Starting /dee2/code/volunteer_pipeline.sh SRR7172688 current disk space = 3058035245056 free memory = 1318072008 SRR7172688 SRAfilesize 07b095959e5dd0075977fb5e14f8ea7b SRR7172688.sra SRR7172688.sra file validated SRR7172688 is paired end SRR7172688 is conventional basespace SRR7172688 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172688_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.9905 18.0 18.0 18.0 18.0 32.0 2 21.95325 18.0 18.0 27.0 18.0 32.0 3 27.72775 27.0 27.0 32.0 18.0 32.0 4 28.5005 29.0 27.0 31.0 25.0 33.0 5 31.5445 32.0 32.0 33.0 28.0 33.0 6 36.3685 37.0 36.0 38.0 34.0 38.0 7 37.11125 38.0 37.0 38.0 35.0 38.0 8 37.27 38.0 38.0 38.0 36.0 38.0 9 37.33475 38.0 38.0 38.0 37.0 38.0 10-14 37.5222 38.0 38.0 38.0 37.4 38.0 15-19 37.613350000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.561550000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.62455 38.0 38.0 38.0 38.0 38.0 30-34 37.62605 38.0 38.0 38.0 38.0 38.0 35-39 37.60645000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.52585 38.0 38.0 38.0 37.8 38.0 45-49 37.47915 38.0 38.0 38.0 37.8 38.0 50-54 37.420100000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.3093 38.0 38.0 38.0 37.0 38.0 60-64 37.27405 38.0 38.0 38.0 37.0 38.0 65-69 37.23035 38.0 38.0 38.0 36.8 38.0 70-74 37.1552 38.0 38.0 38.0 36.2 38.0 75-79 37.08245000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.058049999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.773199999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.87915 38.0 38.0 38.0 35.2 38.0 95-99 36.838350000000005 38.0 38.0 38.0 35.4 38.0 100-104 36.68245 38.0 38.0 38.0 34.6 38.0 105-109 36.2889 38.0 37.8 38.0 33.8 38.0 110-114 36.25745 38.0 37.6 38.0 33.2 38.0 115-119 36.158500000000004 38.0 37.0 38.0 33.0 38.0 120-124 36.315 38.0 37.6 38.0 33.6 38.0 125-129 36.0976 38.0 37.2 38.0 33.2 38.0 130-134 35.6976 38.0 36.2 38.0 31.4 38.0 135-139 35.24835 38.0 35.8 38.0 28.4 38.0 140-144 35.308949999999996 38.0 35.8 38.0 29.8 38.0 145-149 35.0825 38.0 35.8 38.0 30.0 38.0 150-151 31.74275 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 1.0 19 1.0 20 2.0 21 4.0 22 4.0 23 1.0 24 3.0 25 2.0 26 9.0 27 20.0 28 20.0 29 27.0 30 39.0 31 40.0 32 76.0 33 122.0 34 164.0 35 301.0 36 851.0 37 2311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 10.071029934043633 29.832572298325722 13.039066463723998 47.05733130390664 2 18.574297188755022 27.309236947791167 29.44277108433735 24.673694779116463 3 18.2 28.7 23.375 29.725 4 22.45 33.825 20.25 23.474999999999998 5 21.0 37.05 24.0 17.95 6 15.275 37.65 25.8 21.275 7 12.275 20.875 46.45 20.4 8 18.975 22.625 30.75 27.650000000000002 9 17.65 23.724999999999998 33.675 24.95 10-14 19.09 29.775000000000002 26.82 24.315 15-19 18.925 28.560000000000002 28.410000000000004 24.104999999999997 20-24 19.52 28.93 27.644999999999996 23.905 25-29 19.42 28.52 28.485 23.575 30-34 19.91 28.565 28.084999999999997 23.44 35-39 19.86 28.105000000000004 28.64 23.395 40-44 19.805 28.15 28.43 23.615 45-49 19.415 29.345 26.87 24.37 50-54 19.830000000000002 28.1 28.26 23.810000000000002 55-59 20.119999999999997 27.82 28.060000000000002 24.0 60-64 19.91 28.505000000000003 27.625 23.96 65-69 19.88 28.17 27.589999999999996 24.36 70-74 19.775000000000002 29.215000000000003 27.22 23.79 75-79 19.705000000000002 28.470000000000002 27.965 23.86 80-84 20.225 27.935 28.175 23.665 85-89 19.814999999999998 28.499999999999996 28.355000000000004 23.330000000000002 90-94 20.085 27.860000000000003 27.935 24.12 95-99 19.79 28.735 28.105000000000004 23.369999999999997 100-104 19.994999999999997 28.125 27.944999999999997 23.935000000000002 105-109 20.405 28.37 28.065 23.16 110-114 19.92396578460307 28.117652943824723 28.292731729278174 23.66564954229403 