Starting /dee2/code/volunteer_pipeline.sh SRR7172685 current disk space = 3057612652544 free memory = 1579839228 SRR7172685 SRAfilesize 1b1ef4a12952f35b9f993e785b55e345 SRR7172685.sra SRR7172685.sra file validated SRR7172685 is paired end SRR7172685 is conventional basespace SRR7172685 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172685_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.0255 31.0 18.0 32.0 18.0 33.0 2 29.4835 31.0 29.0 33.0 18.0 33.0 3 31.44775 33.0 31.0 33.0 28.0 33.0 4 31.54825 33.0 31.0 33.0 29.0 34.0 5 32.51575 33.0 33.0 33.0 32.0 34.0 6 37.152 38.0 37.0 38.0 36.0 38.0 7 37.50825 38.0 38.0 38.0 37.0 38.0 8 37.55125 38.0 38.0 38.0 38.0 38.0 9 37.61075 38.0 38.0 38.0 38.0 38.0 10-14 37.590149999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.5561 38.0 38.0 38.0 38.0 38.0 20-24 37.58175 38.0 38.0 38.0 38.0 38.0 25-29 37.58865 38.0 38.0 38.0 38.0 38.0 30-34 37.62065 38.0 38.0 38.0 38.0 38.0 35-39 37.522850000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.37859999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.411699999999996 38.0 38.0 38.0 37.2 38.0 50-54 37.36275 38.0 38.0 38.0 37.0 38.0 55-59 37.3293 38.0 38.0 38.0 37.0 38.0 60-64 37.2796 38.0 38.0 38.0 36.8 38.0 65-69 37.1914 38.0 38.0 38.0 36.8 38.0 70-74 37.14625000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.074299999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.00815 38.0 38.0 38.0 36.0 38.0 85-89 36.9206 38.0 38.0 38.0 35.6 38.0 90-94 36.859899999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.8169 38.0 38.0 38.0 35.2 38.0 100-104 36.76565 38.0 38.0 38.0 35.0 38.0 105-109 36.49525 38.0 38.0 38.0 34.0 38.0 110-114 36.29559999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.38244999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.25345 38.0 37.2 38.0 33.6 38.0 125-129 35.88245 38.0 36.8 38.0 32.2 38.0 130-134 35.099 38.0 35.6 38.0 28.6 38.0 135-139 35.07415 38.0 35.6 38.0 28.0 38.0 140-144 34.961800000000004 38.0 35.0 38.0 28.2 38.0 145-149 34.41395 38.0 35.0 38.0 26.2 38.0 150-151 30.810000000000002 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 4.0 22 2.0 23 7.0 24 7.0 25 7.0 26 15.0 27 22.0 28 24.0 29 24.0 30 38.0 31 44.0 32 69.0 33 85.0 34 162.0 35 291.0 36 706.0 37 2490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.658847526772057 15.01784803671596 13.411524732279451 42.911779704232536 2 19.044025157232706 20.67924528301887 39.37106918238994 20.90566037735849 3 19.225 25.674999999999997 25.6 29.5 4 22.95 35.125 20.674999999999997 21.25 5 21.775 36.575 24.05 17.599999999999998 6 15.975 37.3 25.724999999999998 21.0 7 13.625000000000002 20.525 46.050000000000004 19.8 8 17.0 21.65 31.75 29.599999999999998 9 18.7 21.4 33.650000000000006 26.25 10-14 19.88 29.585 26.939999999999998 23.595 15-19 19.42 28.535 27.97 24.075 20-24 19.715 29.409999999999997 27.250000000000004 23.625 25-29 19.62 28.63 28.27 23.48 30-34 19.220000000000002 28.965000000000003 27.950000000000003 23.865 35-39 19.775000000000002 28.360000000000003 28.115000000000002 23.75 40-44 19.505 28.87 27.889999999999997 23.735 45-49 20.115 28.725 27.450000000000003 23.71 50-54 19.99 27.985 28.139999999999997 23.885 55-59 20.015 28.265 28.04 23.68 60-64 20.18 28.165000000000003 27.755000000000003 23.9 65-69 19.830000000000002 28.265 28.305000000000003 23.599999999999998 70-74 20.43 28.035 27.985 23.549999999999997 75-79 20.185 28.79 27.455000000000002 23.57 80-84 20.794999999999998 28.275 27.694999999999997 23.235 85-89 20.825 28.044999999999998 27.67 23.46 90-94 20.5 28.175 27.68 23.645 95-99 20.45 27.589999999999996 28.67 23.29 100-104 