Starting /dee2/code/volunteer_pipeline.sh SRR7172683 current disk space = 3059104555008 free memory = 1436792196 SRR7172683 SRAfilesize 56cef3c8898f65235b50d1338e2c79d7 SRR7172683.sra SRR7172683.sra file validated SRR7172683 is paired end SRR7172683 is conventional basespace SRR7172683 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172683_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41575 33.0 33.0 34.0 32.0 34.0 2 32.8025 34.0 33.0 34.0 32.0 34.0 3 32.68475 33.0 33.0 34.0 31.0 34.0 4 32.699 33.0 33.0 34.0 31.0 34.0 5 32.86775 33.0 33.0 34.0 32.0 34.0 6 36.82375 38.0 37.0 38.0 35.0 38.0 7 37.3805 38.0 38.0 38.0 37.0 38.0 8 37.45375 38.0 38.0 38.0 37.0 38.0 9 37.5655 38.0 38.0 38.0 38.0 38.0 10-14 37.6456 38.0 38.0 38.0 38.0 38.0 15-19 37.62775 38.0 38.0 38.0 38.0 38.0 20-24 37.5667 38.0 38.0 38.0 38.0 38.0 25-29 37.52795 38.0 38.0 38.0 38.0 38.0 30-34 37.516650000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.52465 38.0 38.0 38.0 38.0 38.0 40-44 37.43685000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.4071 38.0 38.0 38.0 38.0 38.0 50-54 37.310100000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.204899999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.22575 38.0 38.0 38.0 37.0 38.0 65-69 37.1534 38.0 38.0 38.0 36.8 38.0 70-74 36.9963 38.0 38.0 38.0 36.0 38.0 75-79 37.021100000000004 38.0 38.0 38.0 36.2 38.0 80-84 36.9714 38.0 38.0 38.0 36.0 38.0 85-89 36.64905 38.0 38.0 38.0 35.0 38.0 90-94 36.7765 38.0 38.0 38.0 35.4 38.0 95-99 36.7097 38.0 38.0 38.0 35.4 38.0 100-104 36.51559999999999 38.0 38.0 38.0 34.4 38.0 105-109 36.291700000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.0779 38.0 37.8 38.0 33.2 38.0 115-119 35.9583 38.0 37.2 38.0 32.4 38.0 120-124 36.1492 38.0 38.0 38.0 33.8 38.0 125-129 36.02385 38.0 37.6 38.0 33.4 38.0 130-134 35.62905 38.0 36.8 38.0 31.6 38.0 135-139 35.257850000000005 38.0 36.0 38.0 30.0 38.0 140-144 35.186749999999996 38.0 36.0 38.0 29.8 38.0 145-149 34.8788 38.0 36.0 38.0 29.4 38.0 150-151 31.757125000000002 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 5.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 3.0 17 2.0 18 2.0 19 3.0 20 5.0 21 4.0 22 4.0 23 3.0 24 7.0 25 9.0 26 13.0 27 15.0 28 15.0 29 29.0 30 32.0 31 47.0 32 66.0 33 65.0 34 115.0 35 239.0 36 558.0 37 2750.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.90770791075051 12.829614604462474 13.590263691683571 42.672413793103445 2 20.637710268641726 17.449158925433093 37.55962842078835 24.35350238513683 3 19.45 22.575 27.200000000000003 30.775000000000002 4 22.1 31.424999999999997 22.400000000000002 24.075 5 21.525 34.300000000000004 25.25 18.925 6 17.150000000000002 36.449999999999996 27.450000000000003 18.95 7 13.8 24.825 43.974999999999994 17.4 8 17.349999999999998 25.275 32.025 25.35 9 17.45 25.5 34.65 22.400000000000002 10-14 18.82 31.46 27.200000000000003 22.52 15-19 18.485 29.854999999999997 28.265 23.395 20-24 19.295 30.09 28.225 22.39 25-29 19.2 30.4 28.34 22.06 30-34 19.175 30.080000000000002 27.815 22.93 35-39 19.53 29.7 27.63 23.14 40-44 19.79 29.935000000000002 27.805000000000003 22.470000000000002 45-49 19.45 29.715000000000003 27.584999999999997 23.25 50-54 19.935 29.705 27.565 22.795 55-59 19.62 30.214999999999996 27.634999999999998 