Starting /dee2/code/volunteer_pipeline.sh SRR7172686 current disk space = 3058100060160 free memory = 1256931112 SRR7172686 SRAfilesize 751cb94bc188d4d7510a6bf6da48e979 SRR7172686.sra SRR7172686.sra file validated SRR7172686 is paired end SRR7172686 is conventional basespace SRR7172686 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172686_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.986 25.0 18.0 32.0 18.0 32.0 2 22.33275 18.0 18.0 27.0 18.0 31.0 3 26.72225 27.0 25.0 32.0 18.0 32.0 4 28.5695 32.0 27.0 32.0 15.0 33.0 5 30.6385 32.0 31.0 33.0 27.0 33.0 6 36.57675 38.0 37.0 38.0 34.0 38.0 7 37.3045 38.0 38.0 38.0 36.0 38.0 8 37.446 38.0 38.0 38.0 37.0 38.0 9 37.388 38.0 38.0 38.0 37.0 38.0 10-14 37.49875 38.0 38.0 38.0 37.4 38.0 15-19 37.49585 38.0 38.0 38.0 38.0 38.0 20-24 37.4988 38.0 38.0 38.0 37.8 38.0 25-29 37.5156 38.0 38.0 38.0 38.0 38.0 30-34 37.49095 38.0 38.0 38.0 37.8 38.0 35-39 37.43335 38.0 38.0 38.0 37.4 38.0 40-44 37.39095 38.0 38.0 38.0 37.0 38.0 45-49 37.3277 38.0 38.0 38.0 37.0 38.0 50-54 37.2186 38.0 38.0 38.0 37.0 38.0 55-59 37.19279999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.16244999999999 38.0 38.0 38.0 36.4 38.0 65-69 37.0876 38.0 38.0 38.0 36.0 38.0 70-74 37.072900000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9072 38.0 38.0 38.0 35.2 38.0 80-84 36.784299999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.661199999999994 38.0 38.0 38.0 34.8 38.0 90-94 36.7372 38.0 38.0 38.0 35.0 38.0 95-99 36.7561 38.0 38.0 38.0 35.0 38.0 100-104 36.52645 38.0 38.0 38.0 34.2 38.0 105-109 36.14205 38.0 37.6 38.0 33.2 38.0 110-114 35.90259999999999 38.0 37.0 38.0 32.6 38.0 115-119 35.9809 38.0 37.0 38.0 33.0 38.0 120-124 35.826350000000005 38.0 36.8 38.0 31.8 38.0 125-129 35.4173 38.0 36.0 38.0 30.6 38.0 130-134 34.84255 38.0 35.4 38.0 26.6 38.0 135-139 34.5895 38.0 35.0 38.0 25.4 38.0 140-144 34.42275000000001 38.0 35.0 38.0 24.6 38.0 145-149 34.14919999999999 38.0 35.0 38.0 24.2 38.0 150-151 30.002375 36.0 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 1.0 19 3.0 20 2.0 21 3.0 22 4.0 23 6.0 24 8.0 25 16.0 26 8.0 27 23.0 28 33.0 29 29.0 30 44.0 31 55.0 32 88.0 33 122.0 34 208.0 35 330.0 36 898.0 37 2112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.08320571720265 11.25574272588055 12.429811128126596 33.2312404287902 2 25.4326561324304 15.701028342111863 38.650614497115626 20.21570102834211 3 20.375 23.35 27.450000000000003 28.825 4 23.225 30.475 22.6 23.7 5 23.525 32.324999999999996 25.4 18.75 6 18.275 36.05 24.625 21.05 7 13.4 21.625 45.85 19.125 8 19.025 23.3 29.25 28.425 9 17.724999999999998 22.225 33.050000000000004 27.0 10-14 20.335 28.89 26.895000000000003 23.880000000000003 15-19 20.135 27.894999999999996 28.38 23.59 20-24 19.919999999999998 28.315 28.32 23.445 25-29 20.44 28.194999999999997 27.865000000000002 23.5 30-34 19.830000000000002 28.42 28.044999999999998 23.705000000000002 35-39 20.515 27.544999999999998 27.939999999999998 24.0 40-44 20.18 28.48 27.63 23.71 45-49 20.28 28.27 27.595 23.855 50-54 19.965 28.425 27.925 23.685000000000002 55-59 20.155 28.16 28.084999999999997 23.599999999999998 60-64 19.935 28.299999999999997 27.375 24.39 65-69 19.975 28.660000000000004 27.644999999999996 23.72 70-74 20.27 28.15 27.77 23.810000000000002 75-79 20.375 27.24 28.610000000000003 23.775 80-84 19.915 28.084999999999997 27.925 24.075 85-89 20.32 28.165000000000003 28.27 23.244999999999997 90-94 20.165 27.42 28.505000000000003 23.91 95-99 20.4 28.335 27.644999999999996 23.62 100-104 20.745 28.12 27.694999999999997 23.44 105-109 20.305 27.584999999999997 28.43 23.68 110-114 20.49 27.584999999999997 28.349999999999998 23.575 115-119 20.965 27.400000000000002 27.884999999999998 23.75 120-124 21.035 