.031600000000005 38.0 38.0 38.0 36.0 38.0 100-104 36.8814 38.0 38.0 38.0 35.8 38.0 105-109 36.66805 38.0 38.0 38.0 35.0 38.0 110-114 36.52645 38.0 38.0 38.0 34.2 38.0 115-119 36.47935 38.0 38.0 38.0 34.0 38.0 120-124 36.4028 38.0 38.0 38.0 34.0 38.0 125-129 36.0668 38.0 37.8 38.0 33.4 38.0 130-134 35.761849999999995 38.0 36.8 38.0 32.2 38.0 135-139 35.404 38.0 36.0 38.0 30.6 38.0 140-144 35.3299 38.0 36.0 38.0 31.0 38.0 145-149 35.135450000000006 38.0 36.0 38.0 30.6 38.0 150-151 32.12125 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 1.0 19 3.0 20 8.0 21 1.0 22 3.0 23 4.0 24 10.0 25 5.0 26 15.0 27 9.0 28 17.0 29 24.0 30 27.0 31 36.0 32 52.0 33 78.0 34 113.0 35 219.0 36 599.0 37 2769.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.03987807975616 13.48742697485395 13.004826009652017 34.46786893573787 2 20.040281973816718 16.8932527693857 37.66364551863041 25.40281973816717 3 19.75 23.325000000000003 26.05 30.875000000000004 4 23.474999999999998 32.15 21.099999999999998 23.275000000000002 5 21.8 35.15 23.7 19.35 6 17.424999999999997 34.2 26.200000000000003 22.175 7 13.450000000000001 24.05 43.4 19.1 8 16.675 24.75 31.3 27.275 9 18.15 24.275 31.75 25.825 10-14 18.95 30.564999999999998 27.134999999999998 23.35 15-19 19.38 28.549999999999997 28.035 24.035 20-24 19.139999999999997 28.865000000000002 28.265 23.73 25-29 19.055 28.52 28.255000000000003 24.169999999999998 30-34 19.39 28.965000000000003 27.62 24.025 35-39 19.5 28.505000000000003 27.55 24.445 40-44 20.215 28.4 27.310000000000002 24.075 45-49 19.900000000000002 28.46 27.71 23.93 50-54 19.715 28.449999999999996 28.005000000000003 23.830000000000002 55-59 19.89 28.21 27.544999999999998 24.355 60-64 19.515 28.62 27.689999999999998 24.175 65-69 19.650000000000002 28.560000000000002 27.47 24.32 70-74 19.53 28.555000000000003 27.295 24.62 75-79 19.755 28.07 28.225 23.95 80-84 19.509999999999998 27.735 28.470000000000002 24.285 85-89 20.115 28.185 27.305 24.395 90-94 20.044999999999998 28.494999999999997 27.750000000000004 23.71 95-99 19.7 28.035 28.155 24.11 100-104 20.369999999999997 28.13 27.49 24.01 105-109 20.044999999999998 27.175 28.23 24.55 110-114 20.215 27.825 27.560000000000002 24.4 115-119 20.145 27.639999999999997 27.98 24.235 120-124 20.25 27.485 27.67 24.595 125-129 20.715 27.474999999999998 27.76 24.05 130-134 20.599999999999998 27.994999999999997 27.134999999999998 24.27 135-139 20.565 28.084999999999997 27.43 23.919999999999998 140-144 20.445 27.275 27.85 24.43 145-149 20.395 27.834999999999997 26.740000000000002 25.03 150-151 20.724999999999998 27.5875 26.887499999999996 24.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 0.5 25 4.0 26 8.0 27 9.5 28 12.0 29 12.5 30 14.0 31 22.5 32 32.5 33 39.5 34 52.0 35 71.0 36 98.0 37 118.0 38 135.5 39 161.0 40 200.0 41 223.5 42 228.0 43 253.5 44 277.5 45 288.5 46 280.0 47 262.5 48 248.0 49 202.5 50 147.5 51 128.0 52 114.0 53 87.5 54 70.5 55 51.0 56 28.0 57 22.5 58 20.5 59 18.0 60 13.5 61 6.5 62 4.5 63 5.5 64 5.5 65 2.0 66 3.0 67 3.0 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.7000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09182643794148 98.2 2 0.9081735620585267 1.7999999999999998 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.225 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.8499999999999996 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.324999999999999 0.0 0.0 0.0 0.0 134-135 6.8625 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172677 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172677_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04025 34.0 33.0 34.0 32.0 34.0 2 33.1225 34.0 33.0 34.0 33.0 34.0 3 33.035 34.0 