Starting /dee2/code/volunteer_pipeline.sh SRR7172684 current disk space = 3057993396224 free memory = 1484713696 SRR7172684 SRAfilesize 8aa48765fbca0adc583f614ef60f9330 SRR7172684.sra SRR7172684.sra file validated SRR7172684 is paired end SRR7172684 is conventional basespace SRR7172684 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172684_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7165 33.0 32.0 34.0 30.0 34.0 2 32.596 33.0 33.0 34.0 32.0 34.0 3 32.86875 33.0 33.0 34.0 32.0 34.0 4 32.882 33.0 33.0 34.0 32.0 34.0 5 32.9765 33.0 33.0 34.0 32.0 34.0 6 37.11725 38.0 37.0 38.0 36.0 38.0 7 37.41325 38.0 38.0 38.0 37.0 38.0 8 37.56625 38.0 38.0 38.0 38.0 38.0 9 37.6345 38.0 38.0 38.0 38.0 38.0 10-14 37.65425 38.0 38.0 38.0 38.0 38.0 15-19 37.598 38.0 38.0 38.0 38.0 38.0 20-24 37.61125 38.0 38.0 38.0 38.0 38.0 25-29 37.59215 38.0 38.0 38.0 38.0 38.0 30-34 37.5911 38.0 38.0 38.0 38.0 38.0 35-39 37.53895 38.0 38.0 38.0 38.0 38.0 40-44 37.49895 38.0 38.0 38.0 38.0 38.0 45-49 37.376999999999995 38.0 38.0 38.0 37.4 38.0 50-54 37.423700000000004 38.0 38.0 38.0 37.6 38.0 55-59 37.379599999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.287749999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.30735 38.0 38.0 38.0 37.0 38.0 70-74 37.24680000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.1163 38.0 38.0 38.0 36.2 38.0 80-84 37.10065 38.0 38.0 38.0 36.0 38.0 85-89 36.8725 38.0 38.0 38.0 35.4 38.0 90-94 36.8687 38.0 38.0 38.0 35.6 38.0 95-99 36.9306 38.0 38.0 38.0 35.8 38.0 100-104 36.806250000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.59105000000001 38.0 38.0 38.0 34.2 38.0 110-114 36.3951 38.0 38.0 38.0 34.0 38.0 115-119 36.3765 38.0 38.0 38.0 34.0 38.0 120-124 36.23620000000001 38.0 37.8 38.0 33.6 38.0 125-129 35.9781 38.0 37.4 38.0 32.6 38.0 130-134 35.399849999999994 38.0 36.2 38.0 29.4 38.0 135-139 35.23009999999999 38.0 36.0 38.0 28.8 38.0 140-144 35.1199 38.0 36.0 38.0 29.4 38.0 145-149 34.77729999999999 38.0 35.2 38.0 28.4 38.0 150-151 30.71075 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 1.0 23 5.0 24 6.0 25 7.0 26 11.0 27 15.0 28 17.0 29 28.0 30 34.0 31 48.0 32 55.0 33 95.0 34 135.0 35 253.0 36 572.0 37 2705.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.598726114649683 12.45859872611465 14.471337579617835 42.47133757961784 2 20.59192375219463 20.21570102834211 40.35615751191372 18.836217707549537 3 18.65 26.474999999999998 26.3 28.575 4 22.45 34.150000000000006 22.25 21.15 5 21.325 36.449999999999996 23.65 18.575 6 15.1 39.050000000000004 25.15 20.7 7 12.7 20.599999999999998 46.675 20.025000000000002 8 18.825 21.9 30.15 29.125 9 18.475 21.275 32.6 27.650000000000002 10-14 19.33 30.044999999999998 26.779999999999998 23.845 15-19 19.91 27.884999999999998 28.46 23.745 20-24 19.555 28.84 28.28 23.325000000000003 25-29 19.615 28.12 28.255000000000003 24.01 30-34 19.68 29.104999999999997 27.644999999999996 23.57 35-39 19.975 28.655 27.794999999999998 23.575 40-44 19.895 29.29 27.515 23.3 45-49 19.355 28.425 28.355000000000004 23.865 50-54 19.78 28.52 28.275 23.425 55-59 19.759999999999998 28.310000000000002 27.97 23.96 60-64 19.985 28.439999999999998 28.09 23.485 65-69 19.925 28.005000000000003 28.485 23.585 70-74 19.96 28.83 27.48 23.73 75-79 20.375 28.105000000000004 28.125 23.395 80-84 20.325 28.215 28.044999999999998 23.415 85-89 19.79 28.244999999999997 27.825 24.14 90-94 19.82 28.555000000000003 27.415 24.21 95-99 19.994999999999997 28.499999999999996 28.050000000000004 23.455000000000002 100-104 20.165 28.455000000000002 27.96 23.419999999999998 105-109 20.49 28.035 27.894999999999996 23.580000000000002 110-114 20.669133826765353 28.050610122024406 