Starting /dee2/code/volunteer_pipeline.sh SRR7172680 current disk space = 3058669916160 free memory = 1303165440 SRR7172680 SRAfilesize bef4ac3f6638d1b8b566116328b24ca8 SRR7172680.sra SRR7172680.sra file validated SRR7172680 is paired end SRR7172680 is conventional basespace SRR7172680 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172680_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.565 18.0 18.0 31.0 18.0 33.0 2 30.363 31.0 29.0 33.0 27.0 33.0 3 31.7245 33.0 32.0 33.0 27.0 33.0 4 32.1535 33.0 32.0 33.0 31.0 33.0 5 32.636 33.0 33.0 34.0 32.0 34.0 6 37.1485 38.0 38.0 38.0 36.0 38.0 7 37.3045 38.0 38.0 38.0 37.0 38.0 8 37.40575 38.0 38.0 38.0 37.0 38.0 9 37.4195 38.0 38.0 38.0 37.0 38.0 10-14 37.57835 38.0 38.0 38.0 38.0 38.0 15-19 37.585750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5642 38.0 38.0 38.0 38.0 38.0 25-29 37.60345 38.0 38.0 38.0 38.0 38.0 30-34 37.52810000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.50335 38.0 38.0 38.0 38.0 38.0 40-44 37.470549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.42855 38.0 38.0 38.0 37.2 38.0 50-54 37.3562 38.0 38.0 38.0 37.0 38.0 55-59 37.27140000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.2468 38.0 38.0 38.0 36.8 38.0 65-69 37.20615 38.0 38.0 38.0 36.6 38.0 70-74 37.169 38.0 38.0 38.0 36.4 38.0 75-79 37.01975 38.0 38.0 38.0 35.8 38.0 80-84 36.927800000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.879999999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.94135 38.0 38.0 38.0 35.6 38.0 95-99 36.850550000000005 38.0 38.0 38.0 35.4 38.0 100-104 36.692899999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.36215 38.0 38.0 38.0 33.8 38.0 110-114 36.1908 38.0 37.8 38.0 33.6 38.0 115-119 36.2076 38.0 37.8 38.0 33.6 38.0 120-124 36.053700000000006 38.0 37.2 38.0 33.2 38.0 125-129 35.69435 38.0 36.6 38.0 31.4 38.0 130-134 35.0883 38.0 35.6 38.0 28.0 38.0 135-139 34.9762 38.0 35.2 38.0 27.8 38.0 140-144 34.7787 38.0 35.0 38.0 27.6 38.0 145-149 34.39255 38.0 35.0 38.0 27.0 38.0 150-151 30.515124999999998 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 0.0 17 2.0 18 1.0 19 1.0 20 3.0 21 1.0 22 6.0 23 2.0 24 9.0 25 13.0 26 15.0 27 17.0 28 22.0 29 27.0 30 38.0 31 52.0 32 63.0 33 103.0 34 153.0 35 262.0 36 699.0 37 2505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.726944873776407 14.992272024729521 13.575476558475014 41.70530654301906 2 18.715504264927247 19.543401906673356 37.48118414450577 24.25990968389363 3 21.4 24.5 25.5 28.599999999999998 4 21.875 32.625 21.8 23.7 5 22.125 35.449999999999996 23.7 18.725 6 17.25 37.15 26.125 19.475 7 12.55 21.325 46.85 19.275000000000002 8 19.175 23.05 29.025000000000002 28.749999999999996 9 18.85 23.9 31.6 25.650000000000002 10-14 19.505 29.635 26.955000000000002 23.905 15-19 19.865 28.050000000000004 28.065 24.02 20-24 20.28 28.415000000000003 27.889999999999997 23.415 25-29 19.175 28.605000000000004 27.905 24.315 30-34 19.580000000000002 28.444999999999997 28.225 23.75 35-39 19.735 27.96 28.360000000000003 23.945 40-44 19.84 28.16 27.944999999999997 24.055 45-49 19.89 28.535 27.565 24.01 50-54 20.135 28.73 27.54 23.595 55-59 20.119999999999997 28.139999999999997 27.785 23.955000000000002 60-64 20.215 28.4 27.589999999999996 23.794999999999998 65-69 20.445 28.275 27.445000000000004 23.835 70-74 20.52 27.894999999999996 27.87 23.715 75-79 20.685000000000002 27.950000000000003 27.33 24.035 80-84 20.385 27.74 28.305000000000003 23.57 85-89 20.575 28.235 27.705000000000002 23.485 90-94 21.175 28.235 26.945000000000004 23.645 95-99 20.405 27.42 28.185 23.990000000000002 100-104 20.330000000000002 27.73 28.335 23.605 105-109 20.24 28.025 28.015 23.72 110-114 20.880000000000003 27.994999999999997 27.825 23.3 115-119 20.405 28.24 27.310000000000002 24.044999999999998 120-124 20.46 28.249999999999996 27.560000000000002 23.73 125-129 20.31 28.410000000000004 27.455000000000002 23.825 130-134 20.294999999999998 27.99 27.655 24.060000000000002 135-139 20.74 27.815 27.589999999999996 23.855 140-144 21.16 27.939999999999998 27.375 23.525 145-149 21.07 28.310000000000002 26.669999999999998 23.95 150-151 21.1375 28.95 26.55 23.