Starting /dee2/code/volunteer_pipeline.sh SRR7172678 current disk space = 3058998362112 free memory = 1580109008 SRR7172678 SRAfilesize 3d7e64ce0837f3ce6c6581b43a0ab2f6 SRR7172678.sra SRR7172678.sra file validated SRR7172678 is paired end SRR7172678 is conventional basespace SRR7172678 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172678_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.07125 25.0 18.0 32.0 18.0 33.0 2 30.3655 31.0 29.0 33.0 27.0 33.0 3 31.75225 33.0 32.0 33.0 27.0 33.0 4 31.68225 33.0 32.0 33.0 30.0 33.0 5 32.2965 33.0 32.0 33.0 31.0 34.0 6 37.1385 38.0 37.0 38.0 36.0 38.0 7 37.50575 38.0 38.0 38.0 37.0 38.0 8 37.56475 38.0 38.0 38.0 38.0 38.0 9 37.49475 38.0 38.0 38.0 38.0 38.0 10-14 37.57665 38.0 38.0 38.0 38.0 38.0 15-19 37.549400000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.49455 38.0 38.0 38.0 38.0 38.0 25-29 37.5762 38.0 38.0 38.0 38.0 38.0 30-34 37.513349999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.48585 38.0 38.0 38.0 37.8 38.0 40-44 37.45375 38.0 38.0 38.0 37.8 38.0 45-49 37.3754 38.0 38.0 38.0 37.2 38.0 50-54 37.35080000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.241600000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.26664999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.16685 38.0 38.0 38.0 36.6 38.0 70-74 37.1137 38.0 38.0 38.0 36.4 38.0 75-79 37.00305 38.0 38.0 38.0 35.8 38.0 80-84 36.847950000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.78679999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.82365 38.0 38.0 38.0 35.2 38.0 95-99 36.819449999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.629200000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.303349999999995 38.0 37.8 38.0 33.6 38.0 110-114 36.11775 38.0 37.4 38.0 33.2 38.0 115-119 36.15045 38.0 37.4 38.0 33.6 38.0 120-124 36.0379 38.0 37.0 38.0 33.0 38.0 125-129 35.6336 38.0 36.4 38.0 31.0 38.0 130-134 35.06054999999999 38.0 35.6 38.0 28.8 38.0 135-139 34.8753 38.0 35.4 38.0 27.8 38.0 140-144 34.77105 38.0 35.0 38.0 27.8 38.0 145-149 34.41585 38.0 35.0 38.0 27.0 38.0 150-151 30.554499999999997 36.0 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 4.0 19 3.0 20 5.0 21 4.0 22 7.0 23 5.0 24 9.0 25 12.0 26 8.0 27 9.0 28 20.0 29 25.0 30 34.0 31 61.0 32 88.0 33 95.0 34 151.0 35 278.0 36 714.0 37 2462.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.32010243277849 14.801536491677336 12.010243277848911 42.86811779769526 2 17.14860447573548 18.984158913754086 39.75358310284134 24.1136535076691 3 20.1 23.25 27.625 29.025000000000002 4 24.175 31.424999999999997 21.475 22.925 5 22.8 33.975 24.375 18.85 6 17.724999999999998 35.099999999999994 25.85 21.325 7 13.975000000000001 22.325 43.775 19.925 8 17.9 22.1 31.924999999999997 28.075 9 18.15 22.675 32.550000000000004 26.625 10-14 19.38 29.134999999999998 27.045 24.44 15-19 19.465 28.175 28.060000000000002 24.3 20-24 19.96 28.07 28.125 23.845 25-29 19.6 28.46 27.694999999999997 24.245 30-34 19.915 27.935 27.905 24.245 35-39 20.01 28.425 28.005000000000003 23.56 40-44 19.725 28.175 28.165000000000003 23.935000000000002 45-49 20.24 27.91 27.88 23.97 50-54 20.169999999999998 27.325 28.199999999999996 24.305 55-59 20.105 28.425 27.839999999999996 23.630000000000003 60-64 19.685 28.32 28.28 23.715 65-69 20.3 27.61 28.37 23.72 70-74 19.96 27.894999999999996 28.28 23.865 75-79 19.85 27.700000000000003 28.199999999999996 24.25 80-84 20.315 27.73 27.775 24.18 85-89 20.235 28.225 27.800000000000004 23.74 90-94 20.095 27.99 27.61 24.305 95-99 20.365 27.384999999999998 27.894999999999996 24.355 100-104 20.48 27.87 27.99 23.66 105-109 20.775 27.68 27.915 23.630000000000003 110-114 20.565 27.544999999999998 28.17 23.72 115-119 20.305 28.53 27.860000000000003 