27.880576115223043 23.399679935987198 115-119 20.415 27.834999999999997 27.655 24.095 120-124 20.155 28.205000000000002 28.095 23.544999999999998 125-129 20.585 28.16 27.925 23.330000000000002 130-134 20.549999999999997 27.63 28.060000000000002 23.76 135-139 20.52 27.985 27.534999999999997 23.96 140-144 20.555 28.315 27.98 23.150000000000002 145-149 20.535 28.08 27.82 23.565 150-151 20.4 28.287499999999998 26.9625 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 2.0 24 3.0 25 3.5 26 4.0 27 7.0 28 9.5 29 9.5 30 14.0 31 20.0 32 34.5 33 43.5 34 51.0 35 68.5 36 88.5 37 118.5 38 158.0 39 183.5 40 203.5 41 232.0 42 249.0 43 278.5 44 304.0 45 296.0 46 281.0 47 263.5 48 221.5 49 185.5 50 160.0 51 122.5 52 92.5 53 71.5 54 54.0 55 46.5 56 35.0 57 20.5 58 16.0 59 13.0 60 11.0 61 7.5 62 5.0 63 4.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAATT 10 0.006832588 144.9875 7 >>END_MODULE SRR7172684 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172684_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16825 34.0 33.0 34.0 33.0 34.0 2 33.2285 34.0 33.0 34.0 33.0 34.0 3 33.25675 34.0 33.0 34.0 33.0 34.0 4 33.26175 34.0 33.0 34.0 33.0 34.0 5 33.27025 34.0 33.0 34.0 33.0 34.0 6 37.4005 38.0 38.0 38.0 38.0 38.0 7 37.49925 38.0 38.0 38.0 38.0 38.0 8 37.38925 38.0 38.0 38.0 38.0 38.0 9 37.4295 38.0 38.0 38.0 38.0 38.0 10-14 37.35225 38.0 38.0 38.0 37.6 38.0 15-19 37.412200000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.42905 38.0 38.0 38.0 38.0 38.0 25-29 37.063399999999994 38.0 38.0 38.0 37.4 38.0 30-34 36.322199999999995 38.0 38.0 38.0 36.6 38.0 35-39 36.67165 38.0 38.0 38.0 36.0 38.0 40-44 37.23555 38.0 38.0 38.0 36.8 38.0 45-49 37.246849999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.265499999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.169799999999995 38.0 38.0 38.0 37.0 38.0 60-64 36.9148 38.0 38.0 38.0 35.8 38.0 65-69 36.845549999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.911649999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.90695000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.81165 38.0 38.0 38.0 35.8 38.0 85-89 36.73989999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.6333 38.0 38.0 38.0 34.8 38.0 95-99 36.5795 38.0 38.0 38.0 34.6 38.0 100-104 36.4002 38.0 38.0 38.0 34.0 38.0 105-109 36.2614 38.0 38.0 38.0 34.0 38.0 110-114 36.095 38.0 38.0 38.0 33.2 38.0 115-119 35.92245 38.0 37.2 38.0 33.0 38.0 120-124 35.5216 38.0 37.0 38.0 30.6 38.0 125-129 35.50785 38.0 36.4 38.0 31.0 38.0 130-134 35.18385 38.0 36.0 38.0 29.6 38.0 135-139 34.629000000000005 38.0 35.4 38.0 26.2 38.0 140-144 34.2462 38.0 33.6 38.0 25.6 38.0 145-149 33.142649999999996 38.0 33.0 38.0 17.8 38.0 150-151 28.267000000000003 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 2.0 14 2.0 15 3.0 16 2.0 17 1.0 18 2.0 19 5.0 20 4.0 21 6.0 22 8.0 23 7.0 24 8.0 25 17.0 26 22.0 27 20.0 28 22.0 29 37.0 30 46.0 31 58.0 32 77.0 33 107.0 34 178.0 35 281.0 36 615.0 37 2459.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.15 14.149999999999999 17.9 34.8 2 24.8 22.650000000000002 37.35 15.2 3 20.575 26.3 30.65 22.475 4 23.0 34.525 23.0 19.475 5 24.0 37.574999999999996 22.475 15.950000000000001 6 18.3 38.574999999999996 24.224999999999998 18.9 7 16.35 17.1 44.45 22.1 8 20.525 22.05 29.099999999999998 28.325 9 21.975 24.099999999999998 28.375 25.55 10-14 22.759999999999998 29.085 26.865 21.29 15-19 22.85 27.96 28.144999999999996 21.044999999999998 20-24 22.55 28.42 27.950000000000003 21.08 25-29 22.22670025188917 28.20654911838791 28.362720403022667 21.20403022670025 30-34 22.29302636312246 27.82260136697672 28.68081607482399 21.20355619507683 35-39 22.93545445333874 27.637045293342787 