22.53 60-64 19.595000000000002 29.28 28.165000000000003 22.96 65-69 19.825 29.475 27.439999999999998 23.26 70-74 19.215 29.675 27.96 23.150000000000002 75-79 19.725 28.78 28.405 23.09 80-84 19.81 28.715000000000003 27.935 23.54 85-89 20.150000000000002 28.395 27.55 23.905 90-94 20.355 28.9 28.12 22.625 95-99 19.615 28.439999999999998 28.12 23.825 100-104 20.14 28.875 27.92 23.064999999999998 105-109 20.655 28.82 27.125 23.400000000000002 110-114 20.303197078100766 27.92815329964477 27.863111022164404 23.90553860009006 115-119 20.005 29.195 26.974999999999998 23.825 120-124 20.565 28.384999999999998 27.215 23.835 125-129 20.465 28.410000000000004 27.18 23.945 130-134 20.95 28.660000000000004 27.07 23.32 135-139 20.95 28.435 26.855 23.76 140-144 20.515 28.18 27.384999999999998 23.919999999999998 145-149 20.66 28.544999999999998 26.63 24.165 150-151 19.287499999999998 29.075 26.825 24.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.5 13 1.5 14 2.0 15 1.5 16 0.5 17 1.5 18 1.5 19 0.5 20 2.5 21 2.5 22 1.5 23 1.0 24 3.0 25 7.0 26 10.5 27 14.0 28 19.0 29 21.0 30 30.0 31 52.0 32 65.5 33 79.0 34 97.5 35 105.0 36 124.0 37 151.5 38 162.0 39 174.5 40 189.5 41 218.0 42 231.0 43 231.5 44 243.0 45 235.0 46 236.5 47 234.0 48 199.5 49 159.0 50 140.0 51 126.5 52 99.5 53 76.0 54 56.5 55 45.0 56 33.5 57 21.5 58 20.5 59 17.0 60 11.5 61 9.0 62 8.0 63 5.0 64 2.5 65 4.0 66 3.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.5 72 2.0 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.065 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57904085257549 97.125 2 1.3448363359553412 2.65 3 0.07612281146917026 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.0125000000000002 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.275 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.300000000000001 0.0 0.0 0.0 0.0 134-135 6.925 0.0 0.0 0.0 0.0 136-137 7.45 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAC 10 0.006830828 145.0 9 GTCCCTT 10 0.006830828 145.0 6 CGAAAGT 10 0.006830828 145.0 3 >>END_MODULE SRR7172683 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172683_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20525 34.0 33.0 34.0 33.0 34.0 2 33.32425 34.0 33.0 34.0 33.0 34.0 3 33.32275 34.0 33.0 34.0 33.0 34.0 4 33.29125 34.0 33.0 34.0 33.0 34.0 5 33.26825 34.0 33.0 34.0 33.0 34.0 6 37.4105 38.0 38.0 38.0 38.0 38.0 7 37.4225 38.0 38.0 38.0 38.0 38.0 8 37.38675 38.0 38.0 38.0 38.0 38.0 9 37.348 38.0 38.0 38.0 38.0 38.0 10-14 37.3402 38.0 38.0 38.0 38.0 38.0 15-19 37.3698 38.0 38.0 38.0 38.0 38.0 20-24 37.327 38.0 38.0 38.0 37.8 38.0 25-29 37.1011 38.0 38.0 38.0 37.6 38.0 30-34 36.644 38.0 38.0 38.0 37.0 38.0 35-39 36.83615 38.0 38.0 38.0 37.0 38.0 40-44 37.221050000000005 38.0 38.0 38.0 37.4 38.0 45-49 37.24285 38.0 38.0 38.0 37.4 38.0 50-54 37.23045 38.0 38.0 38.0 37.0 38.0 55-59 37.167249999999996 38.0 38.0 38.0 37.2 38.0 60-64 37.077 38.0 38.0 38.0 37.0 38.0 65-69 36.989850000000004 38.0 38.0 38.0 37.0 38.0 70-74 36.9493 38.0 38.0 38.0 36.0 38.0 75-79 36.86625 38.0 38.0 38.0 35.8 38.0 80-84 36.898399999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.866099999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.749249999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.65715 