26.895000000000003 28.194999999999997 23.875 125-129 20.91 27.560000000000002 28.044999999999998 23.485 130-134 20.73 27.68 28.16 23.43 135-139 21.36 27.435 27.779999999999998 23.425 140-144 21.044999999999998 27.779999999999998 27.750000000000004 23.425 145-149 21.085 27.73 27.27 23.915 150-151 20.925 27.1 28.3875 23.5875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.5 25 4.0 26 2.0 27 2.0 28 3.5 29 8.5 30 11.5 31 15.0 32 22.5 33 28.5 34 41.0 35 63.0 36 77.5 37 104.0 38 137.5 39 157.0 40 200.0 41 260.5 42 279.0 43 264.0 44 275.5 45 293.5 46 294.5 47 266.5 48 215.0 49 183.5 50 164.0 51 138.0 52 120.5 53 100.0 54 75.0 55 55.5 56 33.5 57 26.0 58 24.5 59 13.5 60 6.0 61 5.0 62 4.5 63 3.5 64 3.0 65 3.0 66 3.0 67 2.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9874999999999999 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCAGT 10 0.006836113 144.9625 9 >>END_MODULE SRR7172686 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172686_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87175 33.0 33.0 34.0 32.0 34.0 2 32.953 34.0 33.0 34.0 32.0 34.0 3 32.9395 34.0 33.0 34.0 32.0 34.0 4 32.89275 34.0 33.0 34.0 32.0 34.0 5 32.82025 34.0 33.0 34.0 32.0 34.0 6 37.0185 38.0 38.0 38.0 37.0 38.0 7 37.10125 38.0 38.0 38.0 37.0 38.0 8 37.10225 38.0 38.0 38.0 37.0 38.0 9 37.05 38.0 38.0 38.0 37.0 38.0 10-14 36.947399999999995 38.0 38.0 38.0 36.4 38.0 15-19 36.94019999999999 38.0 38.0 38.0 36.6 38.0 20-24 36.96015 38.0 38.0 38.0 36.4 38.0 25-29 36.77034999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.27525 38.0 38.0 38.0 35.4 38.0 35-39 36.448299999999996 38.0 38.0 38.0 35.2 38.0 40-44 36.764199999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.73275 38.0 38.0 38.0 36.0 38.0 50-54 36.693 38.0 38.0 38.0 36.0 38.0 55-59 36.570499999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.36105 38.0 38.0 38.0 34.2 38.0 65-69 36.1117 38.0 38.0 38.0 33.4 38.0 70-74 36.196299999999994 38.0 38.0 38.0 33.6 38.0 75-79 36.19295000000001 38.0 38.0 38.0 33.8 38.0 80-84 36.13775 38.0 38.0 38.0 33.8 38.0 85-89 36.06179999999999 38.0 38.0 38.0 33.6 38.0 90-94 36.078050000000005 38.0 38.0 38.0 33.8 38.0 95-99 35.97795 38.0 38.0 38.0 33.2 38.0 100-104 35.753 38.0 37.6 38.0 32.0 38.0 105-109 35.57775 38.0 37.0 38.0 31.0 38.0 110-114 35.41015 38.0 37.0 38.0 29.8 38.0 115-119 35.20525 38.0 36.8 38.0 29.0 38.0 120-124 34.915299999999995 38.0 36.0 38.0 27.8 38.0 125-129 34.51955 38.0 35.6 38.0 25.4 38.0 130-134 34.034000000000006 38.0 35.0 38.0 23.0 38.0 135-139 33.7142 38.0 34.0 38.0 21.8 38.0 140-144 33.372150000000005 38.0 33.0 38.0 18.0 38.0 145-149 32.122699999999995 38.0 32.6 38.0 10.8 38.0 150-151 27.706000000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 7.0 5 4.0 6 1.0 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 4.0 13 3.0 14 9.0 15 2.0 16 2.0 17 8.0 18 6.0 19 7.0 20 9.0 21 15.0 22 10.0 23 10.0 24 12.0 25 23.0 26 20.0 27 36.0 28 40.0 29 53.0 30 61.0 31 75.0 32 84.0 33 91.0 34 190.0 35 306.0 36 608.0 37 2283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.725 18.3 17.849999999999998 29.125 2 24.25 24.8 33.550000000000004 17.4 3 19.950000000000003 28.249999999999996 30.725 21.075 4 24.25 33.7 22.900000000000002 19.15 5 23.775 37.275000000000006 21.25 17.7 6 19.15 38.15 23.25 19.45 7 17.7 18.925 41.5 21.875 8 20.9 23.474999999999998 26.474999999999998 29.15 9 22.0 24.9 29.4 23.7 10-14 23.080000000000002 28.765 26.1 22.055 15-19 23.13 28.194999999999997 27.415 21.26 20-24 23.465 28.435 27.18 20.919999999999998 25-29 23.078851070229085 28.19188931776029 27.37480575467442 21.35445385733621 30-34 22.80434561884455 28.236369174535486 27.469793887704334 21.489491318915626 35-39 23.051000905341514 28.362337792978575 27.587767830198167 20.998893471481743 