115-119 19.93 28.634999999999998 28.349999999999998 23.085 120-124 20.905 27.779999999999998 28.12 23.195 125-129 20.805 28.165000000000003 27.255000000000003 23.775 130-134 20.465 27.894999999999996 27.43 24.21 135-139 20.43 27.775 28.134999999999998 23.66 140-144 20.595 27.515 27.634999999999998 24.255 145-149 21.025 28.01 26.99 23.974999999999998 150-151 21.3 26.974999999999998 27.787499999999998 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.5 27 4.5 28 7.5 29 17.0 30 25.0 31 26.5 32 33.5 33 50.0 34 61.5 35 71.0 36 90.5 37 118.0 38 150.5 39 181.5 40 212.5 41 245.0 42 267.0 43 281.0 44 278.5 45 267.0 46 269.0 47 244.5 48 204.5 49 186.5 50 168.5 51 142.0 52 101.5 53 71.5 54 51.5 55 37.0 56 34.0 57 24.0 58 18.5 59 14.5 60 9.5 61 7.5 62 7.0 63 3.0 64 1.5 65 3.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.675 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGAT 10 0.006836113 144.9625 9 >>END_MODULE SRR7172688 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172688_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.153 34.0 33.0 34.0 33.0 34.0 2 33.1635 34.0 33.0 34.0 33.0 34.0 3 33.1925 34.0 33.0 34.0 33.0 34.0 4 33.1895 34.0 33.0 34.0 33.0 34.0 5 33.202 34.0 33.0 34.0 33.0 34.0 6 37.36775 38.0 38.0 38.0 38.0 38.0 7 37.41475 38.0 38.0 38.0 38.0 38.0 8 37.369 38.0 38.0 38.0 38.0 38.0 9 37.3325 38.0 38.0 38.0 37.0 38.0 10-14 37.30405 38.0 38.0 38.0 37.4 38.0 15-19 37.3283 38.0 38.0 38.0 38.0 38.0 20-24 37.29235 38.0 38.0 38.0 37.6 38.0 25-29 37.03855 38.0 38.0 38.0 37.0 38.0 30-34 36.520950000000006 38.0 38.0 38.0 36.4 38.0 35-39 36.75045 38.0 38.0 38.0 36.2 38.0 40-44 37.18005 38.0 38.0 38.0 37.0 38.0 45-49 37.2248 38.0 38.0 38.0 37.2 38.0 50-54 37.19709999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.0737 38.0 38.0 38.0 36.6 38.0 60-64 36.958450000000006 38.0 38.0 38.0 36.2 38.0 65-69 36.9259 38.0 38.0 38.0 36.0 38.0 70-74 36.85275 38.0 38.0 38.0 36.0 38.0 75-79 36.7506 38.0 38.0 38.0 35.6 38.0 80-84 36.8347 38.0 38.0 38.0 35.8 38.0 85-89 36.727999999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.674400000000006 38.0 38.0 38.0 35.2 38.0 95-99 36.575 38.0 38.0 38.0 34.8 38.0 100-104 36.44995 38.0 38.0 38.0 34.2 38.0 105-109 36.427350000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.313900000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.0655 38.0 37.8 38.0 33.8 38.0 120-124 35.79605 38.0 37.2 38.0 32.4 38.0 125-129 35.6495 38.0 36.8 38.0 31.2 38.0 130-134 35.3839 38.0 36.0 38.0 30.4 38.0 135-139 35.148900000000005 38.0 36.0 38.0 30.0 38.0 140-144 34.5912 38.0 35.2 38.0 27.4 38.0 145-149 33.87925 38.0 33.2 38.0 24.4 38.0 150-151 29.616 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 4.0 13 0.0 14 3.0 15 0.0 16 3.0 17 3.0 18 2.0 19 5.0 20 7.0 21 6.0 22 3.0 23 6.0 24 8.0 25 19.0 26 12.0 27 18.0 28 17.0 29 27.0 30 39.0 31 33.0 32 67.0 33 96.0 34 162.0 35 272.0 36 552.0 37 2618.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.45 16.225 19.425 32.9 2 24.025 22.375 37.824999999999996 15.775 3 21.525 27.025 30.15 21.3 4 23.625 33.125 22.325 20.925 5 24.025 36.675000000000004 22.375 16.925 6 17.875 37.974999999999994 23.875 20.275000000000002 7 17.525 15.975 44.15 22.35 8 20.7 22.025 29.599999999999998 27.675 9 22.75 23.325000000000003 29.299999999999997 24.625 10-14 22.525000000000002 28.970000000000002 26.645000000000003 21.86 15-19 22.455 28.17 28.244999999999997 21.13 20-24 22.71 28.375 27.965 20.95 25-29 23.806412704794454 28.620966931349884 27.1132777163534 20.45934264750226 30-34 22.782874617737004 28.13965341488277 27.619775739041796 21.45769622833843 35-39 23.28995157384988 28.91949152542373 26.967312348668283 20.823244552058114 40-44 23.43 28.12 27.935 20.515 45-49 22.75 28.449999999999996 27.855 