Starting /dee2/code/volunteer_pipeline.sh SRR7172679 current disk space = 3058892492800 free memory = 1577132908 SRR7172679 SRAfilesize a488a93596b357a999bcc6c168d8d343 SRR7172679.sra SRR7172679.sra file validated SRR7172679 is paired end SRR7172679 is conventional basespace SRR7172679 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172679_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86975 33.0 33.0 34.0 31.0 34.0 2 32.5495 33.0 33.0 34.0 32.0 34.0 3 32.5385 33.0 33.0 34.0 31.0 34.0 4 32.8275 33.0 33.0 34.0 32.0 34.0 5 32.68125 33.0 33.0 34.0 32.0 34.0 6 36.95525 38.0 37.0 38.0 36.0 38.0 7 37.5335 38.0 38.0 38.0 37.0 38.0 8 37.5 38.0 38.0 38.0 37.0 38.0 9 37.6175 38.0 38.0 38.0 38.0 38.0 10-14 37.62245 38.0 38.0 38.0 38.0 38.0 15-19 37.5714 38.0 38.0 38.0 38.0 38.0 20-24 37.54105 38.0 38.0 38.0 38.0 38.0 25-29 37.4933 38.0 38.0 38.0 37.8 38.0 30-34 37.507799999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.47645 38.0 38.0 38.0 38.0 38.0 40-44 37.423649999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.3229 38.0 38.0 38.0 37.0 38.0 50-54 37.35055 38.0 38.0 38.0 37.0 38.0 55-59 37.299600000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.18265 38.0 38.0 38.0 36.6 38.0 65-69 37.208349999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.129200000000004 38.0 38.0 38.0 36.2 38.0 75-79 37.023849999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.92205 38.0 38.0 38.0 36.0 38.0 85-89 36.7747 38.0 38.0 38.0 35.2 38.0 90-94 36.7475 38.0 38.0 38.0 35.0 38.0 95-99 36.75525 38.0 38.0 38.0 35.0 38.0 100-104 36.7221 38.0 38.0 38.0 35.0 38.0 105-109 36.5427 38.0 38.0 38.0 34.2 38.0 110-114 36.29815 38.0 38.0 38.0 33.8 38.0 115-119 36.237199999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.0327 38.0 37.4 38.0 33.0 38.0 125-129 35.891999999999996 38.0 37.0 38.0 32.4 38.0 130-134 35.411649999999995 38.0 36.2 38.0 29.6 38.0 135-139 35.15975 38.0 36.0 38.0 28.0 38.0 140-144 35.008950000000006 38.0 35.8 38.0 28.2 38.0 145-149 34.729150000000004 38.0 35.4 38.0 28.2 38.0 150-151 30.77725 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 2.0 19 4.0 20 2.0 21 2.0 22 6.0 23 6.0 24 8.0 25 7.0 26 12.0 27 22.0 28 21.0 29 22.0 30 39.0 31 41.0 32 67.0 33 84.0 34 163.0 35 240.0 36 603.0 37 2644.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.615033011681053 13.153885220924327 14.118842051802947 41.11223971559167 2 20.23659702995218 20.66448527561037 37.553486030707276 21.545431663730177 3 20.225 25.4 23.95 30.425 4 22.0 32.1 21.725 24.175 5 20.599999999999998 34.825 25.3 19.275000000000002 6 17.4 35.4 25.724999999999998 21.475 7 13.425 22.025 44.925 19.625 8 18.099999999999998 23.400000000000002 30.7 27.800000000000004 9 18.55 22.05 33.324999999999996 26.075 10-14 19.085 29.770000000000003 26.900000000000002 24.245 15-19 19.84 28.155 27.884999999999998 24.12 20-24 19.48 29.01 27.815 23.695 25-29 19.545 29.285 27.744999999999997 23.425 30-34 19.35 28.83 27.560000000000002 24.26 35-39 19.185 28.585 28.444999999999997 23.785 40-44 19.875 28.46 27.485 24.18 45-49 19.43 28.349999999999998 27.779999999999998 24.44 50-54 19.54 28.610000000000003 27.485 24.365000000000002 55-59 19.535 28.68 27.605 24.18 60-64 19.564999999999998 28.71 27.35 24.375 65-69 19.825 28.060000000000002 27.77 24.345 70-74 19.955000000000002 28.38 27.47 24.195 75-79 19.985 28.26 27.255000000000003 24.5 80-84 20.044999999999998 28.244999999999997 27.639999999999997 24.07 85-89 20.474999999999998 28.405 27.639999999999997 23.48 90-94 20.015 28.13 27.925 23.93 95-99 20.61 28.444999999999997 27.089999999999996 23.855 100-104 20.52 28.035 27.400000000000002 24.044999999999998 105-109 20.32 28.305000000000003 27.689999999999998 23.685000000000002 110-114 20.385 28.035 27.22 24.36 115-119 20.325 28.49 27.205000000000002 23.98 120-124 