33.0 34.0 33.0 34.0 4 32.993 34.0 33.0 34.0 33.0 34.0 5 33.03025 34.0 33.0 34.0 33.0 34.0 6 37.04725 38.0 38.0 38.0 37.0 38.0 7 37.07275 38.0 38.0 38.0 37.0 38.0 8 37.06825 38.0 38.0 38.0 38.0 38.0 9 37.02975 38.0 38.0 38.0 37.0 38.0 10-14 36.9962 38.0 38.0 38.0 37.2 38.0 15-19 37.00005 38.0 38.0 38.0 37.6 38.0 20-24 36.948299999999996 38.0 38.0 38.0 37.4 38.0 25-29 36.75415 38.0 38.0 38.0 36.8 38.0 30-34 36.3069 38.0 38.0 38.0 36.6 38.0 35-39 36.5206 38.0 38.0 38.0 36.0 38.0 40-44 36.8203 38.0 38.0 38.0 37.0 38.0 45-49 36.859300000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.822050000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.7588 38.0 38.0 38.0 36.8 38.0 60-64 36.55145 38.0 38.0 38.0 36.0 38.0 65-69 36.51975 38.0 38.0 38.0 35.8 38.0 70-74 36.51035 38.0 38.0 38.0 36.0 38.0 75-79 36.50855 38.0 38.0 38.0 35.8 38.0 80-84 36.4737 38.0 38.0 38.0 35.4 38.0 85-89 36.4097 38.0 38.0 38.0 35.0 38.0 90-94 36.282650000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.2529 38.0 38.0 38.0 34.6 38.0 100-104 36.21755 38.0 38.0 38.0 34.4 38.0 105-109 36.141450000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.017450000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.8258 38.0 38.0 38.0 33.6 38.0 120-124 35.54175 38.0 37.6 38.0 32.0 38.0 125-129 35.260000000000005 38.0 36.6 38.0 31.0 38.0 130-134 35.04494999999999 38.0 36.0 38.0 29.2 38.0 135-139 34.783100000000005 38.0 36.0 38.0 28.2 38.0 140-144 34.3506 38.0 35.6 38.0 26.2 38.0 145-149 33.748400000000004 38.0 34.2 38.0 21.6 38.0 150-151 29.244875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 15.0 4 5.0 5 5.0 6 3.0 7 2.0 8 3.0 9 2.0 10 3.0 11 4.0 12 3.0 13 5.0 14 0.0 15 3.0 16 1.0 17 3.0 18 3.0 19 6.0 20 4.0 21 8.0 22 8.0 23 11.0 24 6.0 25 13.0 26 15.0 27 15.0 28 22.0 29 21.0 30 31.0 31 51.0 32 60.0 33 78.0 34 132.0 35 227.0 36 488.0 37 2723.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.224999999999994 16.525000000000002 18.275 26.974999999999998 2 23.65 23.799999999999997 35.425000000000004 17.125 3 21.775 28.225 30.175 19.825 4 25.75 33.15 22.05 19.05 5 25.174999999999997 35.5 22.85 16.475 6 19.425 37.3 24.224999999999998 19.05 7 20.325 18.375 40.300000000000004 21.0 8 22.025 22.7 28.4 26.875 9 23.925 25.424999999999997 27.375 23.275000000000002 10-14 24.404999999999998 29.215000000000003 26.135 20.244999999999997 15-19 24.27 28.139999999999997 27.42 20.169999999999998 20-24 24.205 28.444999999999997 26.935 20.415 25-29 23.932911519534 28.743597469117205 27.131666164507383 20.19182484684142 30-34 24.002237022726117 28.155981493721082 27.67807209314149 20.16370939041131 35-39 23.722921914357684 28.690176322418136 27.032745591939545 20.554156171284635 40-44 24.095 28.050000000000004 27.42 20.435 45-49 24.165 27.935 27.305 20.595 50-54 24.285 27.98 27.62 20.115 55-59 24.855 27.67 27.675 19.8 60-64 25.1 27.365000000000002 27.655 19.88 65-69 24.865000000000002 28.22 27.075 19.84 70-74 24.05 28.26 27.555000000000003 20.135 75-79 24.215 28.02 27.6 20.165 80-84 24.785 27.775 27.525 19.915 85-89 24.42 28.275 27.529999999999998 19.775000000000002 90-94 23.625 28.615000000000002 27.605 20.155 95-99 24.29 28.15 27.98 19.580000000000002 100-104 24.529999999999998 28.42 27.265 19.785 105-109 24.185000000000002 28.48 27.62 19.715 110-114 24.645 27.994999999999997 27.584999999999997 19.775000000000002 115-119 24.465 27.71 28.02 19.805 120-124 24.529999999999998 28.560000000000002 27.139999999999997 19.77 125-129 25.345000000000002 28.060000000000002 27.265 19.33 130-134 25.55 28.000000000000004 27.485 18.965 135-139 25.105 28.075 27.384999999999998 19.435 140-144 26.27 27.955000000000002 26.795 18.98 145-149 26.290000000000003 27.88 27.05 18.78 150-151 26.525 28.449999999999996 26.35 18.