38.0 38.0 38.0 35.4 38.0 100-104 36.54684999999999 38.0 38.0 38.0 34.6 38.0 105-109 36.48425 38.0 38.0 38.0 34.6 38.0 110-114 36.4086 38.0 38.0 38.0 34.4 38.0 115-119 36.14325 38.0 38.0 38.0 33.8 38.0 120-124 35.888200000000005 38.0 37.6 38.0 32.8 38.0 125-129 35.627700000000004 38.0 37.0 38.0 31.6 38.0 130-134 35.439350000000005 38.0 36.2 38.0 31.0 38.0 135-139 35.15495 38.0 36.0 38.0 30.0 38.0 140-144 34.70545 38.0 35.8 38.0 28.0 38.0 145-149 33.70665 38.0 33.4 38.0 22.2 38.0 150-151 29.134500000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 4.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 5.0 18 2.0 19 3.0 20 3.0 21 3.0 22 7.0 23 9.0 24 20.0 25 7.0 26 14.0 27 20.0 28 22.0 29 26.0 30 30.0 31 42.0 32 56.0 33 99.0 34 144.0 35 247.0 36 500.0 37 2715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.0 15.024999999999999 18.575 32.4 2 24.65 23.45 36.15 15.75 3 21.025 26.575 30.725 21.675 4 23.974999999999998 33.15 23.775 19.1 5 25.224999999999998 35.35 23.075000000000003 16.35 6 19.15 37.675 25.75 17.424999999999997 7 20.05 16.675 42.925000000000004 20.349999999999998 8 21.475 22.825 28.499999999999996 27.200000000000003 9 22.525000000000002 24.45 28.999999999999996 24.025 10-14 23.32 29.615000000000002 25.874999999999996 21.19 15-19 23.765 28.26 27.555000000000003 20.419999999999998 20-24 23.735 28.939999999999998 26.810000000000002 20.515 25-29 23.557498994772818 28.231805388017694 27.849819059107357 20.36087655810213 30-34 23.338422391857506 28.458015267175576 27.455470737913483 20.748091603053435 35-39 23.76292559899117 27.687263556116015 27.697351828499368 20.852459016393443 40-44 23.505000000000003 28.555000000000003 27.605 20.335 45-49 23.32 28.32 27.639999999999997 20.72 50-54 23.7 28.305000000000003 27.48 20.515 55-59 23.56 28.13 27.644999999999996 20.665 60-64 23.165 28.549999999999997 28.01 20.275000000000002 65-69 23.635 27.474999999999998 28.01 20.880000000000003 70-74 23.57 28.28 28.08 20.07 75-79 24.065 27.685 27.700000000000003 20.549999999999997 80-84 23.815 27.62 28.134999999999998 20.43 85-89 23.48 27.73 27.845 20.945 90-94 23.345 28.265 28.305000000000003 20.085 95-99 23.635 27.894999999999996 28.395 20.075000000000003 100-104 23.34 27.915 28.599999999999998 20.145 105-109 23.200000000000003 27.800000000000004 28.425 20.575 110-114 23.455000000000002 28.315 27.839999999999996 20.39 115-119 23.599999999999998 27.655 28.395 20.349999999999998 120-124 24.445 27.775 28.22 19.56 125-129 24.01 28.139999999999997 27.889999999999997 19.96 130-134 24.185000000000002 27.994999999999997 27.935 19.885 135-139 24.654999999999998 28.09 27.66 19.595000000000002 140-144 24.565 28.360000000000003 27.215 19.86 145-149 25.245 28.249999999999996 27.435 19.07 150-151 24.837500000000002 28.525 27.5875 19.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.5 18 1.5 19 1.0 20 1.0 21 1.0 22 2.5 23 2.0 24 3.0 25 3.5 26 4.0 27 7.5 28 10.0 29 8.0 30 9.5 31 15.5 32 29.5 33 37.0 34 43.5 35 63.5 36 80.0 37 107.5 38 135.0 39 170.0 40 200.5 41 209.5 42 241.5 43 280.5 44 278.0 45 280.5 46 284.5 47 258.5 48 234.0 49 199.5 50 164.0 51 138.0 52 111.5 53 96.0 54 79.0 55 55.0 56 40.5 57 26.5 58 19.5 59 14.0 60 7.0 61 8.0 62 8.0 63 6.5 64 5.0 65 3.0 66 1.