40-44 22.384999999999998 28.365000000000002 28.335 20.915 45-49 23.605 27.215 28.055000000000003 21.125 50-54 23.26 28.01 27.915 20.815 55-59 23.05 28.23 27.584999999999997 21.135 60-64 23.06 28.715000000000003 27.96 20.265 65-69 23.385 28.4 27.365000000000002 20.849999999999998 70-74 23.25 28.134999999999998 28.01 20.605 75-79 23.205000000000002 28.389999999999997 27.639999999999997 20.765 80-84 23.62 28.13 27.084999999999997 21.165 85-89 23.685000000000002 28.244999999999997 28.01 20.06 90-94 23.36 28.23 27.389999999999997 21.02 95-99 23.835 27.644999999999996 27.839999999999996 20.68 100-104 23.474999999999998 28.595 27.785 20.145 105-109 24.415 28.610000000000003 26.51 20.465 110-114 24.104999999999997 28.24 27.29 20.365 115-119 24.43 28.050000000000004 28.165000000000003 19.355 120-124 23.915 27.87 27.51 20.705000000000002 125-129 24.08 28.265 26.845000000000002 20.810000000000002 130-134 24.060000000000002 28.08 27.525 20.335 135-139 23.96 27.85 27.36 20.830000000000002 140-144 23.825 27.889999999999997 27.85 20.435 145-149 23.995 28.24 27.35 20.415 150-151 24.575 27.5125 26.950000000000003 20.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 4.0 29 7.0 30 10.0 31 13.5 32 20.0 33 28.5 34 40.0 35 52.5 36 70.0 37 98.0 38 133.0 39 162.0 40 212.5 41 243.0 42 258.0 43 294.5 44 310.0 45 307.5 46 290.0 47 261.0 48 228.0 49 191.0 50 175.5 51 149.5 52 107.0 53 86.5 54 68.5 55 48.0 56 32.0 57 22.5 58 18.0 59 16.0 60 8.5 61 4.5 62 4.0 63 5.5 64 3.5 65 1.5 66 1.0 67 0.0 68 1.0 69 1.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.255 30-34 1.51 35-39 0.59 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.4000000000000004 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACT 10 0.006830828 145.0 1 CTTGAGA 20 0.00593511 29.0 105-109 >>END_MODULE Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829285 spots for SRR7172686.sra Written 829285 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra Read 829283 spots for SRR7172686.sra Written 829283 spots for SRR7172686.sra SRR ids: ['SRR7172686.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ts6msr0s SRR7172686.sra spots: 16585662 blocks: [[1, 829283], [829284, 1658566], [1658567, 2487849], [2487850, 3317132], [3317133, 4146415], [4146416, 4975698], [4975699, 5804981], [5804982, 6634264], [6634265, 7463547], [7463548, 8292830], [8292831, 9122113], [9122114, 9951396], [9951397, 10780679], [10780680, 11609962], [11609963, 12439245], [12439246, 13268528], [13268529, 14097811], [14097812, 14927094], [14927095, 15756377], [15756378, 16585662]] SRR7172686 file size 5598636 SRR7172686 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172686 SRR7172686_1.fastq SRR7172686_2.fastq Input file: SRR7172686_1.fastq Paired file: SRR7172686_2.fastq trimmed: SRR7172686-trimmed-pair1.fastq, SRR7172686-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:25:15 2025 >> started Mon Feb 10 17:25:33 2025 >> done (17.606s) 16585662 read pairs processed; of these: 26221 ( 0.16%) short read pairs filtered out after trimming by size control 19381 ( 0.12%) empty read pairs filtered out after trimming by size control 16540060 (99.73%) read pairs available; of these: 6786260 (41.03%) trimmed read pairs available after processing 9753800 (58.