20.315 27.889999999999997 28.215 23.580000000000002 105-109 19.96 28.76 27.57 23.71 110-114 20.345 27.775 28.000000000000004 23.880000000000003 115-119 20.375 28.465 28.17 22.99 120-124 19.88 27.83 28.28 24.01 125-129 20.405 28.349999999999998 27.860000000000003 23.385 130-134 20.71 28.64 27.46 23.189999999999998 135-139 21.115000000000002 28.110000000000003 27.13 23.645 140-144 20.89 28.449999999999996 27.01 23.65 145-149 21.185000000000002 28.51 26.93 23.375 150-151 20.5375 28.3625 27.575 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 2.5 25 2.5 26 3.0 27 7.5 28 10.0 29 12.5 30 21.5 31 25.0 32 27.0 33 44.0 34 57.0 35 65.0 36 81.0 37 111.5 38 137.0 39 172.5 40 212.0 41 229.5 42 264.0 43 290.0 44 283.5 45 281.0 46 269.5 47 255.0 48 228.5 49 188.0 50 166.0 51 131.0 52 98.5 53 81.0 54 64.0 55 43.5 56 34.5 57 29.5 58 20.5 59 15.5 60 9.0 61 6.0 62 5.0 63 5.0 64 2.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.7999999999999998 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5875 0.0125 0.0 0.0 0.0 138-139 3.9250000000000003 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172685 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172685_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0795 34.0 33.0 34.0 32.0 34.0 2 33.12875 34.0 33.0 34.0 33.0 34.0 3 33.1695 34.0 33.0 34.0 33.0 34.0 4 33.13175 34.0 33.0 34.0 33.0 34.0 5 33.1215 34.0 33.0 34.0 33.0 34.0 6 37.2575 38.0 38.0 38.0 37.0 38.0 7 37.24975 38.0 38.0 38.0 37.0 38.0 8 37.309 38.0 38.0 38.0 37.0 38.0 9 37.241 38.0 38.0 38.0 37.0 38.0 10-14 37.23565 38.0 38.0 38.0 37.0 38.0 15-19 37.2834 38.0 38.0 38.0 37.0 38.0 20-24 37.28750000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.1119 38.0 38.0 38.0 37.0 38.0 30-34 36.654450000000004 38.0 38.0 38.0 36.4 38.0 35-39 36.8153 38.0 38.0 38.0 35.8 38.0 40-44 37.0531 38.0 38.0 38.0 36.4 38.0 45-49 37.13125 38.0 38.0 38.0 36.8 38.0 50-54 37.10325 38.0 38.0 38.0 36.6 38.0 55-59 37.0243 38.0 38.0 38.0 36.4 38.0 60-64 36.83729999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.72925 38.0 38.0 38.0 35.8 38.0 70-74 36.6863 38.0 38.0 38.0 35.0 38.0 75-79 36.5918 38.0 38.0 38.0 34.4 38.0 80-84 36.479 38.0 38.0 38.0 34.0 38.0 85-89 36.433 38.0 38.0 38.0 34.0 38.0 90-94 36.38205000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.3068 38.0 38.0 38.0 34.0 38.0 100-104 36.2596 38.0 38.0 38.0 34.0 38.0 105-109 36.132349999999995 38.0 37.8 38.0 33.6 38.0 110-114 35.96205 38.0 37.6 38.0 32.6 38.0 115-119 35.628150000000005 38.0 37.0 38.0 31.0 38.0 120-124 35.5161 38.0 36.6 38.0 30.6 38.0 125-129 35.17015 38.0 36.0 38.0 29.0 38.0 130-134 34.67945 38.0 35.2 38.0 26.4 38.0 135-139 34.333299999999994 38.0 33.8 38.0 25.6 38.0 140-144 33.75445 38.0 33.0 38.0 21.6 38.0 145-149 32.5949 38.0 33.0 38.0 11.6 38.0 150-151 28.014625000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 3.0 7 0.0 8 1.0 9 3.0 10 0.0 11 1.0 12 4.0 13 1.0 14 3.0 15 3.0 16 2.0 17 3.0 18 5.0 19 2.0 20 7.0 21 3.0 22 10.0 23 12.0 24 15.0 25 15.0 26 16.0 27 25.0 28 34.0 29 37.0 30 42.0 31 63.0 32 90.0 33 123.0 34 175.0 35 293.0 36 655.0 37 2349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.175 14.099999999999998 18.45 35.275 2 23.75 23.325000000000003 37.0 15.925 3 20.3 26.1 31.175000000000004 22.425 4 22.275 34.9 22.775000000000002 20.05 5 24.425 36.9 22.475 16.2 6 18.0 38.800000000000004 24.4 18.8 7 18.35 16.55 43.5 21.6 8 19.900000000000002 21.2 29.299999999999997 29.599999999999998 9 21.875 24.0 30.425 23.7 10-14 22.509999999999998 29.03 26.650000000000002 21.81 15-19 22.445 28.305000000000003 27.655 21.595 20-24 22.98 27.855 27.99 21.175 25-29 22.407825432656132 