Starting /dee2/code/volunteer_pipeline.sh SRR7172687 current disk space = 3058058149888 free memory = 1083462064 SRR7172687 SRAfilesize ecbdb836f879cc614e76fdd115a73620 SRR7172687.sra SRR7172687.sra file validated SRR7172687 is paired end SRR7172687 is conventional basespace SRR7172687 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172687_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.6835 18.0 18.0 30.0 18.0 32.0 2 21.479 18.0 18.0 27.0 18.0 31.0 3 27.44525 27.0 25.0 32.0 18.0 32.0 4 30.47975 32.0 31.0 33.0 27.0 33.0 5 31.8445 33.0 32.0 33.0 30.0 33.0 6 37.0425 38.0 37.0 38.0 36.0 38.0 7 37.529 38.0 38.0 38.0 37.0 38.0 8 37.59525 38.0 38.0 38.0 38.0 38.0 9 37.61975 38.0 38.0 38.0 38.0 38.0 10-14 37.62925 38.0 38.0 38.0 38.0 38.0 15-19 37.63875 38.0 38.0 38.0 38.0 38.0 20-24 37.61755 38.0 38.0 38.0 38.0 38.0 25-29 37.63175 38.0 38.0 38.0 38.0 38.0 30-34 37.634949999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.58685 38.0 38.0 38.0 38.0 38.0 40-44 37.539 38.0 38.0 38.0 37.8 38.0 45-49 37.50815 38.0 38.0 38.0 37.8 38.0 50-54 37.5065 38.0 38.0 38.0 37.6 38.0 55-59 37.3543 38.0 38.0 38.0 37.0 38.0 60-64 37.322849999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2527 38.0 38.0 38.0 37.0 38.0 70-74 37.278 38.0 38.0 38.0 36.8 38.0 75-79 37.18715 38.0 38.0 38.0 36.4 38.0 80-84 37.09525 38.0 38.0 38.0 36.2 38.0 85-89 36.968650000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.98355 38.0 38.0 38.0 36.0 38.0 95-99 37.002700000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.8507 38.0 38.0 38.0 35.2 38.0 105-109 36.573 38.0 38.0 38.0 34.2 38.0 110-114 36.554950000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.51585 38.0 38.0 38.0 34.2 38.0 120-124 36.40245 38.0 38.0 38.0 34.0 38.0 125-129 36.1075 38.0 37.2 38.0 33.2 38.0 130-134 35.6569 38.0 36.6 38.0 31.2 38.0 135-139 35.294650000000004 38.0 36.0 38.0 29.4 38.0 140-144 35.29585 38.0 36.0 38.0 30.4 38.0 145-149 35.1947 38.0 36.0 38.0 31.0 38.0 150-151 32.394875 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 2.0 18 3.0 19 3.0 20 3.0 21 1.0 22 2.0 23 7.0 24 3.0 25 7.0 26 5.0 27 10.0 28 20.0 29 22.0 30 21.0 31 57.0 32 55.0 33 86.0 34 142.0 35 254.0 36 767.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.188038520020275 17.20729853015712 13.025848960973137 46.57881398884947 2 14.37908496732026 23.68024132730015 39.76872800402212 22.171945701357465 3 19.425 25.85 25.275 29.45 4 21.45 34.425 21.0 23.125 5 20.474999999999998 36.725 24.55 18.25 6 16.5 35.8 27.3 20.4 7 12.875 20.974999999999998 46.425 19.725 8 17.974999999999998 21.3 31.775 28.95 9 18.85 22.5 32.75 25.900000000000002 10-14 19.5 29.375 27.065 24.060000000000002 15-19 19.27 28.265 28.365000000000002 24.099999999999998 20-24 19.384999999999998 28.98 27.534999999999997 24.099999999999998 25-29 19.155 28.89 28.000000000000004 23.955000000000002 30-34 19.48 28.51 27.884999999999998 24.125 35-39 19.759999999999998 28.465 27.765 24.01 40-44 19.885 28.715000000000003 27.375 24.025 45-49 19.794999999999998 28.96 27.525 23.72 50-54 19.384999999999998 28.299999999999997 28.355000000000004 23.96 55-59 19.794999999999998 28.26 27.950000000000003 23.995 60-64 19.725 28.225 27.725 24.325 65-69 19.74 28.465 27.845 23.95 70-74 19.72 28.575 27.85 23.855 75-79 19.74 28.325 28.189999999999998 23.745 80-84 20.19 28.48 27.939999999999998 23.39 85-89 19.725 28.884999999999998 27.395000000000003 23.995 90-94 19.885 28.470000000000002 27.63 24.015 95-99 19.855 28.389999999999997 28.175 23.580000000000002 100-104 20.200000000000003 28.775000000000002 27.67 23.355 105-109 20.345 28.725 27.145000000000003 23.785 110-114 20.515 28.71 27.57 23.205000000000002 