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.52 30-34 1.7500000000000002 35-39 0.8750000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65482233502539 97.175 2 1.1928934010152283 2.35 3 0.12690355329949238 0.375 4 0.025380710659898477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.0125000000000002 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.8875 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.699999999999999 0.0 0.0 0.0 0.0 132-133 6.324999999999999 0.0 0.0 0.0 0.0 134-135 6.925 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 8.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCAAA 10 0.0068555363 144.825 8 CCATTTT 10 0.0068555363 144.825 6 ATCAGCT 20 0.0059702373 28.965 80-84 >>END_MODULE Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503770 spots for SRR7172683.sra Written 503770 spots for SRR7172683.sra Read 503772 spots for SRR7172683.sra Written 503772 spots for SRR7172683.sra SRR ids: ['SRR7172683.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nawidbep SRR7172683.sra spots: 10075402 blocks: [[1, 503770], [503771, 1007540], [1007541, 1511310], [1511311, 2015080], [2015081, 2518850], [2518851, 3022620], [3022621, 3526390], [3526391, 4030160], [4030161, 4533930], [4533931, 5037700], [5037701, 5541470], [5541471, 6045240], [6045241, 6549010], [6549011, 7052780], [7052781, 7556550], [7556551, 8060320], [8060321, 8564090], [8564091, 9067860], [9067861, 9571630], [9571631, 10075402]] SRR7172683 file size 3392522 SRR7172683 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172683 SRR7172683_1.fastq SRR7172683_2.fastq Input file: SRR7172683_1.fastq Paired file: SRR7172683_2.fastq trimmed: SRR7172683-trimmed-pair1.fastq, SRR7172683-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:50:04 2025 >> started Mon Feb 10 13:50:21 2025 >> done (17.020s) 10075402 read pairs processed; of these: 9143 ( 0.09%) short read pairs filtered out after trimming by size control 9393 ( 0.09%) empty read pairs filtered out after trimming by size control 10056866 (99.82%) read pairs available; of these: 5122976 (50.94%) trimmed read pairs available after processing 4933890 (49.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 5 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 2 0.00% 25 4 0.00% 26 11 0.00% 27 2 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 2 0.00% 34 4 0.00% 35 5 0.00% 36 1 0.00% 37 6 0.00% 38 9 0.00% 39 8 0.00% 40 11 0.00% 41 9 0.00% 42 7 0.00% 43 6 0.00% 44 12 0.00% 45 15 0.00% 46 13 0.00% 47 15 0.00% 48 15 0.00% 49 19 0.00% 50 23 0.00% 51 20 0.00% 52 29 0.00% 53 37 0.00% 54 35 0.00% 55 39 0.00% 56 55 0.00% 57 44 0.00% 58 54 0.00% 59 51 0.00% 60 102 0.00% 61 84 0.00% 62 88 0.00% 63 99 0.00% 64 110 0.00% 65 126 0.00% 66 134 0.00% 67 165 0.00% 68 175 0.00% 69 194 0.00% 70 261 0.00% 71 267 0.00% 72 326 0.00% 73 335 0.00% 74 447 0.00% 75 527 0.01% 76 686 0.01% 77 756 0.01% 78 699 0.01% 79 764 0.01% 80 883 0.01% 81 984 0.01% 82 1175 0.01% 83 1402 0.01% 84 2024 0.02% 85 2721 0.03% 86 2941 0.03% 87 3775 0.04% 88 3944 0.04% 89 3883 0.04% 90 4061 0.04% 91 4175 0.04% 92 4599 0.05% 93 4887 0.05% 94 5203 0.05% 95 5535 0.06% 96 5890 0.06% 97 6117 0.06% 98 6716 0.07% 99 7143 0.07% 100 7658 0.08% 101 8249 0.08% 102 8930 0.09% 103 9572 0.10% 104 10054 0.10% 105 