Starting /dee2/code/volunteer_pipeline.sh SRR7172682 current disk space = 3058929635328 free memory = 1302127092 SRR7172682 SRAfilesize daa871da4701904b6b1140f212cb2ae8 SRR7172682.sra SRR7172682.sra file validated SRR7172682 is paired end SRR7172682 is conventional basespace SRR7172682 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172682_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.52325 18.0 18.0 31.0 18.0 33.0 2 30.17975 31.0 29.0 33.0 27.0 33.0 3 31.7815 33.0 32.0 33.0 27.0 33.0 4 32.2225 33.0 32.0 33.0 31.0 33.0 5 32.53875 33.0 33.0 33.0 32.0 34.0 6 36.4305 38.0 37.0 38.0 34.0 38.0 7 37.4715 38.0 38.0 38.0 37.0 38.0 8 37.51125 38.0 38.0 38.0 37.0 38.0 9 37.49125 38.0 38.0 38.0 37.0 38.0 10-14 37.614700000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.58525 38.0 38.0 38.0 38.0 38.0 20-24 37.56565 38.0 38.0 38.0 38.0 38.0 25-29 37.59570000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.59355000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.56215 38.0 38.0 38.0 38.0 38.0 40-44 37.50675 38.0 38.0 38.0 38.0 38.0 45-49 37.44945 38.0 38.0 38.0 37.8 38.0 50-54 37.43365 38.0 38.0 38.0 37.2 38.0 55-59 37.33 38.0 38.0 38.0 37.0 38.0 60-64 37.33185 38.0 38.0 38.0 37.0 38.0 65-69 37.249 38.0 38.0 38.0 37.0 38.0 70-74 37.23545 38.0 38.0 38.0 36.8 38.0 75-79 37.102999999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.95795 38.0 38.0 38.0 35.8 38.0 85-89 36.93725 38.0 38.0 38.0 36.0 38.0 90-94 37.0143 38.0 38.0 38.0 36.0 38.0 95-99 37.0064 38.0 38.0 38.0 35.8 38.0 100-104 36.8385 38.0 38.0 38.0 35.2 38.0 105-109 36.5535 38.0 38.0 38.0 34.2 38.0 110-114 36.3646 38.0 38.0 38.0 34.0 38.0 115-119 36.3607 38.0 38.0 38.0 34.0 38.0 120-124 36.234950000000005 38.0 37.4 38.0 33.8 38.0 125-129 35.848299999999995 38.0 37.0 38.0 31.6 38.0 130-134 35.3072 38.0 36.0 38.0 29.8 38.0 135-139 35.242599999999996 38.0 35.8 38.0 29.4 38.0 140-144 35.02515 38.0 35.6 38.0 28.4 38.0 145-149 34.694100000000006 38.0 35.2 38.0 28.4 38.0 150-151 30.789250000000003 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 3.0 23 1.0 24 2.0 25 9.0 26 17.0 27 19.0 28 19.0 29 31.0 30 40.0 31 47.0 32 62.0 33 84.0 34 154.0 35 275.0 36 660.0 37 2570.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.31616889804325 14.907312049433575 11.1740473738414 40.60247167868177 2 19.069182389937104 18.28930817610063 37.9622641509434 24.67924528301887 3 19.5 23.95 26.25 30.3 4 22.425 32.65 22.45 22.475 5 20.075000000000003 34.599999999999994 24.425 20.9 6 17.849999999999998 35.699999999999996 26.25 20.200000000000003 7 12.975 22.0 45.975 19.05 8 18.4 22.0 31.125000000000004 28.475 9 18.65 23.025000000000002 32.550000000000004 25.775 10-14 19.475 29.615000000000002 27.339999999999996 23.57 15-19 19.98 28.23 28.095 23.695 20-24 19.93 28.715000000000003 28.04 23.315 25-29 20.09 28.189999999999998 28.24 23.48 30-34 19.439999999999998 28.4 28.08 24.08 35-39 19.759999999999998 27.994999999999997 28.29 23.955000000000002 40-44 20.45 28.720000000000002 27.589999999999996 23.24 45-49 19.97 28.025 27.825 24.18 50-54 19.96 28.110000000000003 27.939999999999998 23.990000000000002 55-59 20.165 28.305000000000003 27.63 23.9 60-64 19.71 28.59 27.76 23.94 65-69 19.415 28.16 28.105000000000004 24.32 70-74 20.09 28.194999999999997 27.76 23.955000000000002 75-79 20.315 28.694999999999997 27.455000000000002 23.535 80-84 20.25 28.084999999999997 27.675 23.990000000000002 85-89 19.915 28.470000000000002 27.894999999999996 23.72 90-94 20.355 27.595 27.83 24.22 95-99 20.225 28.549999999999997 27.685 23.54 100-104 19.88 27.565 28.689999999999998 23.865 105-109 20.365 27.805000000000003 27.965 23.865 110-114 20.095 27.975 27.805000000000003 24.125 115-119 20.13 27.68 28.000000000000004 