Starting /dee2/code/volunteer_pipeline.sh SRR7172689 current disk space = 3058143318016 free memory = 1188205604 SRR7172689 SRAfilesize 35e23853ef2af423b200b19bf315b164 SRR7172689.sra SRR7172689.sra file validated SRR7172689 is paired end SRR7172689 is conventional basespace SRR7172689 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172689_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.2725 25.0 18.0 32.0 18.0 32.0 2 23.5835 25.0 18.0 29.0 18.0 31.0 3 26.28825 27.0 25.0 29.0 18.0 31.0 4 28.39725 29.0 27.0 31.0 25.0 33.0 5 29.69125 31.0 29.0 33.0 25.0 33.0 6 35.22 37.0 34.0 38.0 31.0 38.0 7 36.635 38.0 37.0 38.0 34.0 38.0 8 37.325 38.0 38.0 38.0 36.0 38.0 9 37.462 38.0 38.0 38.0 37.0 38.0 10-14 37.532650000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.53745 38.0 38.0 38.0 38.0 38.0 20-24 37.5152 38.0 38.0 38.0 38.0 38.0 25-29 37.5621 38.0 38.0 38.0 38.0 38.0 30-34 37.49365 38.0 38.0 38.0 37.8 38.0 35-39 37.51345 38.0 38.0 38.0 38.0 38.0 40-44 37.46495 38.0 38.0 38.0 37.4 38.0 45-49 37.308299999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.37115 38.0 38.0 38.0 37.0 38.0 55-59 37.26084999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.20720000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.126 38.0 38.0 38.0 36.2 38.0 70-74 37.126149999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.005250000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.9467 38.0 38.0 38.0 35.6 38.0 85-89 36.753 38.0 38.0 38.0 34.6 38.0 90-94 36.74775 38.0 38.0 38.0 34.8 38.0 95-99 36.7305 38.0 38.0 38.0 34.6 38.0 100-104 36.73950000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.3742 38.0 37.8 38.0 34.0 38.0 110-114 36.286 38.0 37.8 38.0 33.6 38.0 115-119 36.22235 38.0 37.4 38.0 33.6 38.0 120-124 36.185900000000004 38.0 37.2 38.0 33.4 38.0 125-129 35.7527 38.0 36.4 38.0 31.8 38.0 130-134 35.24525 38.0 35.8 38.0 29.4 38.0 135-139 34.9479 38.0 35.4 38.0 27.6 38.0 140-144 34.7722 38.0 35.0 38.0 27.6 38.0 145-149 34.27735 38.0 34.6 38.0 26.2 38.0 150-151 30.614125 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 3.0 21 4.0 22 3.0 23 7.0 24 4.0 25 14.0 26 14.0 27 13.0 28 16.0 29 35.0 30 43.0 31 53.0 32 68.0 33 108.0 34 178.0 35 327.0 36 915.0 37 2187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.75038441824705 12.12198872373142 12.813941568426449 38.31368528959508 2 23.069207622868607 19.28284854563691 38.66599799398195 18.981945837512537 3 18.8 26.775 27.775 26.650000000000002 4 22.475 32.725 24.325 20.474999999999998 5 21.15 36.075 25.25 17.525 6 17.224999999999998 36.25 25.775 20.75 7 13.475000000000001 21.475 44.6 20.45 8 18.025 21.025 31.65 29.299999999999997 9 18.275 21.2 33.375 27.150000000000002 10-14 19.41 28.835 27.29 24.465 15-19 19.49 28.194999999999997 28.37 23.945 20-24 19.45 28.939999999999998 27.965 23.645 25-29 19.54 28.389999999999997 28.360000000000003 23.71 30-34 20.06 28.58 28.37 22.99 35-39 19.945 28.895 27.445000000000004 23.715 40-44 19.405 28.794999999999998 27.875 23.925 45-49 20.205000000000002 28.634999999999998 27.575 23.585 50-54 19.645000000000003 28.675 28.144999999999996 23.535 55-59 20.215 28.285 27.935 23.565 60-64 19.215 28.62 27.994999999999997 24.169999999999998 65-69 19.49 28.51 28.155 23.845 70-74 20.495 27.685 28.055000000000003 23.765 75-79 19.84 28.585 28.139999999999997 23.435 80-84 19.865 28.675 27.500000000000004 23.96 85-89 20.23 28.549999999999997 27.52 23.7 90-94 19.919999999999998 28.244999999999997 27.99 23.845 95-99 19.895 28.54 27.85 23.715 100-104 19.85 28.16 28.744999999999997 23.244999999999997 105-109 19.885 28.24 27.944999999999997 