115-119 20.455000000000002 27.810000000000002 28.599999999999998 23.135 120-124 20.735 28.255000000000003 27.48 23.53 125-129 20.825 28.305000000000003 27.515 23.355 130-134 20.505000000000003 28.884999999999998 27.500000000000004 23.11 135-139 20.64 28.610000000000003 27.43 23.32 140-144 21.224999999999998 27.884999999999998 27.389999999999997 23.5 145-149 20.305 28.299999999999997 27.145000000000003 24.25 150-151 21.65 27.462500000000002 27.125 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.5 26 3.5 27 4.5 28 10.5 29 13.0 30 13.0 31 18.0 32 29.0 33 41.0 34 56.0 35 75.5 36 92.5 37 108.0 38 135.0 39 177.5 40 214.5 41 246.5 42 283.0 43 295.0 44 293.5 45 302.5 46 281.0 47 240.5 48 200.0 49 172.5 50 162.0 51 131.0 52 101.0 53 84.0 54 59.0 55 41.0 56 26.0 57 16.0 58 15.0 59 10.5 60 9.5 61 9.5 62 6.5 63 4.5 64 5.0 65 3.5 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.1624999999999996 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.4625000000000004 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCGCT 10 0.006090368 150.5974 1 >>END_MODULE SRR7172687 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172687_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.17825 34.0 33.0 34.0 33.0 34.0 2 33.28475 34.0 33.0 34.0 33.0 34.0 3 33.28275 34.0 33.0 34.0 33.0 34.0 4 33.27925 34.0 33.0 34.0 33.0 34.0 5 33.3115 34.0 33.0 34.0 33.0 34.0 6 37.43 38.0 38.0 38.0 38.0 38.0 7 37.45425 38.0 38.0 38.0 38.0 38.0 8 37.418 38.0 38.0 38.0 38.0 38.0 9 37.426 38.0 38.0 38.0 38.0 38.0 10-14 37.4442 38.0 38.0 38.0 38.0 38.0 15-19 37.4738 38.0 38.0 38.0 38.0 38.0 20-24 37.457100000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.278 38.0 38.0 38.0 37.8 38.0 30-34 36.9297 38.0 38.0 38.0 37.0 38.0 35-39 37.08705 38.0 38.0 38.0 37.0 38.0 40-44 37.33630000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.34975 38.0 38.0 38.0 37.4 38.0 50-54 37.3417 38.0 38.0 38.0 37.6 38.0 55-59 37.24925 38.0 38.0 38.0 37.0 38.0 60-64 37.116949999999996 38.0 38.0 38.0 36.8 38.0 65-69 37.064499999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.01265 38.0 38.0 38.0 36.0 38.0 75-79 37.07075 38.0 38.0 38.0 36.4 38.0 80-84 37.0772 38.0 38.0 38.0 36.2 38.0 85-89 36.928700000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.78959999999999 38.0 38.0 38.0 35.8 38.0 95-99 36.806349999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.79265 38.0 38.0 38.0 35.2 38.0 105-109 36.6774 38.0 38.0 38.0 34.8 38.0 110-114 36.522149999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.387649999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.1648 38.0 38.0 38.0 33.8 38.0 125-129 35.8446 38.0 37.6 38.0 32.6 38.0 130-134 35.624900000000004 38.0 36.8 38.0 31.4 38.0 135-139 35.25345 38.0 36.0 38.0 31.0 38.0 140-144 35.005900000000004 38.0 36.0 38.0 30.0 38.0 145-149 34.41075 38.0 35.6 38.0 27.6 38.0 150-151 29.739874999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 2.0 17 0.0 18 4.0 19 3.0 20 1.0 21 9.0 22 9.0 23 9.0 24 6.0 25 7.0 26 19.0 27 17.0 28 20.0 29 25.0 30 31.0 31 42.0 32 47.0 33 100.0 34 128.0 35 251.0 36 487.0 37 2772.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.025 14.075 17.875 35.025 2 22.900000000000002 22.3 38.375 16.425 3 21.349999999999998 25.45 32.2 21.0 4 25.8 33.925 21.475 18.8 5 23.175 36.75 22.825 17.25 6 18.05 38.875 24.875 18.2 7 16.725 16.650000000000002 44.1 22.525000000000002 8 19.175 23.425 30.0 27.400000000000002 9 22.8 22.8 29.275000000000002 25.124999999999996 10-14 22.735 29.09 26.685 21.490000000000002 15-19 22.85 27.825 28.470000000000002 20.855 20-24 22.835 28.365000000000002 27.694999999999997 21.105 25-29 23.267599979928747 28.164985699232275 27.5728837372673 