28.14368223730874 21.28381801600973 40-44 23.0 28.005000000000003 28.025 20.97 45-49 22.689999999999998 28.485 28.199999999999996 20.625 50-54 22.895 28.715000000000003 27.79 20.599999999999998 55-59 22.685 28.084999999999997 28.244999999999997 20.985 60-64 23.535 27.82 28.044999999999998 20.599999999999998 65-69 23.315 28.205000000000002 28.349999999999998 20.13 70-74 23.294999999999998 28.155 28.015 20.535 75-79 23.7 28.23 27.76 20.31 80-84 22.89 28.12 27.805000000000003 21.185000000000002 85-89 23.375 27.634999999999998 28.285 20.705000000000002 90-94 23.36 28.249999999999996 27.779999999999998 20.61 95-99 23.494999999999997 28.060000000000002 28.055000000000003 20.39 100-104 24.015 28.055000000000003 27.46 20.47 105-109 23.9 27.67 27.834999999999997 20.595 110-114 23.64 28.335 27.860000000000003 20.165 115-119 23.369999999999997 28.08 28.249999999999996 20.3 120-124 23.485 28.084999999999997 28.12 20.31 125-129 23.34 28.015 28.310000000000002 20.335 130-134 23.89 28.439999999999998 27.82 19.85 135-139 23.615 28.185 28.18 20.02 140-144 24.4 28.255000000000003 27.52 19.825 145-149 24.345 28.610000000000003 26.735 20.31 150-151 24.212500000000002 28.3375 28.037499999999998 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 3.0 27 3.5 28 7.0 29 7.5 30 9.5 31 16.0 32 22.5 33 33.0 34 52.5 35 70.0 36 88.0 37 121.5 38 164.0 39 183.5 40 201.0 41 245.0 42 279.0 43 289.0 44 301.5 45 287.5 46 254.5 47 238.5 48 221.0 49 191.0 50 148.5 51 123.0 52 99.5 53 78.0 54 70.0 55 54.5 56 38.5 57 26.5 58 17.5 59 13.0 60 10.0 61 8.0 62 5.5 63 3.5 64 3.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.75 30-34 2.705 35-39 1.31 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAAAT 10 0.0068803662 144.65 8 GTCGAAG 10 0.0068803662 144.65 145 AGAAATG 10 0.0068803662 144.65 9 >>END_MODULE Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740831 spots for SRR7172684.sra Written 740831 spots for SRR7172684.sra Read 740839 spots for SRR7172684.sra Written 740839 spots for SRR7172684.sra SRR ids: ['SRR7172684.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j3agkxaw SRR7172684.sra spots: 14816628 blocks: [[1, 740831], [740832, 1481662], [1481663, 2222493], [2222494, 2963324], [2963325, 3704155], [3704156, 4444986], [4444987, 5185817], [5185818, 5926648], [5926649, 6667479], [6667480, 7408310], [7408311, 8149141], [8149142, 8889972], [8889973, 9630803], [9630804, 10371634], [10371635, 11112465], [11112466, 11853296], [11853297, 12594127], [12594128, 13334958], [13334959, 14075789], [14075790, 14816628]] SRR7172684 file size 4999168 SRR7172684 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172684 SRR7172684_1.fastq SRR7172684_2.fastq Input file: SRR7172684_1.fastq Paired file: SRR7172684_2.fastq trimmed: SRR7172684-trimmed-pair1.fastq, SRR7172684-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:35:18 2025 >> started Mon Feb 10 17:35:38 2025 >> done (19.754s) 14816628 read pairs processed; of these: 8520 ( 0.06%) short read pairs filtered out after trimming by size control 6341 ( 0.04%) empty read pairs filtered out after trimming by size control 14801767 (99.90%) read pairs available; of these: 7338695 (49.58%) trimmed read pairs available after processing 7463072 (50.