23.305 120-124 20.44 27.544999999999998 27.950000000000003 24.065 125-129 20.080000000000002 27.689999999999998 27.950000000000003 24.279999999999998 130-134 20.74 27.71 27.68 23.87 135-139 20.845 27.815 27.33 24.01 140-144 21.015 27.165 27.939999999999998 23.880000000000003 145-149 21.455 27.705000000000002 27.279999999999998 23.56 150-151 21.099999999999998 28.050000000000004 27.3125 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.5 26 3.0 27 6.0 28 8.5 29 10.0 30 14.0 31 21.0 32 27.0 33 32.5 34 42.5 35 66.0 36 87.5 37 103.0 38 132.0 39 158.0 40 193.0 41 239.0 42 253.5 43 267.5 44 280.5 45 291.5 46 281.0 47 258.5 48 256.5 49 216.0 50 167.0 51 130.5 52 95.0 53 75.5 54 61.5 55 47.0 56 38.5 57 29.0 58 23.5 59 21.5 60 16.0 61 10.0 62 8.5 63 7.0 64 3.5 65 1.5 66 1.0 67 1.5 68 1.0 69 1.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4125 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGCT 10 0.0068343505 144.975 9 CAACGAA 10 0.0068343505 144.975 9 >>END_MODULE SRR7172678 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172678_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06775 34.0 33.0 34.0 32.0 34.0 2 33.17875 34.0 33.0 34.0 33.0 34.0 3 33.1945 34.0 33.0 34.0 33.0 34.0 4 33.156 34.0 33.0 34.0 33.0 34.0 5 33.08275 34.0 33.0 34.0 33.0 34.0 6 37.1925 38.0 38.0 38.0 37.0 38.0 7 37.205 38.0 38.0 38.0 37.0 38.0 8 37.29775 38.0 38.0 38.0 37.0 38.0 9 37.37125 38.0 38.0 38.0 38.0 38.0 10-14 37.2601 38.0 38.0 38.0 37.0 38.0 15-19 37.2778 38.0 38.0 38.0 37.0 38.0 20-24 37.24125 38.0 38.0 38.0 37.0 38.0 25-29 37.0744 38.0 38.0 38.0 37.0 38.0 30-34 36.477549999999994 38.0 38.0 38.0 36.2 38.0 35-39 36.681200000000004 38.0 38.0 38.0 36.0 38.0 40-44 37.07115 38.0 38.0 38.0 37.0 38.0 45-49 37.08075 38.0 38.0 38.0 37.0 38.0 50-54 37.059900000000006 38.0 38.0 38.0 37.0 38.0 55-59 36.965650000000004 38.0 38.0 38.0 36.2 38.0 60-64 36.7856 38.0 38.0 38.0 36.0 38.0 65-69 36.61425 38.0 38.0 38.0 35.2 38.0 70-74 36.721000000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.72135 38.0 38.0 38.0 35.4 38.0 80-84 36.74115 38.0 38.0 38.0 35.2 38.0 85-89 36.6556 38.0 38.0 38.0 35.2 38.0 90-94 36.58435 38.0 38.0 38.0 35.0 38.0 95-99 36.4653 38.0 38.0 38.0 34.6 38.0 100-104 36.307050000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.19885 38.0 38.0 38.0 34.0 38.0 110-114 36.07005 38.0 37.8 38.0 33.4 38.0 115-119 35.897650000000006 38.0 37.4 38.0 32.2 38.0 120-124 35.6416 38.0 36.8 38.0 31.0 38.0 125-129 35.37205 38.0 36.4 38.0 30.4 38.0 130-134 34.94115 38.0 35.8 38.0 28.0 38.0 135-139 34.63745 38.0 35.0 38.0 27.4 38.0 140-144 34.35085 38.0 34.4 38.0 27.0 38.0 145-149 33.186099999999996 38.0 33.0 38.0 18.2 38.0 150-151 28.921375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 4.0 6 4.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 5.0 14 0.0 15 0.0 16 2.0 17 4.0 18 6.0 19 6.0 20 4.0 21 6.0 22 7.0 23 7.0 24 7.0 25 8.0 26 15.0 27 23.0 28 36.0 29 29.0 30 45.0 31 51.0 32 76.0 33 105.0 34 182.0 35 277.0 36 569.0 37 2508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.6 14.924999999999999 18.0 31.474999999999998 2 24.15 24.0 36.225 15.625 3 20.724999999999998 27.275 30.9 21.099999999999998 4 24.8 34.125 22.075 19.0 5 25.5 36.199999999999996 21.825 16.475 6 18.2 40.025 23.075000000000003 18.7 7 18.25 16.650000000000002 42.975 22.125 8 20.674999999999997 22.55 28.549999999999997 28.225 9 22.725 23.9 29.7 23.674999999999997 10-14 23.25 29.310000000000002 25.814999999999998 21.625 15-19 22.93 28.525 27.76 20.785 20-24 23.785 28.525 27.185 20.505000000000003 25-29 23.21276275523002 27.84829177745447 27.55731701199017 21.38162845532534 30-34 23.36815286624204 28.071337579617833 27.67388535031847 20.886624203821654 35-39 23.388925278379606 28.004232377689327 