20.005 28.515 26.955000000000002 24.525 125-129 20.66 28.54 26.729999999999997 24.07 130-134 19.965 28.310000000000002 27.644999999999996 24.08 135-139 20.44 28.299999999999997 27.310000000000002 23.95 140-144 21.099999999999998 28.78 26.479999999999997 23.64 145-149 21.13 28.415000000000003 26.25 24.205 150-151 21.1125 28.9125 25.85 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 3.0 26 6.0 27 9.0 28 13.5 29 18.0 30 20.0 31 26.0 32 29.0 33 42.5 34 54.0 35 54.5 36 79.0 37 108.5 38 137.5 39 170.5 40 195.0 41 216.0 42 231.0 43 258.5 44 273.0 45 281.0 46 285.5 47 258.5 48 233.0 49 203.5 50 168.0 51 139.5 52 121.5 53 97.0 54 76.5 55 54.5 56 36.0 57 28.5 58 17.0 59 12.5 60 12.0 61 7.5 62 3.5 63 2.5 64 0.5 65 2.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.0125 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.987500000000001 0.0 0.0 0.0 0.0 130-131 5.4875 0.0 0.0 0.0 0.0 132-133 6.1375 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAA 10 0.0058553475 152.56578 1 TTTGCTC 10 0.0068396386 144.9375 6 >>END_MODULE SRR7172679 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172679_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08425 34.0 33.0 34.0 32.0 34.0 2 33.11925 34.0 33.0 34.0 33.0 34.0 3 33.13075 34.0 33.0 34.0 33.0 34.0 4 33.07325 34.0 33.0 34.0 33.0 34.0 5 33.12125 34.0 33.0 34.0 33.0 34.0 6 37.193 38.0 38.0 38.0 37.0 38.0 7 37.21525 38.0 38.0 38.0 37.0 38.0 8 37.122 38.0 38.0 38.0 37.0 38.0 9 37.166 38.0 38.0 38.0 37.0 38.0 10-14 37.09505 38.0 38.0 38.0 37.0 38.0 15-19 37.1147 38.0 38.0 38.0 37.0 38.0 20-24 37.13605 38.0 38.0 38.0 37.0 38.0 25-29 36.827600000000004 38.0 38.0 38.0 36.8 38.0 30-34 36.1796 38.0 38.0 38.0 36.0 38.0 35-39 36.4362 38.0 38.0 38.0 35.6 38.0 40-44 36.92805 38.0 38.0 38.0 36.8 38.0 45-49 36.91815 38.0 38.0 38.0 37.0 38.0 50-54 36.953700000000005 38.0 38.0 38.0 37.0 38.0 55-59 36.782650000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.63125 38.0 38.0 38.0 35.4 38.0 65-69 36.557300000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.588049999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.571 38.0 38.0 38.0 35.4 38.0 80-84 36.474900000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.382600000000004 38.0 38.0 38.0 34.4 38.0 90-94 36.373000000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.186099999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.02655 38.0 38.0 38.0 33.8 38.0 105-109 35.924749999999996 38.0 38.0 38.0 33.2 38.0 110-114 35.809450000000005 38.0 37.6 38.0 33.2 38.0 115-119 35.5698 38.0 37.0 38.0 31.2 38.0 120-124 35.13605 38.0 36.2 38.0 28.4 38.0 125-129 35.12525 38.0 36.0 38.0 29.2 38.0 130-134 34.87734999999999 38.0 35.8 38.0 28.2 38.0 135-139 34.2527 38.0 34.8 38.0 24.8 38.0 140-144 33.8296 38.0 33.0 38.0 23.2 38.0 145-149 32.7247 38.0 33.0 38.0 13.2 38.0 150-151 27.628625 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 11.0 4 2.0 5 2.0 6 4.0 7 0.0 8 0.0 9 4.0 10 3.0 11 1.0 12 1.0 13 3.0 14 4.0 15 5.0 16 4.0 17 6.0 18 5.0 19 4.0 20 3.0 21 3.0 22 12.0 23 9.0 24 14.0 25 8.0 26 22.0 27 11.0 28 26.0 29 35.0 30 42.0 31 56.0 32 91.0 33 112.0 34 166.0 35 307.0 36 549.0 37 2462.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 14.625 19.675 30.4 2 22.95 22.75 35.975 18.325 3 20.875 27.55 30.55 21.025 4 24.9 34.375 22.075 18.65 5 25.424999999999997 36.9 21.2 16.475 6 19.525000000000002 37.475 24.325 18.675 7 18.65 18.05 42.875 20.424999999999997 8 20.95 22.425 28.925 27.700000000000003 9 22.85 24.8 27.85 24.5 10-14 23.665 29.049999999999997 26.38 20.905 15-19 23.29 28.01 27.815 20.885 20-24 23.685000000000002 28.54 27.310000000000002 20.465 25-29 23.88810625880459 28.053934393238077 27.842624270476957 20.21533507748038 30-34 23.264031134780826 28.369520688242524 27.565546907005327 20.800901269971323 35-39 