Starting /dee2/code/volunteer_pipeline.sh SRR7172681 current disk space = 3058772647936 free memory = 1176667452 SRR7172681 SRAfilesize cea7d97ccd82b0b4d96189115da7862b SRR7172681.sra SRR7172681.sra file validated SRR7172681 is paired end SRR7172681 is conventional basespace SRR7172681 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172681_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.118 33.0 32.0 33.0 27.0 34.0 2 32.3565 33.0 33.0 34.0 31.0 34.0 3 32.65275 33.0 33.0 34.0 32.0 34.0 4 32.444 33.0 33.0 34.0 31.0 34.0 5 32.75275 33.0 33.0 34.0 32.0 34.0 6 36.58925 38.0 37.0 38.0 34.0 38.0 7 37.3915 38.0 38.0 38.0 37.0 38.0 8 37.535 38.0 38.0 38.0 37.0 38.0 9 37.59725 38.0 38.0 38.0 38.0 38.0 10-14 37.63495 38.0 38.0 38.0 38.0 38.0 15-19 37.5909 38.0 38.0 38.0 38.0 38.0 20-24 37.56325 38.0 38.0 38.0 38.0 38.0 25-29 37.5105 38.0 38.0 38.0 38.0 38.0 30-34 37.527049999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.50855 38.0 38.0 38.0 38.0 38.0 40-44 37.44855 38.0 38.0 38.0 37.8 38.0 45-49 37.3733 38.0 38.0 38.0 37.0 38.0 50-54 37.3747 38.0 38.0 38.0 37.0 38.0 55-59 37.28515 38.0 38.0 38.0 37.0 38.0 60-64 37.23875 38.0 38.0 38.0 37.0 38.0 65-69 37.235549999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.178 38.0 38.0 38.0 37.0 38.0 75-79 37.069649999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.0058 38.0 38.0 38.0 36.0 38.0 85-89 36.8473 38.0 38.0 38.0 35.2 38.0 90-94 36.848600000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.8483 38.0 38.0 38.0 35.2 38.0 100-104 36.76025 38.0 38.0 38.0 35.0 38.0 105-109 36.56505 38.0 38.0 38.0 34.2 38.0 110-114 36.313449999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.33765 38.0 38.0 38.0 34.0 38.0 120-124 36.1034 38.0 37.6 38.0 33.0 38.0 125-129 35.97995 38.0 37.4 38.0 32.8 38.0 130-134 35.34185 38.0 36.2 38.0 29.6 38.0 135-139 35.2606 38.0 36.0 38.0 29.6 38.0 140-144 35.104350000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.78655 38.0 35.6 38.0 29.0 38.0 150-151 30.942500000000003 35.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.0 21 4.0 22 6.0 23 5.0 24 6.0 25 10.0 26 15.0 27 16.0 28 25.0 29 27.0 30 32.0 31 37.0 32 58.0 33 96.0 34 136.0 35 235.0 36 587.0 37 2695.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.82403870639165 12.808759867583397 14.973262032085561 39.39393939393939 2 20.81447963800905 17.998994469582705 37.506284565108096 23.68024132730015 3 20.474999999999998 23.625 25.924999999999997 29.975 4 23.375 30.65 20.375 25.6 5 21.8 34.375 24.325 19.5 6 17.299999999999997 34.300000000000004 26.400000000000002 22.0 7 13.475000000000001 22.7 45.025 18.8 8 18.325 24.05 31.324999999999996 26.3 9 17.65 22.95 33.35 26.05 10-14 19.32 30.095 27.185 23.400000000000002 15-19 19.445 28.994999999999997 27.825 23.735 20-24 19.900000000000002 28.405 28.225 23.47 25-29 19.355 28.9 27.96 23.785 30-34 19.875 29.205 27.500000000000004 23.419999999999998 35-39 19.535 28.599999999999998 28.235 23.630000000000003 40-44 20.25 28.065 28.16 23.525 45-49 20.185 28.335 27.77 23.71 50-54 19.66 28.285 28.025 24.03 55-59 20.215 28.105000000000004 27.915 23.765 60-64 20.085 28.360000000000003 27.584999999999997 23.97 65-69 20.24 28.125 27.735 23.9 70-74 19.955000000000002 28.499999999999996 27.779999999999998 23.765 75-79 20.195 28.71 27.055 24.04 80-84 20.19 27.400000000000002 28.32 24.09 85-89 20.23 27.66 28.000000000000004 24.11 90-94 20.810000000000002 27.54 27.99 23.66 95-99 20.075000000000003 28.015 27.939999999999998 23.97 100-104 20.62 28.044999999999998 27.415 23.919999999999998 105-109 20.715 27.925 27.750000000000004 23.61 110-114 20.580000000000002 28.410000000000004 27.095000000000002 23.915 115-119 20.89 27.29 28.060000000000002 23.76 120-124 20.69 27.57 27.715 24.025 125-129 20.080000000000002 27.675 28.225 24.02 130-134 