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 5.5 28 8.0 29 10.0 30 8.0 31 12.5 32 21.0 33 27.5 34 35.5 35 46.0 36 61.5 37 87.0 38 129.0 39 167.5 40 192.5 41 225.0 42 269.5 43 284.0 44 283.0 45 307.0 46 300.0 47 264.5 48 236.5 49 207.0 50 180.5 51 149.5 52 115.5 53 91.0 54 69.5 55 49.0 56 36.5 57 27.5 58 21.0 59 16.5 60 11.0 61 5.5 62 4.0 63 3.5 64 4.0 65 3.5 66 3.0 67 4.0 68 3.5 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.43 30-34 1.6549999999999998 35-39 0.75 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0125 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.21250000000000002 0.0 0.0 0.025 0.0 94-95 0.2625 0.0 0.0 0.025 0.0 96-97 0.3125 0.0 0.0 0.025 0.0 98-99 0.3875 0.0 0.0 0.025 0.0 100-101 0.5125 0.0 0.0 0.025 0.0 102-103 0.6625 0.0 0.0 0.025 0.0 104-105 0.925 0.0 0.0 0.025 0.0 106-107 1.0375 0.0 0.0 0.025 0.0 108-109 1.2875 0.0 0.0 0.025 0.0 110-111 1.5375 0.0 0.0 0.025 0.0 112-113 1.9 0.0 0.0 0.025 0.0 114-115 2.225 0.0 0.0 0.025 0.0 116-117 2.425 0.0 0.0 0.025 0.0 118-119 2.875 0.0 0.0 0.025 0.0 120-121 3.3875 0.0 0.0 0.025 0.0 122-123 3.9 0.0 0.0 0.025 0.0 124-125 4.300000000000001 0.0 0.0 0.025 0.0 126-127 4.85 0.0 0.0 0.025 0.0 128-129 5.324999999999999 0.0 0.0 0.025 0.0 130-131 5.85 0.0 0.0 0.025 0.0 132-133 6.475 0.0 0.0 0.025 0.0 134-135 7.0375 0.0 0.0 0.025 0.0 136-137 7.550000000000001 0.0 0.0 0.025 0.0 138-139 8.175 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATAAA 10 0.006867937 144.7375 8 AATAAAT 10 0.006867937 144.7375 9 >>END_MODULE Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra Read 619878 spots for SRR7172677.sra Written 619878 spots for SRR7172677.sra Read 619860 spots for SRR7172677.sra Written 619860 spots for SRR7172677.sra SRR ids: ['SRR7172677.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ec20ygyw SRR7172677.sra spots: 12397218 blocks: [[1, 619860], [619861, 1239720], [1239721, 1859580], [1859581, 2479440], [2479441, 3099300], [3099301, 3719160], [3719161, 4339020], [4339021, 4958880], [4958881, 5578740], [5578741, 6198600], [6198601, 6818460], [6818461, 7438320], [7438321, 8058180], [8058181, 8678040], [8678041, 9297900], [9297901, 9917760], [9917761, 10537620], [10537621, 11157480], [11157481, 11777340], [11777341, 12397218]] SRR7172677 file size 4179310 SRR7172677 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172677 SRR7172677_1.fastq SRR7172677_2.fastq Input file: SRR7172677_1.fastq Paired file: SRR7172677_2.fastq trimmed: SRR7172677-trimmed-pair1.fastq, SRR7172677-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:34:53 2025 >> started Mon Feb 10 12:35:07 2025 >> done (14.337s) 12397218 read pairs processed; of these: 37860 ( 0.31%) short read pairs filtered out after trimming by size control 28859 ( 0.23%) empty read pairs filtered out after trimming by size control 12330499 (99.46%) read pairs available; of these: 5529072 (44.84%) trimmed read pairs available after processing 6801427 (55.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 2 0.00% 22 8 0.00% 23 3 0.00% 24 3 0.00% 25 3 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 3 0.00% 30 5 0.00% 31 8 0.00% 32 6 0.00% 33 3 0.00% 34 4 0.00% 35 2 0.00% 36 5 0.00% 37 3 0.00% 38 2 0.00% 39 4 0.00% 40 4 0.00% 41 7 0.00% 42 3 0.00% 43 5 0.00% 44 6 0.00% 45 7 0.00% 46 7 0.00% 47 5 0.00% 48 7 0.00% 49 12 0.00% 50 20 0.00% 51 25 0.00% 52 21 0.00% 53 25 0.00% 54 26 0.00% 55 26 0.00% 56 42 0.00% 57 30 0.00% 58 39 0.00% 59 47 0.00% 60 50 0.00% 61 74 0.00% 62 72 0.00% 63 105 0.00% 64 110 0.00% 65 129 0.00% 66 158 0.00% 67 169 0.00% 68 203 0.00% 69 216 0.00% 70 239 0.00% 71 282 0.00% 72 