22.711641549509455 27.97613027207444 28.239101850915343 21.07312632750076 40-44 23.395 28.095 27.595 20.915 45-49 23.635 28.15 27.265 20.95 50-54 23.200000000000003 28.185 27.615000000000002 21.0 55-59 23.5 28.050000000000004 27.615000000000002 20.835 60-64 24.09 28.155 27.015 20.74 65-69 24.075 27.589999999999996 28.349999999999998 19.985 70-74 24.625 27.235 28.18 19.96 75-79 23.985 27.97 28.075 19.97 80-84 24.775 28.060000000000002 27.034999999999997 20.13 85-89 24.09 27.834999999999997 27.825 20.25 90-94 23.895 27.644999999999996 28.02 20.44 95-99 24.0 27.944999999999997 28.095 19.96 100-104 24.165 27.785 27.785 20.265 105-109 24.035 27.755000000000003 28.26 19.950000000000003 110-114 24.065 28.075 27.750000000000004 20.11 115-119 24.615000000000002 27.455000000000002 28.07 19.86 120-124 24.805 27.474999999999998 27.92 19.8 125-129 25.380000000000003 28.205000000000002 26.91 19.505 130-134 25.405 27.575 27.54 19.48 135-139 25.695 28.12 26.985 19.2 140-144 25.314999999999998 27.99 26.955000000000002 19.74 145-149 26.75 28.26 25.985000000000003 19.005 150-151 26.9625 27.462500000000002 26.437500000000004 19.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 3.0 26 3.0 27 4.5 28 4.5 29 7.5 30 13.5 31 18.0 32 22.0 33 26.5 34 38.5 35 53.0 36 68.5 37 101.0 38 134.0 39 160.5 40 188.0 41 220.0 42 257.5 43 291.5 44 303.5 45 287.5 46 269.5 47 274.5 48 267.0 49 228.5 50 168.5 51 127.0 52 107.0 53 81.5 54 63.0 55 49.0 56 39.5 57 29.0 58 23.5 59 18.0 60 14.5 61 10.0 62 5.0 63 2.5 64 2.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.62 30-34 2.36 35-39 1.13 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.9875000000000003 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.949999999999999 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 6.125 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTTG 10 0.0069178343 144.3875 2 TTAGCTT 10 0.0069178343 144.3875 8 >>END_MODULE Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704059 spots for SRR7172679.sra Written 704059 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra Read 704058 spots for SRR7172679.sra Written 704058 spots for SRR7172679.sra SRR ids: ['SRR7172679.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8hq16hed SRR7172679.sra spots: 14081161 blocks: [[1, 704058], [704059, 1408116], [1408117, 2112174], [2112175, 2816232], [2816233, 3520290], [3520291, 4224348], [4224349, 4928406], [4928407, 5632464], [5632465, 6336522], [6336523, 7040580], [7040581, 7744638], [7744639, 8448696], [8448697, 9152754], [9152755, 9856812], [9856813, 10560870], [10560871, 11264928], [11264929, 11968986], [11968987, 12673044], [12673045, 13377102], [13377103, 14081161]] SRR7172679 file size 4749943 SRR7172679 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172679 SRR7172679_1.fastq SRR7172679_2.fastq Input file: SRR7172679_1.fastq Paired file: SRR7172679_2.fastq trimmed: SRR7172679-trimmed-pair1.fastq, SRR7172679-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:25:13 2025 >> started Mon Feb 10 14:25:28 2025 >> done (14.944s) 14081161 read pairs processed; of these: 25688 ( 0.18%) short read pairs filtered out after trimming by size control 23289 ( 0.17%) empty read pairs filtered out after trimming by size control 14032184 (99.65%) read pairs available; of these: 7556563 (53.85%) trimmed read pairs available after processing 6475621 (46.