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 5 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 1 0.00% 36 0 0.00% 37 2 0.00% 38 4 0.00% 39 1 0.00% 40 1 0.00% 41 3 0.00% 42 3 0.00% 43 4 0.00% 44 5 0.00% 45 5 0.00% 46 14 0.00% 47 6 0.00% 48 7 0.00% 49 10 0.00% 50 17 0.00% 51 12 0.00% 52 17 0.00% 53 15 0.00% 54 10 0.00% 55 24 0.00% 56 17 0.00% 57 31 0.00% 58 33 0.00% 59 28 0.00% 60 30 0.00% 61 36 0.00% 62 41 0.00% 63 42 0.00% 64 64 0.00% 65 86 0.00% 66 87 0.00% 67 90 0.00% 68 100 0.00% 69 113 0.00% 70 132 0.00% 71 142 0.00% 72 196 0.00% 73 202 0.00% 74 254 0.00% 75 260 0.00% 76 359 0.00% 77 355 0.00% 78 356 0.00% 79 428 0.00% 80 526 0.00% 81 585 0.00% 82 646 0.00% 83 787 0.01% 84 1348 0.01% 85 1585 0.01% 86 1872 0.01% 87 2083 0.01% 88 2140 0.01% 89 2271 0.02% 90 2317 0.02% 91 2611 0.02% 92 2810 0.02% 93 2999 0.02% 94 3257 0.02% 95 3369 0.02% 96 3678 0.02% 97 3955 0.03% 98 4244 0.03% 99 4547 0.03% 100 4988 0.03% 101 5387 0.04% 102 5744 0.04% 103 6075 0.04% 104 6659 0.04% 105 7358 0.05% 106 7708 0.05% 107 8170 0.06% 108 8643 0.06% 109 9240 0.06% 110 9807 0.07% 111 10581 0.07% 112 11208 0.08% 113 11890 0.08% 114 12817 0.09% 115 13505 0.09% 116 14180 0.10% 117 14969 0.10% 118 15542 0.11% 119 16628 0.11% 120 17054 0.12% 121 18344 0.12% 122 19399 0.13% 123 20564 0.14% 124 21609 0.15% 125 22553 0.15% 126 23928 0.16% 127 25668 0.17% 128 26685 0.18% 129 27931 0.19% 130 29551 0.20% 131 31353 0.21% 132 33460 0.23% 133 35211 0.24% 134 37229 0.25% 135 40221 0.27% 136 42672 0.29% 137 45785 0.31% 138 48984 0.33% 139 53090 0.36% 140 58430 0.39% 141 65053 0.44% 142 71950 0.49% 143 80475 0.54% 144 93601 0.63% 145 113516 0.77% 146 143190 0.97% 147 196443 1.33% 148 313139 2.12% 149 794815 5.37% 150 4534388 30.63% 151 7463072 50.42% 14801767 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=19.29 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.9 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTTTCC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=30.60 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.0 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172684 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:36:30 Started mapping on | Feb 10 17:36:31 Finished on | Feb 10 17:38:25 Mapping speed, Million of reads per hour | 467.42 Number of input reads | 14801767 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14027999 Uniquely mapped reads % | 94.77% Average mapped length | 296.73 Number of splices: Total | 14380167 Number of splices: Annotated (sjdb) | 14119807 Number of splices: GT/AG | 14153252 Number of splices: GC/AG | 180562 Number of splices: AT/AC | 10696 Number of splices: Non-canonical | 35657 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412002 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 26403 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 370987 370987 370987 N_multimapping 412002 412002 412002 N_noFeature 353889 13908872 399396 N_ambiguous 146435 1017 72275 UnstrandedReadsAssigned:13527675 PositiveStrandReadsAssigned:118110 NegativeStrandReadsAssigned:13556328 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172684 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172684-trimmed-pair1.fastq SRR7172684-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,801,767 reads, 13,464,304 reads pseudoaligned [quant] estimated average fragment length: 256.563 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR7172684.ke.tsv 34699 SRR7172684.se.tsv 87100 total ==> SRR7172684.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.44 1050 41.1516 Potri.005G024800.1.v4.1 1035 779.437 405 35.891 Potri.004G059700.1.v4.1 961 705.475 153 14.9803 Potri.007G009000.2.v4.1 1416 1160.44 0 0 Potri.003G141000.2.v4.1 2943 2687.44 533 13.6994 Potri.016G087400.1.v4.1 270 72.1463 1040 995.705 Potri.015G069301.1.v4.1 564 314.545 0 0 Potri.010G195200.1.v4.1 1773 1517.44 165 7.51077 Potri.012G127500.1.v4.1 977 721.463 3740 358.071 ==> SRR7172684.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 398 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 494 SRR7172684 completed mapping pipeline successfully