27.883307300851513 20.723535043079558 40-44 23.585 28.325 27.515 20.575 45-49 22.884999999999998 28.285 27.145000000000003 21.685 50-54 23.315 28.199999999999996 27.474999999999998 21.01 55-59 23.61 28.050000000000004 27.744999999999997 20.595 60-64 23.44 28.34 27.639999999999997 20.580000000000002 65-69 24.18 27.665 27.21 20.945 70-74 23.555 28.03 27.345000000000002 21.07 75-79 24.095 28.03 27.965 19.91 80-84 23.200000000000003 28.560000000000002 27.650000000000002 20.59 85-89 23.669999999999998 27.88 27.705000000000002 20.745 90-94 23.555 28.49 27.495000000000005 20.46 95-99 23.845 28.13 27.584999999999997 20.44 100-104 24.07 28.155 27.389999999999997 20.385 105-109 24.060000000000002 27.725 27.63 20.585 110-114 24.215 28.18 27.525 20.080000000000002 115-119 24.205 28.044999999999998 27.79 19.96 120-124 24.255 28.18 27.37 20.195 125-129 24.09 28.235 27.615000000000002 20.06 130-134 24.605 28.03 26.99 20.375 135-139 24.925 28.065 27.205000000000002 19.805 140-144 24.97 28.610000000000003 26.724999999999998 19.695 145-149 25.590000000000003 27.87 27.0 19.54 150-151 24.8625 27.762500000000003 27.400000000000002 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 5.0 28 7.0 29 7.5 30 7.5 31 14.0 32 19.5 33 23.5 34 38.0 35 61.5 36 80.0 37 93.0 38 123.0 39 156.5 40 197.0 41 256.0 42 269.5 43 282.0 44 309.0 45 313.5 46 295.0 47 274.5 48 241.5 49 199.5 50 160.0 51 110.5 52 93.0 53 78.0 54 64.0 55 51.5 56 40.5 57 32.0 58 23.0 59 16.0 60 12.0 61 10.0 62 7.0 63 4.0 64 3.5 65 4.0 66 2.5 67 4.0 68 4.5 69 2.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.335 30-34 1.875 35-39 0.765 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.8875 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.8625 0.0 0.0 0.0 0.0 132-133 3.2 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.075 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891326 spots for SRR7172678.sra Written 891326 spots for SRR7172678.sra Read 891336 spots for SRR7172678.sra Written 891336 spots for SRR7172678.sra SRR ids: ['SRR7172678.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pmh47t_r SRR7172678.sra spots: 17826530 blocks: [[1, 891326], [891327, 1782652], [1782653, 2673978], [2673979, 3565304], [3565305, 4456630], [4456631, 5347956], [5347957, 6239282], [6239283, 7130608], [7130609, 8021934], [8021935, 8913260], [8913261, 9804586], [9804587, 10695912], [10695913, 11587238], [11587239, 12478564], [12478565, 13369890], [13369891, 14261216], [14261217, 15152542], [15152543, 16043868], [16043869, 16935194], [16935195, 17826530]] SRR7172678 file size 6019125 SRR7172678 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172678 SRR7172678_1.fastq SRR7172678_2.fastq Input file: SRR7172678_1.fastq Paired file: SRR7172678_2.fastq trimmed: SRR7172678-trimmed-pair1.fastq, SRR7172678-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:09:14 2025 >> started Mon Feb 10 14:09:32 2025 >> done (18.267s) 17826530 read pairs processed; of these: 18753 ( 0.11%) short read pairs filtered out after trimming by size control 15176 ( 0.09%) empty read pairs filtered out after trimming by size control 17792601 (99.81%) read pairs available; of these: 7257021 (40.79%) trimmed read pairs available after processing 10535580 (59.