24.19 120-124 20.02 27.694999999999997 28.02 24.265 125-129 20.695 28.18 27.595 23.53 130-134 20.28 28.310000000000002 27.894999999999996 23.515 135-139 20.575 27.565 27.63 24.23 140-144 20.68 28.28 27.265 23.775 145-149 20.86 27.715 27.85 23.575 150-151 20.9375 29.012500000000003 26.7125 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 2.0 24 2.0 25 1.0 26 4.5 27 6.5 28 4.5 29 10.0 30 18.0 31 23.0 32 30.0 33 42.0 34 53.5 35 60.5 36 75.5 37 104.5 38 139.0 39 167.0 40 190.5 41 216.0 42 254.5 43 286.5 44 283.5 45 290.0 46 291.5 47 259.0 48 239.5 49 217.0 50 176.5 51 144.0 52 105.5 53 74.0 54 57.0 55 43.0 56 35.0 57 23.0 58 15.5 59 13.5 60 9.5 61 5.5 62 3.0 63 3.5 64 3.5 65 2.5 66 1.0 67 1.0 68 2.0 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCTTG 10 0.006832588 144.9875 3 >>END_MODULE SRR7172682 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172682_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14525 34.0 33.0 34.0 33.0 34.0 2 33.1715 34.0 33.0 34.0 33.0 34.0 3 33.192 34.0 33.0 34.0 33.0 34.0 4 33.162 34.0 33.0 34.0 33.0 34.0 5 33.1655 34.0 33.0 34.0 33.0 34.0 6 37.307 38.0 38.0 38.0 37.0 38.0 7 37.214 38.0 38.0 38.0 38.0 38.0 8 37.315 38.0 38.0 38.0 37.0 38.0 9 37.311 38.0 38.0 38.0 37.0 38.0 10-14 37.31485 38.0 38.0 38.0 37.2 38.0 15-19 37.340149999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.2873 38.0 38.0 38.0 37.6 38.0 25-29 37.072199999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.386700000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.693400000000004 38.0 38.0 38.0 36.0 38.0 40-44 37.07465 38.0 38.0 38.0 37.0 38.0 45-49 37.077 38.0 38.0 38.0 37.0 38.0 50-54 37.0431 38.0 38.0 38.0 37.0 38.0 55-59 36.9587 38.0 38.0 38.0 36.2 38.0 60-64 36.75435 38.0 38.0 38.0 35.6 38.0 65-69 36.582049999999995 38.0 38.0 38.0 34.8 38.0 70-74 36.64465 38.0 38.0 38.0 35.4 38.0 75-79 36.645500000000006 38.0 38.0 38.0 35.0 38.0 80-84 36.660349999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.56515 38.0 38.0 38.0 34.8 38.0 90-94 36.565999999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.44925 38.0 38.0 38.0 34.4 38.0 100-104 36.337399999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.19775 38.0 38.0 38.0 34.0 38.0 110-114 36.0159 38.0 37.8 38.0 33.6 38.0 115-119 35.913650000000004 38.0 37.4 38.0 33.2 38.0 120-124 35.6072 38.0 37.0 38.0 31.0 38.0 125-129 35.312400000000004 38.0 36.4 38.0 29.6 38.0 130-134 35.000350000000005 38.0 36.0 38.0 28.2 38.0 135-139 34.640299999999996 38.0 35.2 38.0 27.6 38.0 140-144 34.295 38.0 35.0 38.0 26.2 38.0 145-149 33.222899999999996 38.0 33.0 38.0 18.2 38.0 150-151 28.692375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 4.0 5 1.0 6 3.0 7 3.0 8 1.0 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 0.0 15 2.0 16 7.0 17 2.0 18 6.0 19 4.0 20 5.0 21 8.0 22 7.0 23 8.0 24 12.0 25 14.0 26 10.0 27 26.0 28 30.0 29 42.0 30 51.0 31 53.0 32 76.0 33 98.0 34 157.0 35 250.0 36 592.0 37 2517.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.95 16.6 15.049999999999999 31.4 2 24.5 24.425 35.125 15.950000000000001 3 19.975 28.349999999999998 29.5 22.175 4 23.35 35.325 21.925 19.400000000000002 5 24.5 37.0 22.55 15.950000000000001 6 19.275000000000002 38.224999999999994 23.799999999999997 18.7 7 17.95 18.2 42.3 21.55 8 21.15 24.725 27.950000000000003 26.174999999999997 9 22.825 24.349999999999998 27.375 25.45 10-14 23.02 29.395 26.119999999999997 21.465 15-19 23.07 28.744999999999997 26.985 21.2 20-24 22.785 28.29 27.605 21.32 25-29 23.168833776796024 27.837742858577236 27.978312164265272 21.015111200361464 30-34 23.100909927410285 28.53491463040589 27.773233820672733 20.590941621511092 35-39 23.33921815889029 28.489281210592686 27.611601513240856 20.559899117276167 