20.99453058357168 30-34 22.625924799837843 28.205128205128204 27.617310226005877 21.551636769028075 35-39 22.67444785430397 28.40468883634351 27.90159480806963 21.01926850128289 40-44 22.55 28.07 28.655 20.724999999999998 45-49 23.06 28.165000000000003 27.87 20.905 50-54 23.145 28.57 27.794999999999998 20.49 55-59 22.675 28.155 28.215 20.955 60-64 23.285 28.405 27.62 20.69 65-69 23.615 28.235 28.050000000000004 20.1 70-74 23.015 28.585 28.065 20.335 75-79 23.43 27.950000000000003 28.605000000000004 20.015 80-84 23.7 28.73 27.389999999999997 20.18 85-89 23.215 28.244999999999997 27.815 20.724999999999998 90-94 23.34 27.71 28.535 20.415 95-99 23.9 28.444999999999997 27.644999999999996 20.01 100-104 23.775 28.685 27.395000000000003 20.145 105-109 23.79 27.855 27.825 20.53 110-114 23.365 28.46 27.58 20.595 115-119 23.735 28.000000000000004 27.755000000000003 20.51 120-124 24.095 27.62 27.83 20.455000000000002 125-129 24.310000000000002 28.244999999999997 27.79 19.655 130-134 24.785 28.015 27.51 19.689999999999998 135-139 24.855 28.294999999999998 27.139999999999997 19.71 140-144 24.325 28.055000000000003 27.875 19.744999999999997 145-149 24.575 27.884999999999998 27.794999999999998 19.744999999999997 150-151 24.5625 27.925 27.625 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 4.5 27 6.0 28 4.5 29 6.0 30 11.5 31 15.5 32 22.0 33 26.0 34 41.0 35 63.5 36 87.0 37 110.5 38 137.0 39 172.5 40 208.5 41 252.5 42 287.5 43 312.0 44 302.0 45 296.5 46 289.0 47 240.5 48 222.5 49 205.0 50 161.5 51 132.5 52 104.0 53 69.5 54 45.0 55 35.5 56 31.0 57 25.0 58 22.0 59 13.5 60 8.0 61 7.5 62 4.5 63 3.0 64 2.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.35500000000000004 30-34 1.3299999999999998 35-39 0.615 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.5375 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACT 10 0.0068768123 144.675 2 TCTCGCT 10 0.0068768123 144.675 6 AAAAAGG 10 0.0068768123 144.675 2 >>END_MODULE Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra Read 663418 spots for SRR7172687.sra Written 663418 spots for SRR7172687.sra Read 663417 spots for SRR7172687.sra Written 663417 spots for SRR7172687.sra SRR ids: ['SRR7172687.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_357k_zj_ SRR7172687.sra spots: 13268341 blocks: [[1, 663417], [663418, 1326834], [1326835, 1990251], [1990252, 2653668], [2653669, 3317085], [3317086, 3980502], [3980503, 4643919], [4643920, 5307336], [5307337, 5970753], [5970754, 6634170], [6634171, 7297587], [7297588, 7961004], [7961005, 8624421], [8624422, 9287838], [9287839, 9951255], [9951256, 10614672], [10614673, 11278089], [11278090, 11941506], [11941507, 12604923], [12604924, 13268341]] SRR7172687 file size 4474505 SRR7172687 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172687 SRR7172687_1.fastq SRR7172687_2.fastq Input file: SRR7172687_1.fastq Paired file: SRR7172687_2.fastq trimmed: SRR7172687-trimmed-pair1.fastq, SRR7172687-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:20 2025 >> started Mon Feb 10 17:36:38 2025 >> done (18.216s) 13268341 read pairs processed; of these: 7138 ( 0.05%) short read pairs filtered out after trimming by size control 5835 ( 0.04%) empty read pairs filtered out after trimming by size control 13255368 (99.90%) read pairs available; of these: 5263251 (39.71%) trimmed read pairs available after processing 7992117 (60.