20.945 50-54 23.369999999999997 27.965 27.99 20.674999999999997 55-59 22.95 27.875 27.965 21.21 60-64 23.375 28.139999999999997 28.439999999999998 20.044999999999998 65-69 23.49 28.015 27.855 20.64 70-74 23.26 28.144999999999996 28.185 20.41 75-79 22.869999999999997 28.23 28.1 20.8 80-84 23.46 28.610000000000003 27.175 20.755000000000003 85-89 23.064999999999998 28.000000000000004 28.505000000000003 20.43 90-94 23.45 27.875 28.315 20.36 95-99 23.455000000000002 28.115000000000002 27.800000000000004 20.630000000000003 100-104 23.7 28.345 27.505000000000003 20.45 105-109 23.925 28.505000000000003 27.634999999999998 19.935 110-114 23.94 28.12 27.589999999999996 20.349999999999998 115-119 24.169999999999998 27.689999999999998 27.935 20.205000000000002 120-124 23.25 28.65 28.24 19.86 125-129 24.104999999999997 27.750000000000004 28.035 20.11 130-134 24.265 28.285 27.800000000000004 19.650000000000002 135-139 24.6 27.68 28.04 19.68 140-144 24.505 28.38 27.644999999999996 19.470000000000002 145-149 24.435000000000002 27.76 27.994999999999997 19.81 150-151 25.05 28.262500000000003 27.025 19.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 2.0 25 2.0 26 3.0 27 3.0 28 5.5 29 10.0 30 13.0 31 15.0 32 21.0 33 38.0 34 47.5 35 49.5 36 65.5 37 101.0 38 138.0 39 163.5 40 215.5 41 259.0 42 279.0 43 308.5 44 306.5 45 296.5 46 282.0 47 253.5 48 227.5 49 187.0 50 158.0 51 139.0 52 107.0 53 79.0 54 62.0 55 48.5 56 31.5 57 22.0 58 17.5 59 9.0 60 5.5 61 5.5 62 5.0 63 4.0 64 3.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.51 30-34 1.9 35-39 0.88 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.225 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602406 spots for SRR7172688.sra Written 602406 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra Read 602395 spots for SRR7172688.sra Written 602395 spots for SRR7172688.sra SRR ids: ['SRR7172688.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r6s3kgrm SRR7172688.sra spots: 12047911 blocks: [[1, 602395], [602396, 1204790], [1204791, 1807185], [1807186, 2409580], [2409581, 3011975], [3011976, 3614370], [3614371, 4216765], [4216766, 4819160], [4819161, 5421555], [5421556, 6023950], [6023951, 6626345], [6626346, 7228740], [7228741, 7831135], [7831136, 8433530], [8433531, 9035925], [9035926, 9638320], [9638321, 10240715], [10240716, 10843110], [10843111, 11445505], [11445506, 12047911]] SRR7172688 file size 4060941 SRR7172688 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172688 SRR7172688_1.fastq SRR7172688_2.fastq Input file: SRR7172688_1.fastq Paired file: SRR7172688_2.fastq trimmed: SRR7172688-trimmed-pair1.fastq, SRR7172688-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:29:38 2025 >> started Mon Feb 10 17:29:51 2025 >> done (13.395s) 12047911 read pairs processed; of these: 7356 ( 0.06%) short read pairs filtered out after trimming by size control 5959 ( 0.05%) empty read pairs filtered out after trimming by size control 12034596 (99.89%) read pairs available; of these: 5834335 (48.48%) trimmed read pairs available after processing 6200261 (51.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 0 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 1 0.00% 34 2 0.00% 35 2 0.00% 36 0 0.00% 37 1 0.00% 38 2 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 3 0.00% 43 3 0.00% 44 4 0.00% 45 4 0.00% 46 6 0.00% 47 7 0.00% 48 5 0.00% 49 6 0.00% 50 6 0.00% 51 5 0.00% 52 6 0.00% 53 13 0.00% 54 8 0.00% 55 10 0.00% 56 18 0.00% 57 12 0.00% 58 17 0.00% 59 33 0.00% 60 30 0.00% 61 30 0.00% 62 30 0.00% 63 27 0.00% 64 53 0.00% 65 48 0.00% 66 55 0.00% 67 77 0.00% 68 58 0.00% 69 105 0.00% 70 86 0.00% 71 117 0.00% 72 130 0.00% 73 130 0.00% 74 153 0.00% 75 164 0.00% 76 220 0.00% 77 267 0.00% 78 285 0.00% 79 325 0.00% 80 