40-44 22.994999999999997 28.505000000000003 27.55 20.95 45-49 22.85 27.794999999999998 27.985 21.37 50-54 23.965 27.905 27.700000000000003 20.43 55-59 23.27 27.884999999999998 27.900000000000002 20.945 60-64 23.955000000000002 28.000000000000004 27.950000000000003 20.095 65-69 23.549999999999997 28.225 27.87 20.355 70-74 23.855 27.834999999999997 27.315 20.995 75-79 23.445 28.189999999999998 27.915 20.45 80-84 23.96 27.855 27.689999999999998 20.495 85-89 23.865 28.03 27.595 20.51 90-94 23.794999999999998 27.735 27.665 20.805 95-99 23.56 27.72 28.23 20.49 100-104 23.974999999999998 28.105000000000004 27.66 20.26 105-109 24.2 27.905 27.575 20.32 110-114 24.04 28.08 27.775 20.105 115-119 24.41 27.650000000000002 27.694999999999997 20.244999999999997 120-124 23.875 28.470000000000002 26.955000000000002 20.7 125-129 23.515 27.565 28.205000000000002 20.715 130-134 24.45 27.79 27.295 20.465 135-139 24.46 27.800000000000004 27.779999999999998 19.96 140-144 24.445 28.465 27.345000000000002 19.744999999999997 145-149 25.335 28.115000000000002 26.82 19.73 150-151 24.7375 28.712500000000002 27.2625 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 0.0 21 0.0 22 0.5 23 2.5 24 2.0 25 1.0 26 2.5 27 2.5 28 3.0 29 4.0 30 6.5 31 11.5 32 20.0 33 30.0 34 36.5 35 47.5 36 63.5 37 87.5 38 128.0 39 164.5 40 203.5 41 246.5 42 282.0 43 307.5 44 306.5 45 296.5 46 282.0 47 271.0 48 253.5 49 211.0 50 164.0 51 136.0 52 116.0 53 89.0 54 59.0 55 38.0 56 29.5 57 25.5 58 19.0 59 11.5 60 8.5 61 5.0 62 5.5 63 4.5 64 3.5 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.40499999999999997 30-34 2.19 35-39 0.8750000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.6500000000000004 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATG 10 0.006830828 145.0 2 >>END_MODULE Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905934 spots for SRR7172682.sra Written 905934 spots for SRR7172682.sra Read 905949 spots for SRR7172682.sra Written 905949 spots for SRR7172682.sra SRR ids: ['SRR7172682.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j9lo45go SRR7172682.sra spots: 18118695 blocks: [[1, 905934], [905935, 1811868], [1811869, 2717802], [2717803, 3623736], [3623737, 4529670], [4529671, 5435604], [5435605, 6341538], [6341539, 7247472], [7247473, 8153406], [8153407, 9059340], [9059341, 9965274], [9965275, 10871208], [10871209, 11777142], [11777143, 12683076], [12683077, 13589010], [13589011, 14494944], [14494945, 15400878], [15400879, 16306812], [16306813, 17212746], [17212747, 18118695]] SRR7172682 file size 6118130 SRR7172682 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172682 SRR7172682_1.fastq SRR7172682_2.fastq Input file: SRR7172682_1.fastq Paired file: SRR7172682_2.fastq trimmed: SRR7172682-trimmed-pair1.fastq, SRR7172682-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:25:35 2025 >> started Mon Feb 10 13:25:54 2025 >> done (18.923s) 18118695 read pairs processed; of these: 17044 ( 0.09%) short read pairs filtered out after trimming by size control 11378 ( 0.06%) empty read pairs filtered out after trimming by size control 18090273 (99.84%) read pairs available; of these: 7256407 (40.11%) trimmed read pairs available after processing 10833866 (59.