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 3 0.00% 41 3 0.00% 42 2 0.00% 43 6 0.00% 44 4 0.00% 45 7 0.00% 46 7 0.00% 47 0 0.00% 48 9 0.00% 49 6 0.00% 50 11 0.00% 51 10 0.00% 52 13 0.00% 53 5 0.00% 54 9 0.00% 55 18 0.00% 56 18 0.00% 57 26 0.00% 58 27 0.00% 59 28 0.00% 60 33 0.00% 61 36 0.00% 62 42 0.00% 63 53 0.00% 64 44 0.00% 65 57 0.00% 66 51 0.00% 67 61 0.00% 68 92 0.00% 69 87 0.00% 70 107 0.00% 71 137 0.00% 72 158 0.00% 73 188 0.00% 74 183 0.00% 75 240 0.00% 76 289 0.00% 77 328 0.00% 78 355 0.00% 79 403 0.00% 80 464 0.00% 81 556 0.00% 82 592 0.00% 83 698 0.01% 84 1203 0.01% 85 1444 0.01% 86 1611 0.01% 87 1600 0.01% 88 1750 0.01% 89 1960 0.01% 90 2063 0.02% 91 2251 0.02% 92 2334 0.02% 93 2587 0.02% 94 2969 0.02% 95 3120 0.02% 96 3451 0.03% 97 3697 0.03% 98 3917 0.03% 99 4248 0.03% 100 4516 0.03% 101 4945 0.04% 102 5336 0.04% 103 5729 0.04% 104 6123 0.05% 105 6556 0.05% 106 6918 0.05% 107 7695 0.06% 108 7923 0.06% 109 8527 0.06% 110 9201 0.07% 111 9734 0.07% 112 10229 0.08% 113 10971 0.08% 114 11584 0.09% 115 12085 0.09% 116 13008 0.10% 117 13626 0.10% 118 14463 0.11% 119 14864 0.11% 120 15497 0.12% 121 16772 0.13% 122 17492 0.13% 123 18299 0.14% 124 19276 0.15% 125 20392 0.15% 126 21446 0.16% 127 22710 0.17% 128 23475 0.18% 129 24784 0.19% 130 26166 0.20% 131 27289 0.21% 132 28922 0.22% 133 30422 0.23% 134 32082 0.24% 135 34026 0.26% 136 36291 0.27% 137 38658 0.29% 138 41244 0.31% 139 44277 0.33% 140 47860 0.36% 141 52510 0.40% 142 57965 0.44% 143 64683 0.49% 144 74436 0.56% 145 89394 0.67% 146 112706 0.85% 147 151648 1.14% 148 235348 1.78% 149 570940 4.31% 150 3036512 22.91% 151 7992117 60.29% 13255368 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=22 prefix-density=0.31 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=459.65 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=35.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=392.84 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=31.1 sequence=AAGAAGAAGAAA SRR7172687 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:37:24 Started mapping on | Feb 10 17:37:24 Finished on | Feb 10 17:38:46 Mapping speed, Million of reads per hour | 581.94 Number of input reads | 13255368 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12667018 Uniquely mapped reads % | 95.56% Average mapped length | 296.94 Number of splices: Total | 13267515 Number of splices: Annotated (sjdb) | 13057013 Number of splices: GT/AG | 13061991 Number of splices: GC/AG | 167850 Number of splices: AT/AC | 9671 Number of splices: Non-canonical | 28003 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319779 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 25662 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275532 275532 275532 N_multimapping 319779 319779 319779 N_noFeature 273588 12573719 308056 N_ambiguous 122560 619 63338 UnstrandedReadsAssigned:12270870 PositiveStrandReadsAssigned:92680 NegativeStrandReadsAssigned:12295624 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172687 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172687-trimmed-pair1.fastq SRR7172687-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,255,368 reads, 12,185,470 reads pseudoaligned [quant] estimated average fragment length: 252.9 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR7172687.ke.tsv 34699 SRR7172687.se.tsv 87100 total ==> SRR7172687.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.1 810 37.2625 Potri.005G024800.1.v4.1 1035 783.1 313 32.4736 Potri.004G059700.1.v4.1 961 709.149 25 2.86421 Potri.007G009000.2.v4.1 1416 1164.1 0 0 Potri.003G141000.2.v4.1 2943 2691.1 506 15.2765 Potri.016G087400.1.v4.1 270 73.4564 1084 1198.95 Potri.015G069301.1.v4.1 564 317.358 0 0 Potri.010G195200.1.v4.1 1773 1521.1 113 6.03564 Potri.012G127500.1.v4.1 977 725.13 1986 222.518 ==> SRR7172687.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 92 SRR7172687 completed mapping pipeline successfully