349 0.00% 81 456 0.00% 82 530 0.00% 83 554 0.00% 84 995 0.01% 85 1232 0.01% 86 1336 0.01% 87 1520 0.01% 88 1568 0.01% 89 1697 0.01% 90 1752 0.01% 91 1917 0.02% 92 2097 0.02% 93 2229 0.02% 94 2384 0.02% 95 2543 0.02% 96 2770 0.02% 97 3072 0.03% 98 3143 0.03% 99 3360 0.03% 100 3756 0.03% 101 4010 0.03% 102 4430 0.04% 103 4689 0.04% 104 5012 0.04% 105 5321 0.04% 106 5799 0.05% 107 6133 0.05% 108 6524 0.05% 109 6999 0.06% 110 7614 0.06% 111 7967 0.07% 112 8693 0.07% 113 8954 0.07% 114 9639 0.08% 115 10153 0.08% 116 10777 0.09% 117 11333 0.09% 118 12084 0.10% 119 12485 0.10% 120 13265 0.11% 121 13965 0.12% 122 14837 0.12% 123 15401 0.13% 124 16782 0.14% 125 17542 0.15% 126 18531 0.15% 127 19690 0.16% 128 20825 0.17% 129 21670 0.18% 130 23626 0.20% 131 24582 0.20% 132 26083 0.22% 133 28083 0.23% 134 29715 0.25% 135 31821 0.26% 136 34134 0.28% 137 37073 0.31% 138 40099 0.33% 139 44186 0.37% 140 47878 0.40% 141 52984 0.44% 142 59569 0.49% 143 67821 0.56% 144 79869 0.66% 145 96942 0.81% 146 124390 1.03% 147 170917 1.42% 148 275275 2.29% 149 657041 5.46% 150 3519287 29.24% 151 6200261 51.52% 12034596 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=24 prefix-density=0.47 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.01 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.6 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=22 prefix-density=0.48 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=44.86 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.1 sequence=GGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGGTATAAAACCAGCAAAAGATAAGTCCTTTTCGAAACATTTCCACCCAAACTCTCAGTTGTTCCTTTACAATGATGGTGACGTTAAAGGAGAGAGATCCTTCGCTGAAGATGTTGAGCCGAGGCCTAATGTGTCCGTTTACCACGACGACGCTACTCTTAAAGGAGAAAAATCTTTTCAGGAGGACTTCGAACCAGGACCTAACATATCAGTTTATGATG SRR7172688 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:30:38 Started mapping on | Feb 10 17:30:38 Finished on | Feb 10 17:31:57 Mapping speed, Million of reads per hour | 548.41 Number of input reads | 12034596 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11495825 Uniquely mapped reads % | 95.52% Average mapped length | 296.76 Number of splices: Total | 11729147 Number of splices: Annotated (sjdb) | 11504688 Number of splices: GT/AG | 11548655 Number of splices: GC/AG | 144909 Number of splices: AT/AC | 8691 Number of splices: Non-canonical | 26892 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277783 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 24512 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 268082 268082 268082 N_multimapping 277783 277783 277783 N_noFeature 268050 11403512 302058 N_ambiguous 118414 978 59433 UnstrandedReadsAssigned:11109361 PositiveStrandReadsAssigned:91335 NegativeStrandReadsAssigned:11134334 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172688 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172688-trimmed-pair1.fastq SRR7172688-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,034,596 reads, 11,035,387 reads pseudoaligned [quant] estimated average fragment length: 254.078 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7172688.ke.tsv 34699 SRR7172688.se.tsv 87100 total ==> SRR7172688.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.92 868 42.2953 Potri.005G024800.1.v4.1 1035 781.922 443 48.7234 Potri.004G059700.1.v4.1 961 707.947 19 2.30808 Potri.007G009000.2.v4.1 1416 1162.92 0 0 Potri.003G141000.2.v4.1 2943 2689.92 439 14.0353 Potri.016G087400.1.v4.1 270 71.332 972.269 1172.2 Potri.015G069301.1.v4.1 564 315.589 0 0 Potri.010G195200.1.v4.1 1773 1519.92 197.845 11.1944 Potri.012G127500.1.v4.1 977 723.937 2755 327.279 ==> SRR7172688.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 143 SRR7172688 completed mapping pipeline successfully