21.345 27.625 27.065 23.965 135-139 21.08 27.589999999999996 27.650000000000002 23.68 140-144 21.035 27.76 27.169999999999998 24.035 145-149 21.42 28.89 26.650000000000002 23.04 150-151 20.9125 27.3125 27.325 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.5 22 3.5 23 1.5 24 0.0 25 2.0 26 5.5 27 7.0 28 12.0 29 17.0 30 19.0 31 26.0 32 35.5 33 47.5 34 58.0 35 71.0 36 85.0 37 94.5 38 125.5 39 154.5 40 189.5 41 227.0 42 231.0 43 261.5 44 299.0 45 294.0 46 272.5 47 247.5 48 230.5 49 199.0 50 170.0 51 143.5 52 101.5 53 87.5 54 73.0 55 50.0 56 34.5 57 23.0 58 21.5 59 15.5 60 12.5 61 12.5 62 9.0 63 6.5 64 3.0 65 2.5 66 2.5 67 1.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9750000000000001 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.65 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.975 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 6.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAAGT 10 0.0068396386 144.9375 7 CAAGTGA 10 0.0068396386 144.9375 9 CCAAGTG 20 3.5938638E-4 108.703125 8 >>END_MODULE SRR7172681 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172681_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10275 34.0 33.0 34.0 32.0 34.0 2 33.178 34.0 33.0 34.0 33.0 34.0 3 33.2405 34.0 33.0 34.0 33.0 34.0 4 33.14125 34.0 33.0 34.0 33.0 34.0 5 33.12875 34.0 33.0 34.0 33.0 34.0 6 37.31075 38.0 38.0 38.0 37.0 38.0 7 37.351 38.0 38.0 38.0 38.0 38.0 8 37.27525 38.0 38.0 38.0 38.0 38.0 9 37.28675 38.0 38.0 38.0 38.0 38.0 10-14 37.2496 38.0 38.0 38.0 37.6 38.0 15-19 37.2774 38.0 38.0 38.0 37.8 38.0 20-24 37.28685 38.0 38.0 38.0 38.0 38.0 25-29 36.97925 38.0 38.0 38.0 37.0 38.0 30-34 36.22395 38.0 38.0 38.0 36.2 38.0 35-39 36.56205 38.0 38.0 38.0 36.0 38.0 40-44 37.138 38.0 38.0 38.0 37.0 38.0 45-49 37.10665 38.0 38.0 38.0 37.0 38.0 50-54 37.1598 38.0 38.0 38.0 37.0 38.0 55-59 37.005849999999995 38.0 38.0 38.0 36.4 38.0 60-64 36.80805 38.0 38.0 38.0 36.0 38.0 65-69 36.737550000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.830149999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.787150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.6904 38.0 38.0 38.0 35.4 38.0 85-89 36.6387 38.0 38.0 38.0 35.0 38.0 90-94 36.55845000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.48175 38.0 38.0 38.0 34.4 38.0 100-104 36.33669999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.1301 38.0 38.0 38.0 33.6 38.0 110-114 36.092850000000006 38.0 38.0 38.0 33.8 38.0 115-119 35.965700000000005 38.0 37.6 38.0 33.0 38.0 120-124 35.46625 38.0 36.4 38.0 31.0 38.0 125-129 35.4392 38.0 36.4 38.0 31.0 38.0 130-134 35.1527 38.0 36.0 38.0 30.0 38.0 135-139 34.5529 38.0 35.4 38.0 26.2 38.0 140-144 34.16635 38.0 33.6 38.0 25.0 38.0 145-149 33.20465 38.0 33.0 38.0 18.2 38.0 150-151 27.926875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 0.0 14 1.0 15 3.0 16 2.0 17 1.0 18 5.0 19 5.0 20 7.0 21 5.0 22 8.0 23 5.0 24 10.0 25 10.0 26 12.0 27 24.0 28 27.0 29 39.0 30 56.0 31 56.0 32 71.0 33 94.0 34 169.0 35 282.0 36 581.0 37 2502.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.575 13.900000000000002 18.0 33.525 2 23.75 23.799999999999997 36.199999999999996 16.25 3 21.025 27.375 29.725 21.875 4 25.124999999999996 34.225 20.775 19.875 5 25.2 36.525 21.85 16.425 6 18.9 36.1 25.75 19.25 7 19.325 17.5 42.325 20.849999999999998 8 22.525000000000002 22.275 28.525 26.674999999999997 9 23.799999999999997 23.05 28.475 24.675 10-14 23.05 28.71 26.0 22.24 15-19 23.895 27.275 27.689999999999998 21.14 20-24 22.875 28.255000000000003 27.42 21.45 25-29 23.416893184335045 29.170441961139637 26.502567200241618 20.910097654283703 30-34 23.063877897117017 28.058995837401717 27.57078986587183 21.306336399609435 35-39 23.31729551785262 27.242339832869078 28.027348695872373 21.413015953405925 40-44 23.21 27.825 