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 3 0.00% 32 0 0.00% 33 1 0.00% 34 2 0.00% 35 2 0.00% 36 1 0.00% 37 1 0.00% 38 3 0.00% 39 3 0.00% 40 1 0.00% 41 2 0.00% 42 3 0.00% 43 7 0.00% 44 7 0.00% 45 5 0.00% 46 3 0.00% 47 10 0.00% 48 3 0.00% 49 11 0.00% 50 18 0.00% 51 12 0.00% 52 15 0.00% 53 24 0.00% 54 19 0.00% 55 21 0.00% 56 34 0.00% 57 36 0.00% 58 51 0.00% 59 48 0.00% 60 39 0.00% 61 75 0.00% 62 68 0.00% 63 81 0.00% 64 94 0.00% 65 100 0.00% 66 132 0.00% 67 133 0.00% 68 125 0.00% 69 179 0.00% 70 182 0.00% 71 223 0.00% 72 252 0.00% 73 294 0.00% 74 330 0.00% 75 421 0.00% 76 443 0.00% 77 533 0.00% 78 608 0.00% 79 707 0.00% 80 857 0.00% 81 899 0.01% 82 1069 0.01% 83 1272 0.01% 84 2292 0.01% 85 2910 0.02% 86 3124 0.02% 87 3342 0.02% 88 3545 0.02% 89 3623 0.02% 90 3830 0.02% 91 4136 0.02% 92 4496 0.03% 93 4790 0.03% 94 5195 0.03% 95 5436 0.03% 96 6094 0.03% 97 6394 0.04% 98 6990 0.04% 99 7512 0.04% 100 8203 0.05% 101 8775 0.05% 102 9263 0.05% 103 10205 0.06% 104 10941 0.06% 105 11783 0.07% 106 12480 0.07% 107 13312 0.07% 108 14254 0.08% 109 15190 0.09% 110 16197 0.09% 111 17099 0.10% 112 18332 0.10% 113 19438 0.11% 114 20716 0.12% 115 21993 0.12% 116 23055 0.13% 117 24240 0.14% 118 25623 0.14% 119 26827 0.15% 120 27660 0.16% 121 29582 0.17% 122 30587 0.17% 123 32086 0.18% 124 33755 0.19% 125 35767 0.20% 126 37563 0.21% 127 39000 0.22% 128 40742 0.23% 129 42762 0.24% 130 44317 0.25% 131 46955 0.26% 132 49609 0.28% 133 52266 0.29% 134 54925 0.31% 135 57740 0.32% 136 61325 0.34% 137 65265 0.37% 138 69024 0.39% 139 74488 0.42% 140 79692 0.45% 141 87001 0.49% 142 95200 0.54% 143 104954 0.59% 144 119261 0.67% 145 140866 0.79% 146 173543 0.98% 147 232277 1.31% 148 364641 2.05% 149 680050 3.82% 150 3842995 21.60% 151 10535580 59.21% 17792601 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.80 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=54.49 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.3 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=33 prefix-density=0.39 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=126.31 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=14.8 sequence=AGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGT SRR7172678 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:10:27 Started mapping on | Feb 10 14:10:27 Finished on | Feb 10 14:13:35 Mapping speed, Million of reads per hour | 340.71 Number of input reads | 17792601 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16144138 Uniquely mapped reads % | 90.74% Average mapped length | 296.00 Number of splices: Total | 15460359 Number of splices: Annotated (sjdb) | 15155834 Number of splices: GT/AG | 15208184 Number of splices: GC/AG | 199725 Number of splices: AT/AC | 11780 Number of splices: Non-canonical | 40670 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430355 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 76626 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.28% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1233872 1233872 1233872 N_multimapping 430355 430355 430355 N_noFeature 395319 16007731 450735 N_ambiguous 168187 1272 86252 UnstrandedReadsAssigned:15580632 PositiveStrandReadsAssigned:135135 NegativeStrandReadsAssigned:15607151 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172678 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172678-trimmed-pair1.fastq SRR7172678-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,792,601 reads, 15,589,385 reads pseudoaligned [quant] estimated average fragment length: 236.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7172678.ke.tsv 34699 SRR7172678.se.tsv 87100 total ==> SRR7172678.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.29 1933 72.5516 Potri.005G024800.1.v4.1 1035 799.288 240 20.0863 Potri.004G059700.1.v4.1 961 725.294 22 2.02909 Potri.007G009000.2.v4.1 1416 1180.29 0 0 Potri.003G141000.2.v4.1 2943 2707.29 546 13.4912 Potri.016G087400.1.v4.1 270 76.7677 885 771.184 Potri.015G069301.1.v4.1 564 330.76 0 0 Potri.010G195200.1.v4.1 1773 1537.29 368 16.0135 Potri.012G127500.1.v4.1 977 741.294 7639 689.349 ==> SRR7172678.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 468 SRR7172678 completed mapping pipeline successfully