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 1 0.00% 36 3 0.00% 37 3 0.00% 38 5 0.00% 39 4 0.00% 40 3 0.00% 41 8 0.00% 42 6 0.00% 43 4 0.00% 44 11 0.00% 45 9 0.00% 46 5 0.00% 47 7 0.00% 48 11 0.00% 49 8 0.00% 50 9 0.00% 51 7 0.00% 52 16 0.00% 53 20 0.00% 54 22 0.00% 55 30 0.00% 56 30 0.00% 57 29 0.00% 58 33 0.00% 59 33 0.00% 60 50 0.00% 61 51 0.00% 62 73 0.00% 63 83 0.00% 64 77 0.00% 65 94 0.00% 66 97 0.00% 67 126 0.00% 68 135 0.00% 69 161 0.00% 70 173 0.00% 71 206 0.00% 72 220 0.00% 73 238 0.00% 74 334 0.00% 75 348 0.00% 76 455 0.00% 77 452 0.00% 78 566 0.00% 79 609 0.00% 80 717 0.00% 81 827 0.00% 82 964 0.01% 83 1131 0.01% 84 2087 0.01% 85 2600 0.01% 86 2717 0.02% 87 2939 0.02% 88 3132 0.02% 89 3266 0.02% 90 3494 0.02% 91 3861 0.02% 92 4101 0.02% 93 4448 0.02% 94 4787 0.03% 95 5163 0.03% 96 5680 0.03% 97 6052 0.03% 98 6369 0.04% 99 6937 0.04% 100 7557 0.04% 101 8145 0.05% 102 8814 0.05% 103 9483 0.05% 104 10246 0.06% 105 10982 0.06% 106 11682 0.06% 107 12749 0.07% 108 13370 0.07% 109 14060 0.08% 110 15082 0.08% 111 16063 0.09% 112 16997 0.09% 113 18197 0.10% 114 19245 0.11% 115 20968 0.12% 116 22056 0.12% 117 22855 0.13% 118 24041 0.13% 119 25108 0.14% 120 26252 0.15% 121 28213 0.16% 122 29360 0.16% 123 31207 0.17% 124 32947 0.18% 125 34685 0.19% 126 36358 0.20% 127 38172 0.21% 128 39938 0.22% 129 42068 0.23% 130 43826 0.24% 131 45721 0.25% 132 48516 0.27% 133 50954 0.28% 134 54021 0.30% 135 57614 0.32% 136 61151 0.34% 137 64710 0.36% 138 68680 0.38% 139 73501 0.41% 140 79133 0.44% 141 85810 0.47% 142 93394 0.52% 143 103967 0.57% 144 119556 0.66% 145 141175 0.78% 146 173443 0.96% 147 233217 1.29% 148 365352 2.02% 149 685594 3.79% 150 3884013 21.47% 151 10833866 59.89% 18090273 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.7 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=34.28 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.5 sequence=ATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=30 prefix-density=0.54 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=74.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.7 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTG SRR7172682 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:26:35 Started mapping on | Feb 10 13:26:35 Finished on | Feb 10 13:28:26 Mapping speed, Million of reads per hour | 586.71 Number of input reads | 18090273 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17265487 Uniquely mapped reads % | 95.44% Average mapped length | 296.24 Number of splices: Total | 17789297 Number of splices: Annotated (sjdb) | 17459467 Number of splices: GT/AG | 17504427 Number of splices: GC/AG | 228969 Number of splices: AT/AC | 14187 Number of splices: Non-canonical | 41714 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503408 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 31684 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.54% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 337360 337360 337360 N_multimapping 503408 503408 503408 N_noFeature 390978 17117037 451986 N_ambiguous 172427 808 84477 UnstrandedReadsAssigned:16702082 PositiveStrandReadsAssigned:147642 NegativeStrandReadsAssigned:16729024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172682 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172682-trimmed-pair1.fastq SRR7172682-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,090,273 reads, 16,630,491 reads pseudoaligned [quant] estimated average fragment length: 239.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7172682.ke.tsv 34699 SRR7172682.se.tsv 87100 total ==> SRR7172682.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.72 1997 59.6619 Potri.005G024800.1.v4.1 1035 796.721 440 29.3641 Potri.004G059700.1.v4.1 961 722.721 49 3.60492 Potri.007G009000.2.v4.1 1416 1177.72 0 0 Potri.003G141000.2.v4.1 2943 2704.72 524 10.301 Potri.016G087400.1.v4.1 270 76.0971 1039 725.969 Potri.015G069301.1.v4.1 564 329.038 0 0 Potri.010G195200.1.v4.1 1773 1534.72 814.789 28.2284 Potri.012G127500.1.v4.1 977 738.721 6125 440.856 ==> SRR7172682.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 660 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 309 SRR7172682 completed mapping pipeline successfully