28.201655379984953 28.276899924755455 21.11361926260346 30-34 22.676693257456428 28.01178801890148 28.174381383059803 21.13713734058229 35-39 22.55809274720853 28.392515843476513 27.970023136505382 21.079368272809575 40-44 22.8 28.08 27.955000000000002 21.165 45-49 22.939999999999998 28.34 27.775 20.945 50-54 23.16 27.83 28.37 20.64 55-59 22.545 28.33 28.185 20.94 60-64 23.055 28.449999999999996 27.955000000000002 20.54 65-69 23.345 28.244999999999997 28.565 19.845 70-74 24.05 27.495000000000005 28.275 20.18 75-79 23.27 28.23 27.775 20.724999999999998 80-84 23.535 28.17 27.815 20.48 85-89 23.78 27.77 27.91 20.54 90-94 22.900000000000002 28.225 28.075 20.8 95-99 22.98 28.315 28.215 20.49 100-104 23.825 27.675 27.625 20.875 105-109 23.794999999999998 27.85 28.595 19.759999999999998 110-114 23.835 28.09 27.775 20.3 115-119 23.77 28.615000000000002 27.245 20.369999999999997 120-124 23.24 28.29 28.005000000000003 20.465 125-129 24.044999999999998 27.755000000000003 28.035 20.165 130-134 23.785 28.77 27.265 20.18 135-139 23.655 28.22 27.49 20.635 140-144 24.57 28.18 27.265 19.985 145-149 24.45 28.63 27.08 19.84 150-151 24.3125 27.224999999999998 28.287499999999998 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.0 26 3.0 27 5.0 28 5.5 29 9.5 30 14.5 31 16.0 32 23.5 33 36.5 34 46.0 35 64.0 36 89.5 37 110.0 38 138.5 39 179.5 40 214.0 41 233.5 42 267.0 43 298.0 44 296.0 45 281.5 46 270.0 47 248.5 48 231.5 49 203.0 50 171.0 51 139.5 52 92.0 53 71.0 54 62.5 55 45.5 56 34.0 57 29.0 58 19.0 59 16.5 60 13.0 61 6.0 62 3.0 63 1.0 64 1.0 65 0.5 66 1.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.325 30-34 1.595 35-39 0.59 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.25 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.75 0.0 0.0 0.0 0.0 128-129 2.0999999999999996 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724395 spots for SRR7172685.sra Written 724395 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra Read 724377 spots for SRR7172685.sra Written 724377 spots for SRR7172685.sra SRR ids: ['SRR7172685.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mpkk99pg SRR7172685.sra spots: 14487558 blocks: [[1, 724377], [724378, 1448754], [1448755, 2173131], [2173132, 2897508], [2897509, 3621885], [3621886, 4346262], [4346263, 5070639], [5070640, 5795016], [5795017, 6519393], [6519394, 7243770], [7243771, 7968147], [7968148, 8692524], [8692525, 9416901], [9416902, 10141278], [10141279, 10865655], [10865656, 11590032], [11590033, 12314409], [12314410, 13038786], [13038787, 13763163], [13763164, 14487558]] SRR7172685 file size 4887657 SRR7172685 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172685 SRR7172685_1.fastq SRR7172685_2.fastq Input file: SRR7172685_1.fastq Paired file: SRR7172685_2.fastq trimmed: SRR7172685-trimmed-pair1.fastq, SRR7172685-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:22:22 2025 >> started Mon Feb 10 18:22:37 2025 >> done (15.037s) 14487558 read pairs processed; of these: 7515 ( 0.05%) short read pairs filtered out after trimming by size control 5116 ( 0.04%) empty read pairs filtered out after trimming by size control 14474927 (99.91%) read pairs available; of these: 5687605 (39.29%) trimmed read pairs available after processing 8787322 (60.