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 4 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 0 0.00% 34 1 0.00% 35 4 0.00% 36 6 0.00% 37 4 0.00% 38 5 0.00% 39 4 0.00% 40 3 0.00% 41 7 0.00% 42 5 0.00% 43 6 0.00% 44 10 0.00% 45 7 0.00% 46 12 0.00% 47 11 0.00% 48 10 0.00% 49 16 0.00% 50 17 0.00% 51 20 0.00% 52 34 0.00% 53 27 0.00% 54 36 0.00% 55 45 0.00% 56 40 0.00% 57 50 0.00% 58 71 0.00% 59 68 0.00% 60 83 0.00% 61 84 0.00% 62 115 0.00% 63 116 0.00% 64 147 0.00% 65 159 0.00% 66 211 0.00% 67 246 0.00% 68 272 0.00% 69 299 0.00% 70 366 0.00% 71 428 0.00% 72 472 0.00% 73 570 0.00% 74 631 0.00% 75 755 0.01% 76 980 0.01% 77 1017 0.01% 78 1097 0.01% 79 1289 0.01% 80 1476 0.01% 81 1564 0.01% 82 1787 0.01% 83 2361 0.02% 84 3715 0.03% 85 4436 0.03% 86 4641 0.03% 87 4979 0.04% 88 5313 0.04% 89 5430 0.04% 90 6051 0.04% 91 6306 0.04% 92 6906 0.05% 93 7531 0.05% 94 8339 0.06% 95 8856 0.06% 96 9310 0.07% 97 10329 0.07% 98 10849 0.08% 99 11581 0.08% 100 12789 0.09% 101 13546 0.10% 102 14248 0.10% 103 15318 0.11% 104 16424 0.12% 105 17332 0.12% 106 18307 0.13% 107 19540 0.14% 108 20461 0.15% 109 21604 0.15% 110 23094 0.16% 111 23674 0.17% 112 25360 0.18% 113 26597 0.19% 114 27956 0.20% 115 29350 0.21% 116 30565 0.22% 117 31746 0.23% 118 33251 0.24% 119 34558 0.25% 120 35288 0.25% 121 36998 0.26% 122 38376 0.27% 123 40025 0.29% 124 41415 0.30% 125 43193 0.31% 126 44791 0.32% 127 46832 0.33% 128 48221 0.34% 129 49083 0.35% 130 51485 0.37% 131 52994 0.38% 132 55036 0.39% 133 57159 0.41% 134 59755 0.43% 135 61812 0.44% 136 64786 0.46% 137 67085 0.48% 138 70373 0.50% 139 74155 0.53% 140 78155 0.56% 141 84107 0.60% 142 90051 0.64% 143 97821 0.70% 144 109663 0.78% 145 125722 0.90% 146 151008 1.08% 147 197407 1.41% 148 296098 2.11% 149 713585 5.09% 150 3986716 28.41% 151 6475621 46.15% 14032184 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.32 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=156.07 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.9 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=27 prefix-density=0.32 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=40.46 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=AGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTG SRR7172679 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:26:11 Started mapping on | Feb 10 14:26:11 Finished on | Feb 10 14:27:44 Mapping speed, Million of reads per hour | 543.18 Number of input reads | 14032184 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13375057 Uniquely mapped reads % | 95.32% Average mapped length | 292.91 Number of splices: Total | 13545837 Number of splices: Annotated (sjdb) | 13288977 Number of splices: GT/AG | 13344283 Number of splices: GC/AG | 158221 Number of splices: AT/AC | 10348 Number of splices: Non-canonical | 32985 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312101 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 59583 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365348 365348 365348 N_multimapping 312101 312101 312101 N_noFeature 311000 13255098 347869 N_ambiguous 142244 650 58833 UnstrandedReadsAssigned:12921813 PositiveStrandReadsAssigned:119309 NegativeStrandReadsAssigned:12968355 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172679 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172679-trimmed-pair1.fastq SRR7172679-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,032,184 reads, 12,877,515 reads pseudoaligned [quant] estimated average fragment length: 221.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7172679.ke.tsv 34699 SRR7172679.se.tsv 87100 total ==> SRR7172679.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.42 1397 52.9773 Potri.005G024800.1.v4.1 1035 814.422 1214 101.604 Potri.004G059700.1.v4.1 961 740.442 9 0.828504 Potri.007G009000.2.v4.1 1416 1195.42 0 0 Potri.003G141000.2.v4.1 2943 2722.42 802.709 20.0977 Potri.016G087400.1.v4.1 270 86.5108 1015 799.722 Potri.015G069301.1.v4.1 564 345.696 0 0 Potri.010G195200.1.v4.1 1773 1552.42 249 10.9328 Potri.012G127500.1.v4.1 977 756.429 2846 256.454 ==> SRR7172679.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 94 SRR7172679 completed mapping pipeline successfully