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 2.5 24 3.0 25 3.5 26 4.0 27 7.0 28 12.0 29 14.5 30 16.5 31 23.5 32 30.0 33 34.5 34 47.5 35 72.0 36 91.5 37 109.0 38 131.5 39 155.5 40 187.0 41 221.0 42 259.0 43 275.0 44 272.0 45 292.0 46 276.5 47 234.0 48 215.0 49 189.5 50 168.0 51 146.5 52 107.5 53 79.5 54 68.5 55 61.5 56 45.0 57 30.0 58 24.5 59 16.0 60 17.5 61 18.5 62 11.0 63 6.0 64 5.5 65 4.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.825 0.0 0.0 0.0 0.0 120-121 1.9500000000000002 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.55 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGGC 10 0.0068343505 144.975 9 >>END_MODULE SRR7172680 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172680_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0465 34.0 33.0 34.0 32.0 34.0 2 33.145 34.0 33.0 34.0 33.0 34.0 3 33.1155 34.0 33.0 34.0 33.0 34.0 4 33.09425 34.0 33.0 34.0 33.0 34.0 5 33.024 34.0 33.0 34.0 33.0 34.0 6 37.1285 38.0 38.0 38.0 37.0 38.0 7 37.18325 38.0 38.0 38.0 37.0 38.0 8 37.254 38.0 38.0 38.0 38.0 38.0 9 37.18725 38.0 38.0 38.0 38.0 38.0 10-14 37.16375 38.0 38.0 38.0 37.4 38.0 15-19 37.1652 38.0 38.0 38.0 37.2 38.0 20-24 37.09015 38.0 38.0 38.0 37.2 38.0 25-29 36.9693 38.0 38.0 38.0 37.0 38.0 30-34 36.25745 38.0 38.0 38.0 36.2 38.0 35-39 36.59225 38.0 38.0 38.0 36.0 38.0 40-44 36.968 38.0 38.0 38.0 36.8 38.0 45-49 36.9567 38.0 38.0 38.0 37.0 38.0 50-54 36.942449999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.84595 38.0 38.0 38.0 36.2 38.0 60-64 36.6665 38.0 38.0 38.0 35.6 38.0 65-69 36.487 38.0 38.0 38.0 35.0 38.0 70-74 36.542899999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.562599999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.55555 38.0 38.0 38.0 35.2 38.0 85-89 36.4645 38.0 38.0 38.0 34.8 38.0 90-94 36.40485 38.0 38.0 38.0 34.4 38.0 95-99 36.34165 38.0 38.0 38.0 34.2 38.0 100-104 36.1973 38.0 38.0 38.0 33.8 38.0 105-109 36.06165 38.0 38.0 38.0 33.8 38.0 110-114 35.859049999999996 38.0 38.0 38.0 32.6 38.0 115-119 35.63265 38.0 37.4 38.0 31.8 38.0 120-124 35.4021 38.0 36.8 38.0 30.4 38.0 125-129 35.13695 38.0 36.2 38.0 29.2 38.0 130-134 34.70445 38.0 35.6 38.0 27.6 38.0 135-139 34.3431 38.0 34.6 38.0 24.8 38.0 140-144 33.9837 38.0 33.8 38.0 23.6 38.0 145-149 33.085300000000004 38.0 33.0 38.0 17.8 38.0 150-151 28.511000000000003 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 7.0 5 0.0 6 0.0 7 1.0 8 3.0 9 2.0 10 2.0 11 2.0 12 2.0 13 1.0 14 3.0 15 0.0 16 1.0 17 8.0 18 3.0 19 8.0 20 5.0 21 9.0 22 7.0 23 7.0 24 13.0 25 18.0 26 21.0 27 20.0 28 38.0 29 29.0 30 43.0 31 38.0 32 75.0 33 89.0 34 170.0 35 264.0 36 591.0 37 2500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.625 15.725 18.375 31.275 2 24.025 24.15 35.775 16.05 3 21.75 26.400000000000002 30.425 21.425 4 25.074999999999996 33.275 21.625 20.025000000000002 5 24.125 36.025 22.2 17.65 6 18.7 38.5 24.3 18.5 7 18.75 17.5 42.575 21.175 8 20.424999999999997 22.6 28.999999999999996 27.975 9 24.05 23.474999999999998 28.925 23.549999999999997 10-14 23.465 29.044999999999998 25.929999999999996 21.560000000000002 15-19 23.080000000000002 28.83 26.875 21.215 20-24 23.330000000000002 27.99 27.935 20.745 25-29 22.954933253036234 28.75639867509786 27.592090735722174 20.696577336143733 30-34 22.73679905944896 28.380105300822983 27.189081429228644 21.69401421049941 35-39 23.237163320891757 27.953192777161302 27.4134974276203 21.396146474326642 