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 3 0.00% 36 1 0.00% 37 4 0.00% 38 0 0.00% 39 1 0.00% 40 6 0.00% 41 4 0.00% 42 2 0.00% 43 7 0.00% 44 0 0.00% 45 7 0.00% 46 4 0.00% 47 6 0.00% 48 8 0.00% 49 9 0.00% 50 10 0.00% 51 12 0.00% 52 15 0.00% 53 15 0.00% 54 16 0.00% 55 22 0.00% 56 26 0.00% 57 33 0.00% 58 34 0.00% 59 35 0.00% 60 23 0.00% 61 46 0.00% 62 68 0.00% 63 47 0.00% 64 61 0.00% 65 74 0.00% 66 90 0.00% 67 95 0.00% 68 123 0.00% 69 128 0.00% 70 131 0.00% 71 143 0.00% 72 186 0.00% 73 205 0.00% 74 255 0.00% 75 237 0.00% 76 338 0.00% 77 377 0.00% 78 411 0.00% 79 475 0.00% 80 514 0.00% 81 630 0.00% 82 715 0.00% 83 760 0.01% 84 1326 0.01% 85 1646 0.01% 86 1882 0.01% 87 1958 0.01% 88 2116 0.01% 89 2183 0.02% 90 2387 0.02% 91 2600 0.02% 92 2805 0.02% 93 2953 0.02% 94 3199 0.02% 95 3474 0.02% 96 3707 0.03% 97 4086 0.03% 98 4376 0.03% 99 4669 0.03% 100 5046 0.03% 101 5553 0.04% 102 5947 0.04% 103 6565 0.05% 104 6965 0.05% 105 7297 0.05% 106 7963 0.06% 107 8513 0.06% 108 8823 0.06% 109 9703 0.07% 110 10365 0.07% 111 10779 0.07% 112 11426 0.08% 113 12382 0.09% 114 13339 0.09% 115 14151 0.10% 116 14877 0.10% 117 15776 0.11% 118 16756 0.12% 119 17177 0.12% 120 17984 0.12% 121 19049 0.13% 122 19805 0.14% 123 21342 0.15% 124 22023 0.15% 125 23476 0.16% 126 24535 0.17% 127 26007 0.18% 128 27164 0.19% 129 28994 0.20% 130 29959 0.21% 131 31909 0.22% 132 33849 0.23% 133 36138 0.25% 134 38096 0.26% 135 40864 0.28% 136 43554 0.30% 137 46127 0.32% 138 49701 0.34% 139 53608 0.37% 140 58359 0.40% 141 64293 0.44% 142 71220 0.49% 143 79860 0.55% 144 92627 0.64% 145 110624 0.76% 146 138085 0.95% 147 186794 1.29% 148 281801 1.95% 149 568151 3.93% 150 3140400 21.70% 151 8787322 60.71% 14474927 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=180.31 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=22.6 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=37.98 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=5.0 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172685 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:23:26 Started mapping on | Feb 10 18:23:26 Finished on | Feb 10 18:25:05 Mapping speed, Million of reads per hour | 526.36 Number of input reads | 14474927 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13803004 Uniquely mapped reads % | 95.36% Average mapped length | 296.82 Number of splices: Total | 14165648 Number of splices: Annotated (sjdb) | 13921115 Number of splices: GT/AG | 13940058 Number of splices: GC/AG | 181672 Number of splices: AT/AC | 10724 Number of splices: Non-canonical | 33194 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324180 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 33619 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 355660 355660 355660 N_multimapping 324180 324180 324180 N_noFeature 327075 13692754 374138 N_ambiguous 133780 1274 69690 UnstrandedReadsAssigned:13342149 PositiveStrandReadsAssigned:108976 NegativeStrandReadsAssigned:13359176 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172685 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172685-trimmed-pair1.fastq SRR7172685-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,474,927 reads, 13,227,129 reads pseudoaligned [quant] estimated average fragment length: 253.49 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7172685.ke.tsv 34699 SRR7172685.se.tsv 87100 total ==> SRR7172685.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.51 990 42.592 Potri.005G024800.1.v4.1 1035 782.51 292 28.3437 Potri.004G059700.1.v4.1 961 708.538 38 4.07365 Potri.007G009000.2.v4.1 1416 1163.51 0 0 Potri.003G141000.2.v4.1 2943 2690.51 637.173 17.9881 Potri.016G087400.1.v4.1 270 73.129 1040.84 1081.08 Potri.015G069301.1.v4.1 564 316.794 0 0 Potri.010G195200.1.v4.1 1773 1520.51 118.739 5.93152 Potri.012G127500.1.v4.1 977 724.524 2304 241.542 ==> SRR7172685.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 119 SRR7172685 completed mapping pipeline successfully