353 0.00% 73 345 0.00% 74 449 0.00% 75 515 0.00% 76 590 0.00% 77 731 0.01% 78 786 0.01% 79 805 0.01% 80 1028 0.01% 81 1133 0.01% 82 1281 0.01% 83 1643 0.01% 84 3425 0.03% 85 4546 0.04% 86 4531 0.04% 87 4737 0.04% 88 4953 0.04% 89 5059 0.04% 90 5252 0.04% 91 5565 0.05% 92 5877 0.05% 93 6162 0.05% 94 6867 0.06% 95 7289 0.06% 96 7829 0.06% 97 8362 0.07% 98 8962 0.07% 99 9760 0.08% 100 10456 0.08% 101 11342 0.09% 102 12034 0.10% 103 12909 0.10% 104 14035 0.11% 105 14819 0.12% 106 15920 0.13% 107 16794 0.14% 108 17867 0.14% 109 19109 0.15% 110 19964 0.16% 111 21288 0.17% 112 22433 0.18% 113 23374 0.19% 114 25125 0.20% 115 26166 0.21% 116 27605 0.22% 117 28666 0.23% 118 30017 0.24% 119 31153 0.25% 120 32502 0.26% 121 33787 0.27% 122 35520 0.29% 123 36935 0.30% 124 38799 0.31% 125 39621 0.32% 126 41389 0.34% 127 42952 0.35% 128 44849 0.36% 129 46026 0.37% 130 47967 0.39% 131 49065 0.40% 132 51124 0.41% 133 53244 0.43% 134 54890 0.45% 135 57413 0.47% 136 59330 0.48% 137 62474 0.51% 138 64478 0.52% 139 67407 0.55% 140 70124 0.57% 141 74490 0.60% 142 78973 0.64% 143 84456 0.68% 144 92201 0.75% 145 104268 0.85% 146 121800 0.99% 147 152561 1.24% 148 215623 1.75% 149 489799 3.97% 150 2572851 20.87% 151 6801427 55.16% 12330499 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=11.89 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=2.0 sequence=TCTCAGCACCAGAGTTCATCTCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=30 prefix-density=0.47 prefix-fanout=2.9 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=335.26 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.8 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7172677 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:35:59 Started mapping on | Feb 10 12:36:00 Finished on | Feb 10 12:37:09 Mapping speed, Million of reads per hour | 643.33 Number of input reads | 12330499 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11648450 Uniquely mapped reads % | 94.47% Average mapped length | 292.87 Number of splices: Total | 11808680 Number of splices: Annotated (sjdb) | 11576451 Number of splices: GT/AG | 11627196 Number of splices: GC/AG | 140365 Number of splices: AT/AC | 8778 Number of splices: Non-canonical | 32341 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263653 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 68418 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447210 447210 447210 N_multimapping 263653 263653 263653 N_noFeature 280839 11546163 312881 N_ambiguous 122154 567 51677 UnstrandedReadsAssigned:11245457 PositiveStrandReadsAssigned:101720 NegativeStrandReadsAssigned:11283892 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172677 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172677-trimmed-pair1.fastq SRR7172677-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,330,499 reads, 11,240,712 reads pseudoaligned [quant] estimated average fragment length: 210.581 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7172677.ke.tsv 34699 SRR7172677.se.tsv 87100 total ==> SRR7172677.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.42 1281 51.9438 Potri.005G024800.1.v4.1 1035 825.419 930 82.6213 Potri.004G059700.1.v4.1 961 751.419 5 0.487945 Potri.007G009000.2.v4.1 1416 1206.42 0 0 Potri.003G141000.2.v4.1 2943 2733.42 563 15.1038 Potri.016G087400.1.v4.1 270 86.3605 1147.57 974.424 Potri.015G069301.1.v4.1 564 355.273 0 0 Potri.010G195200.1.v4.1 1773 1563.42 236 11.0693 Potri.012G127500.1.v4.1 977 767.419 4001 382.313 ==> SRR7172677.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 545 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 62 SRR7172677 completed mapping pipeline successfully