40-44 23.794999999999998 28.645 26.965 20.595 45-49 23.535 28.415000000000003 27.145000000000003 20.905 50-54 23.47 28.22 27.345000000000002 20.965 55-59 23.805 28.835 26.61 20.75 60-64 23.625 28.12 27.639999999999997 20.615 65-69 23.5 27.860000000000003 27.615000000000002 21.025 70-74 24.335 27.55 27.755000000000003 20.36 75-79 23.595 28.405 27.36 20.64 80-84 23.62 27.42 28.12 20.84 85-89 24.04 28.33 27.08 20.549999999999997 90-94 24.005000000000003 27.61 27.91 20.474999999999998 95-99 23.810000000000002 28.22 27.785 20.185 100-104 23.685000000000002 27.485 28.08 20.75 105-109 24.185000000000002 28.07 27.655 20.09 110-114 23.544999999999998 27.51 28.09 20.855 115-119 23.919999999999998 27.834999999999997 27.3 20.945 120-124 24.39 27.860000000000003 27.150000000000002 20.599999999999998 125-129 24.465 27.694999999999997 27.43 20.41 130-134 24.19 27.565 27.705000000000002 20.54 135-139 24.575 28.42 27.365000000000002 19.64 140-144 24.77 27.925 27.185 20.119999999999997 145-149 24.805 28.475 27.175 19.545 150-151 25.7625 27.487499999999997 27.575 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 0.5 23 1.0 24 2.0 25 2.0 26 3.0 27 3.5 28 3.5 29 4.5 30 8.0 31 16.0 32 22.5 33 27.5 34 34.5 35 51.0 36 71.0 37 88.5 38 132.0 39 173.5 40 198.0 41 234.0 42 262.5 43 286.0 44 305.5 45 299.0 46 290.0 47 260.5 48 220.5 49 202.0 50 163.5 51 129.0 52 113.0 53 90.0 54 72.0 55 57.0 56 45.5 57 33.5 58 18.0 59 15.0 60 14.5 61 9.5 62 7.5 63 6.0 64 4.5 65 3.0 66 2.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.37 30-34 2.185 35-39 0.8699999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.075 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.6 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.575 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGAT 10 0.006875036 144.6875 1 TATGGCT 10 0.006875036 144.6875 5 >>END_MODULE Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867291 spots for SRR7172680.sra Written 867291 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra Read 867279 spots for SRR7172680.sra Written 867279 spots for SRR7172680.sra SRR ids: ['SRR7172680.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xzgl5ufu SRR7172680.sra spots: 17345592 blocks: [[1, 867279], [867280, 1734558], [1734559, 2601837], [2601838, 3469116], [3469117, 4336395], [4336396, 5203674], [5203675, 6070953], [6070954, 6938232], [6938233, 7805511], [7805512, 8672790], [8672791, 9540069], [9540070, 10407348], [10407349, 11274627], [11274628, 12141906], [12141907, 13009185], [13009186, 13876464], [13876465, 14743743], [14743744, 15611022], [15611023, 16478301], [16478302, 17345592]] SRR7172680 file size 5856151 SRR7172680 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172680 SRR7172680_1.fastq SRR7172680_2.fastq Input file: SRR7172680_1.fastq Paired file: SRR7172680_2.fastq trimmed: SRR7172680-trimmed-pair1.fastq, SRR7172680-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:47:23 2025 >> started Mon Feb 10 12:47:41 2025 >> done (18.164s) 17345592 read pairs processed; of these: 26339 ( 0.15%) short read pairs filtered out after trimming by size control 20834 ( 0.12%) empty read pairs filtered out after trimming by size control 17298419 (99.73%) read pairs available; of these: 7220342 (41.74%) trimmed read pairs available after processing 10078077 (58.