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 3 0.00% 31 1 0.00% 32 5 0.00% 33 5 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 3 0.00% 38 1 0.00% 39 1 0.00% 40 6 0.00% 41 4 0.00% 42 2 0.00% 43 5 0.00% 44 2 0.00% 45 8 0.00% 46 7 0.00% 47 7 0.00% 48 9 0.00% 49 14 0.00% 50 12 0.00% 51 13 0.00% 52 19 0.00% 53 22 0.00% 54 13 0.00% 55 32 0.00% 56 22 0.00% 57 39 0.00% 58 28 0.00% 59 35 0.00% 60 36 0.00% 61 42 0.00% 62 58 0.00% 63 57 0.00% 64 89 0.00% 65 79 0.00% 66 95 0.00% 67 94 0.00% 68 124 0.00% 69 126 0.00% 70 181 0.00% 71 174 0.00% 72 199 0.00% 73 234 0.00% 74 250 0.00% 75 310 0.00% 76 371 0.00% 77 413 0.00% 78 442 0.00% 79 511 0.00% 80 536 0.00% 81 699 0.00% 82 819 0.00% 83 1021 0.01% 84 2207 0.01% 85 3105 0.02% 86 3029 0.02% 87 3265 0.02% 88 3361 0.02% 89 3360 0.02% 90 3371 0.02% 91 3591 0.02% 92 3802 0.02% 93 3932 0.02% 94 4275 0.03% 95 4431 0.03% 96 4669 0.03% 97 5041 0.03% 98 5171 0.03% 99 5663 0.03% 100 5996 0.04% 101 6459 0.04% 102 6928 0.04% 103 7435 0.04% 104 7824 0.05% 105 8428 0.05% 106 9081 0.05% 107 9632 0.06% 108 10203 0.06% 109 10806 0.07% 110 11346 0.07% 111 12179 0.07% 112 13234 0.08% 113 13865 0.08% 114 14931 0.09% 115 15819 0.10% 116 16630 0.10% 117 17439 0.11% 118 18246 0.11% 119 19037 0.12% 120 20064 0.12% 121 21161 0.13% 122 22330 0.14% 123 23709 0.14% 124 25331 0.15% 125 26727 0.16% 126 28060 0.17% 127 29653 0.18% 128 31080 0.19% 129 32535 0.20% 130 34639 0.21% 131 36500 0.22% 132 38993 0.24% 133 41250 0.25% 134 44392 0.27% 135 47132 0.28% 136 51264 0.31% 137 54273 0.33% 138 58318 0.35% 139 63728 0.39% 140 69169 0.42% 141 76093 0.46% 142 84488 0.51% 143 95478 0.58% 144 111107 0.67% 145 134448 0.81% 146 170042 1.03% 147 233840 1.41% 148 372607 2.25% 149 701708 4.24% 150 3701046 22.38% 151 9753800 58.97% 16540060 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.3 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=393.05 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=35.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=26 prefix-density=0.35 prefix-fanout=2.9 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=405.07 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=32.3 sequence=AAGAAGAAGAAA SRR7172686 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:26:39 Started mapping on | Feb 10 17:26:40 Finished on | Feb 10 17:28:51 Mapping speed, Million of reads per hour | 454.54 Number of input reads | 16540060 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15382095 Uniquely mapped reads % | 93.00% Average mapped length | 296.52 Number of splices: Total | 16288173 Number of splices: Annotated (sjdb) | 16022570 Number of splices: GT/AG | 16035750 Number of splices: GC/AG | 206403 Number of splices: AT/AC | 11565 Number of splices: Non-canonical | 34455 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433586 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 28171 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 746923 746923 746923 N_multimapping 433586 433586 433586 N_noFeature 290444 15262020 339585 N_ambiguous 150079 729 78741 UnstrandedReadsAssigned:14941572 PositiveStrandReadsAssigned:119346 NegativeStrandReadsAssigned:14963769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172686 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172686-trimmed-pair1.fastq SRR7172686-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,540,060 reads, 14,863,182 reads pseudoaligned [quant] estimated average fragment length: 252.527 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7172686.ke.tsv 34699 SRR7172686.se.tsv 87100 total ==> SRR7172686.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.47 1073 38.2093 Potri.005G024800.1.v4.1 1035 783.473 273 21.9187 Potri.004G059700.1.v4.1 961 709.478 39 3.45782 Potri.007G009000.2.v4.1 1416 1164.47 0 0 Potri.003G141000.2.v4.1 2943 2691.47 681 15.916 Potri.016G087400.1.v4.1 270 72.1972 1255.12 1093.56 Potri.015G069301.1.v4.1 564 317.013 0 0 Potri.010G195200.1.v4.1 1773 1521.47 392.941 16.2458 Potri.012G127500.1.v4.1 977 725.478 4314 374.052 ==> SRR7172686.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 374 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 175 SRR7172686 completed mapping pipeline successfully