27.82 21.145 45-49 24.09 27.52 27.42 20.97 50-54 23.215 28.28 27.35 21.154999999999998 55-59 23.365 28.065 27.455000000000002 21.115000000000002 60-64 24.044999999999998 27.575 27.534999999999997 20.845 65-69 23.95 27.985 27.175 20.89 70-74 23.695 28.77 27.13 20.405 75-79 24.08 27.32 28.15 20.45 80-84 24.165 27.82 27.395000000000003 20.62 85-89 24.315 28.199999999999996 27.250000000000004 20.235 90-94 24.585 28.000000000000004 27.229999999999997 20.185 95-99 24.185000000000002 27.6 27.57 20.645 100-104 24.104999999999997 28.244999999999997 26.945000000000004 20.705000000000002 105-109 24.135 28.005000000000003 27.589999999999996 20.27 110-114 23.755000000000003 27.955000000000002 27.950000000000003 20.34 115-119 24.08 28.675 27.339999999999996 19.905 120-124 24.279999999999998 27.54 27.700000000000003 20.48 125-129 24.085 28.225 27.41 20.28 130-134 24.245 28.465 26.834999999999997 20.455000000000002 135-139 25.03 28.01 27.250000000000004 19.71 140-144 25.275 28.060000000000002 26.99 19.675 145-149 25.430000000000003 28.815 26.495 19.259999999999998 150-151 26.075 27.925 26.5125 19.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 3.5 23 3.0 24 1.0 25 0.5 26 2.0 27 2.0 28 2.0 29 7.0 30 14.0 31 13.0 32 15.0 33 28.5 34 36.0 35 45.0 36 64.0 37 96.0 38 126.5 39 141.0 40 176.0 41 228.0 42 254.0 43 265.5 44 286.5 45 304.5 46 296.0 47 267.5 48 243.5 49 223.0 50 197.5 51 145.5 52 105.5 53 98.0 54 82.0 55 59.0 56 45.0 57 32.5 58 18.0 59 12.0 60 14.0 61 12.0 62 6.5 63 7.0 64 4.5 65 2.0 66 1.5 67 1.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.67 30-34 2.705 35-39 1.275 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 3.3375000000000004 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.9749999999999996 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.575 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTCCA 10 0.0068963906 144.5375 3 >>END_MODULE Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra Read 817563 spots for SRR7172681.sra Written 817563 spots for SRR7172681.sra SRR ids: ['SRR7172681.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d1t3z7s_ SRR7172681.sra spots: 16351260 blocks: [[1, 817563], [817564, 1635126], [1635127, 2452689], [2452690, 3270252], [3270253, 4087815], [4087816, 4905378], [4905379, 5722941], [5722942, 6540504], [6540505, 7358067], [7358068, 8175630], [8175631, 8993193], [8993194, 9810756], [9810757, 10628319], [10628320, 11445882], [11445883, 12263445], [12263446, 13081008], [13081009, 13898571], [13898572, 14716134], [14716135, 15533697], [15533698, 16351260]] SRR7172681 file size 5519205 SRR7172681 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172681 SRR7172681_1.fastq SRR7172681_2.fastq Input file: SRR7172681_1.fastq Paired file: SRR7172681_2.fastq trimmed: SRR7172681-trimmed-pair1.fastq, SRR7172681-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 12:53:00 2025 >> started Mon Feb 10 12:53:17 2025 >> done (16.746s) 16351260 read pairs processed; of these: 18144 ( 0.11%) short read pairs filtered out after trimming by size control 11742 ( 0.07%) empty read pairs filtered out after trimming by size control 16321374 (99.82%) read pairs available; of these: 8395052 (51.44%) trimmed read pairs available after processing 7926322 (48.