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 4 0.00% 38 2 0.00% 39 5 0.00% 40 3 0.00% 41 4 0.00% 42 3 0.00% 43 7 0.00% 44 5 0.00% 45 8 0.00% 46 7 0.00% 47 12 0.00% 48 15 0.00% 49 18 0.00% 50 10 0.00% 51 19 0.00% 52 19 0.00% 53 19 0.00% 54 20 0.00% 55 32 0.00% 56 46 0.00% 57 35 0.00% 58 49 0.00% 59 49 0.00% 60 58 0.00% 61 54 0.00% 62 68 0.00% 63 90 0.00% 64 108 0.00% 65 126 0.00% 66 137 0.00% 67 142 0.00% 68 159 0.00% 69 225 0.00% 70 234 0.00% 71 237 0.00% 72 302 0.00% 73 387 0.00% 74 398 0.00% 75 514 0.00% 76 559 0.00% 77 658 0.00% 78 690 0.00% 79 832 0.00% 80 979 0.01% 81 1054 0.01% 82 1276 0.01% 83 1564 0.01% 84 2693 0.02% 85 3477 0.02% 86 3608 0.02% 87 3887 0.02% 88 3997 0.02% 89 4274 0.02% 90 4394 0.03% 91 4841 0.03% 92 5148 0.03% 93 5472 0.03% 94 5933 0.03% 95 6454 0.04% 96 6901 0.04% 97 7488 0.04% 98 7825 0.05% 99 8590 0.05% 100 9205 0.05% 101 10081 0.06% 102 10879 0.06% 103 11645 0.07% 104 12210 0.07% 105 13112 0.08% 106 14208 0.08% 107 14989 0.09% 108 15988 0.09% 109 17043 0.10% 110 17972 0.10% 111 18919 0.11% 112 20233 0.12% 113 21422 0.12% 114 23093 0.13% 115 24298 0.14% 116 25190 0.15% 117 26749 0.15% 118 28078 0.16% 119 29141 0.17% 120 30471 0.18% 121 32668 0.19% 122 33625 0.19% 123 35162 0.20% 124 36794 0.21% 125 38807 0.22% 126 40671 0.24% 127 42316 0.24% 128 44593 0.26% 129 46521 0.27% 130 48724 0.28% 131 50170 0.29% 132 52904 0.31% 133 55862 0.32% 134 58329 0.34% 135 61871 0.36% 136 65541 0.38% 137 68669 0.40% 138 73030 0.42% 139 77990 0.45% 140 83437 0.48% 141 89762 0.52% 142 98277 0.57% 143 107819 0.62% 144 122610 0.71% 145 142655 0.82% 146 175428 1.01% 147 232414 1.34% 148 361045 2.09% 149 664368 3.84% 150 3687093 21.31% 151 10078077 58.26% 17298419 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=90.26 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=17.4 sequence=CCATCTTCAAGCTGCTTCCCAGCAAA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=22 prefix-density=0.39 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=34.39 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.9 sequence=GAGAAGGCAATGAGAGATGC SRR7172680 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:48:32 Started mapping on | Feb 10 12:48:32 Finished on | Feb 10 12:51:51 Mapping speed, Million of reads per hour | 312.94 Number of input reads | 17298419 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15651471 Uniquely mapped reads % | 90.48% Average mapped length | 295.38 Number of splices: Total | 15616806 Number of splices: Annotated (sjdb) | 15320943 Number of splices: GT/AG | 15368291 Number of splices: GC/AG | 195746 Number of splices: AT/AC | 13064 Number of splices: Non-canonical | 39705 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395485 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 31871 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.91% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1271572 1271572 1271572 N_multimapping 395485 395485 395485 N_noFeature 369273 15502860 417892 N_ambiguous 174341 893 73930 UnstrandedReadsAssigned:15107857 PositiveStrandReadsAssigned:147718 NegativeStrandReadsAssigned:15159649 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172680 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172680-trimmed-pair1.fastq SRR7172680-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,298,419 reads, 15,089,769 reads pseudoaligned [quant] estimated average fragment length: 232.796 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7172680.ke.tsv 34699 SRR7172680.se.tsv 87100 total ==> SRR7172680.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.2 1407 46.8956 Potri.005G024800.1.v4.1 1035 803.204 431 31.9463 Potri.004G059700.1.v4.1 961 729.214 23 1.87777 Potri.007G009000.2.v4.1 1416 1184.2 0 0 Potri.003G141000.2.v4.1 2943 2711.2 606.481 13.3175 Potri.016G087400.1.v4.1 270 78.8265 1616.48 1220.86 Potri.015G069301.1.v4.1 564 334.555 0 0 Potri.010G195200.1.v4.1 1773 1541.2 1091.95 42.1806 Potri.012G127500.1.v4.1 977 745.209 13539 1081.63 ==> SRR7172680.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 540 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 4 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 159 SRR7172680 completed mapping pipeline successfully