10820 0.11% 106 11768 0.12% 107 12596 0.13% 108 13028 0.13% 109 14057 0.14% 110 14901 0.15% 111 15527 0.15% 112 16385 0.16% 113 17578 0.17% 114 19038 0.19% 115 20436 0.20% 116 21022 0.21% 117 21219 0.21% 118 21654 0.22% 119 22510 0.22% 120 23658 0.24% 121 24311 0.24% 122 25510 0.25% 123 26388 0.26% 124 27559 0.27% 125 28479 0.28% 126 29884 0.30% 127 31071 0.31% 128 31665 0.31% 129 32933 0.33% 130 33369 0.33% 131 34941 0.35% 132 36911 0.37% 133 38028 0.38% 134 39564 0.39% 135 41546 0.41% 136 43509 0.43% 137 45141 0.45% 138 47805 0.48% 139 51451 0.51% 140 53587 0.53% 141 57108 0.57% 142 61817 0.61% 143 67354 0.67% 144 75264 0.75% 145 87383 0.87% 146 105254 1.05% 147 137241 1.36% 148 210129 2.09% 149 483030 4.80% 150 2709072 26.94% 151 4933890 49.06% 10056866 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.4 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=126.78 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.4 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=31 prefix-density=0.56 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=20.09 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=3.6 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172683 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:51:30 Started mapping on | Feb 10 13:51:31 Finished on | Feb 10 13:54:10 Mapping speed, Million of reads per hour | 227.70 Number of input reads | 10056866 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8863029 Uniquely mapped reads % | 88.13% Average mapped length | 293.71 Number of splices: Total | 7363719 Number of splices: Annotated (sjdb) | 7204978 Number of splices: GT/AG | 7241994 Number of splices: GC/AG | 91246 Number of splices: AT/AC | 6073 Number of splices: Non-canonical | 24406 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242353 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 20619 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.19% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 960076 960076 960076 N_multimapping 242353 242353 242353 N_noFeature 239459 8756155 270745 N_ambiguous 120302 610 44465 UnstrandedReadsAssigned:8503268 PositiveStrandReadsAssigned:106264 NegativeStrandReadsAssigned:8547819 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172683 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172683-trimmed-pair1.fastq SRR7172683-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,056,866 reads, 8,494,113 reads pseudoaligned [quant] estimated average fragment length: 222.157 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7172683.ke.tsv 34699 SRR7172683.se.tsv 87100 total ==> SRR7172683.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.84 1127 58.4408 Potri.005G024800.1.v4.1 1035 813.843 1019 116.664 Potri.004G059700.1.v4.1 961 739.848 14 1.76315 Potri.007G009000.2.v4.1 1416 1194.84 0 0 Potri.003G141000.2.v4.1 2943 2721.84 468 16.0208 Potri.016G087400.1.v4.1 270 82.8414 637 716.464 Potri.015G069301.1.v4.1 564 344.345 0 0 Potri.010G195200.1.v4.1 1773 1551.84 308 18.4929 Potri.012G127500.1.v4.1 977 755.843 2752 339.249 ==> SRR7172683.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 493 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 80 SRR7172683 completed mapping pipeline successfully