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 6 0.00% 24 3 0.00% 25 2 0.00% 26 13 0.00% 27 2 0.00% 28 2 0.00% 29 5 0.00% 30 3 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 6 0.00% 36 0 0.00% 37 5 0.00% 38 6 0.00% 39 9 0.00% 40 2 0.00% 41 8 0.00% 42 0 0.00% 43 7 0.00% 44 13 0.00% 45 10 0.00% 46 9 0.00% 47 5 0.00% 48 11 0.00% 49 7 0.00% 50 22 0.00% 51 13 0.00% 52 21 0.00% 53 27 0.00% 54 29 0.00% 55 30 0.00% 56 33 0.00% 57 37 0.00% 58 44 0.00% 59 51 0.00% 60 62 0.00% 61 65 0.00% 62 75 0.00% 63 82 0.00% 64 76 0.00% 65 103 0.00% 66 132 0.00% 67 142 0.00% 68 183 0.00% 69 182 0.00% 70 205 0.00% 71 263 0.00% 72 297 0.00% 73 343 0.00% 74 380 0.00% 75 469 0.00% 76 599 0.00% 77 631 0.00% 78 672 0.00% 79 774 0.00% 80 871 0.01% 81 1011 0.01% 82 1177 0.01% 83 1461 0.01% 84 2500 0.02% 85 3090 0.02% 86 3554 0.02% 87 3936 0.02% 88 4118 0.03% 89 4084 0.03% 90 4309 0.03% 91 4617 0.03% 92 5089 0.03% 93 5405 0.03% 94 5863 0.04% 95 6388 0.04% 96 6682 0.04% 97 7233 0.04% 98 7740 0.05% 99 8287 0.05% 100 8999 0.06% 101 9687 0.06% 102 10446 0.06% 103 11264 0.07% 104 12112 0.07% 105 12949 0.08% 106 13854 0.08% 107 14725 0.09% 108 15650 0.10% 109 16765 0.10% 110 17635 0.11% 111 18823 0.12% 112 20144 0.12% 113 21157 0.13% 114 22948 0.14% 115 24260 0.15% 116 25134 0.15% 117 25977 0.16% 118 27391 0.17% 119 28783 0.18% 120 29793 0.18% 121 31119 0.19% 122 33253 0.20% 123 34726 0.21% 124 36487 0.22% 125 37981 0.23% 126 39601 0.24% 127 41536 0.25% 128 43560 0.27% 129 45164 0.28% 130 47432 0.29% 131 48935 0.30% 132 51650 0.32% 133 54007 0.33% 134 56727 0.35% 135 59271 0.36% 136 63023 0.39% 137 65829 0.40% 138 69985 0.43% 139 74456 0.46% 140 78987 0.48% 141 85679 0.52% 142 93480 0.57% 143 102803 0.63% 144 116140 0.71% 145 135174 0.83% 146 164294 1.01% 147 218158 1.34% 148 333900 2.05% 149 832390 5.10% 150 4817196 29.51% 151 7926322 48.56% 16321374 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=29 prefix-density=0.52 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=381.86 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=33.8 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=27 prefix-density=0.54 prefix-fanout=2.5 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=165.57 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=25.7 sequence=GAGAAGAAGGAT SRR7172681 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 12:54:06 Started mapping on | Feb 10 12:54:06 Finished on | Feb 10 12:56:13 Mapping speed, Million of reads per hour | 462.65 Number of input reads | 16321374 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15305126 Uniquely mapped reads % | 93.77% Average mapped length | 295.01 Number of splices: Total | 15672560 Number of splices: Annotated (sjdb) | 15387829 Number of splices: GT/AG | 15423913 Number of splices: GC/AG | 198064 Number of splices: AT/AC | 12604 Number of splices: Non-canonical | 37979 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404745 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 38011 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 627493 627493 627493 N_multimapping 404745 404745 404745 N_noFeature 353018 15158314 410676 N_ambiguous 157669 862 67954 UnstrandedReadsAssigned:14794439 PositiveStrandReadsAssigned:145950 NegativeStrandReadsAssigned:14826496 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172681 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172681-trimmed-pair1.fastq SRR7172681-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,321,374 reads, 14,730,899 reads pseudoaligned [quant] estimated average fragment length: 228.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR7172681.ke.tsv 34699 SRR7172681.se.tsv 87100 total ==> SRR7172681.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.21 1304 40.9883 Potri.005G024800.1.v4.1 1035 807.205 271 18.8917 Potri.004G059700.1.v4.1 961 733.21 19 1.45818 Potri.007G009000.2.v4.1 1416 1188.21 0 0 Potri.003G141000.2.v4.1 2943 2715.21 602.218 12.4806 Potri.016G087400.1.v4.1 270 80.1844 1548 1086.34 Potri.015G069301.1.v4.1 564 338.437 0 0 Potri.010G195200.1.v4.1 1773 1545.21 599.921 21.847 Potri.012G127500.1.v4.1 977 749.21 3998 300.278 ==> SRR7172681.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 626 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 210 SRR7172681 completed mapping pipeline successfully