23.93 110-114 20.375 28.084999999999997 28.23 23.31 115-119 20.59 28.060000000000002 27.689999999999998 23.66 120-124 20.105 28.51 28.075 23.31 125-129 20.965 28.084999999999997 27.735 23.215 130-134 20.125 28.64 28.04 23.195 135-139 20.705000000000002 28.139999999999997 28.315 22.84 140-144 20.095 28.299999999999997 27.52 24.085 145-149 20.68 28.32 27.16 23.84 150-151 20.2625 27.962500000000002 27.6375 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.5 24 2.5 25 1.0 26 3.5 27 7.0 28 9.0 29 14.0 30 16.5 31 21.5 32 37.0 33 43.0 34 52.5 35 79.0 36 99.0 37 115.0 38 139.5 39 165.5 40 195.5 41 237.5 42 255.5 43 268.5 44 278.0 45 279.0 46 283.0 47 276.0 48 240.5 49 197.0 50 162.0 51 124.0 52 100.0 53 75.5 54 53.5 55 44.5 56 37.5 57 25.0 58 13.0 59 9.0 60 8.5 61 7.5 62 8.0 63 4.5 64 3.0 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.9000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCAG 10 0.0068378756 144.95 9 >>END_MODULE SRR7172689 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172689_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06425 34.0 33.0 34.0 32.0 34.0 2 33.1275 34.0 33.0 34.0 32.0 34.0 3 33.163 34.0 33.0 34.0 33.0 34.0 4 33.11325 34.0 33.0 34.0 33.0 34.0 5 33.05375 34.0 33.0 34.0 32.0 34.0 6 37.2605 38.0 38.0 38.0 37.0 38.0 7 37.21925 38.0 38.0 38.0 37.0 38.0 8 37.166 38.0 38.0 38.0 37.0 38.0 9 37.23725 38.0 38.0 38.0 37.0 38.0 10-14 37.27055 38.0 38.0 38.0 37.2 38.0 15-19 37.275099999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.24075 38.0 38.0 38.0 37.0 38.0 25-29 37.037549999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.42380000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.688550000000006 38.0 38.0 38.0 36.0 38.0 40-44 37.1143 38.0 38.0 38.0 37.0 38.0 45-49 37.09545000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.07105 38.0 38.0 38.0 36.8 38.0 55-59 36.92215 38.0 38.0 38.0 36.2 38.0 60-64 36.812400000000004 38.0 38.0 38.0 35.8 38.0 65-69 36.6567 38.0 38.0 38.0 35.0 38.0 70-74 36.713800000000006 38.0 38.0 38.0 35.4 38.0 75-79 36.7274 38.0 38.0 38.0 35.4 38.0 80-84 36.689750000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.537499999999994 38.0 38.0 38.0 34.6 38.0 90-94 36.342 38.0 38.0 38.0 34.0 38.0 95-99 36.3015 38.0 38.0 38.0 34.0 38.0 100-104 36.263600000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.05475 38.0 37.2 38.0 33.0 38.0 110-114 35.7383 38.0 37.0 38.0 31.4 38.0 115-119 35.546749999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.200100000000006 38.0 36.0 38.0 28.6 38.0 125-129 34.97855 38.0 36.0 38.0 28.0 38.0 130-134 34.583000000000006 38.0 35.0 38.0 26.6 38.0 135-139 33.99285 38.0 33.4 38.0 23.8 38.0 140-144 33.21485 38.0 33.0 38.0 19.8 38.0 145-149 31.859900000000003 38.0 32.2 38.0 10.8 38.0 150-151 26.944875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 2.0 15 3.0 16 2.0 17 3.0 18 3.0 19 2.0 20 7.0 21 7.0 22 11.0 23 11.0 24 16.0 25 14.0 26 20.0 27 35.0 28 22.0 29 41.0 30 52.0 31 52.0 32 92.0 33 143.0 34 174.0 35 345.0 36 675.0 37 2247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.525 14.725 16.75 32.0 2 23.025000000000002 24.8 36.3 15.875 3 20.674999999999997 28.025 30.95 20.349999999999998 4 23.674999999999997 34.2 22.8 19.325 5 22.55 37.475 22.275 17.7 6 18.15 38.324999999999996 23.549999999999997 19.975 7 17.925 16.8 43.1 22.175 8 20.424999999999997 22.475 28.449999999999996 28.65 9 22.125 25.174999999999997 28.7 24.0 10-14 22.134999999999998 29.17 26.790000000000003 21.905 15-19 22.095000000000002 28.04 28.325 21.54 20-24 22.465 28.310000000000002 27.865000000000002 21.36 25-29 22.767251344423784 28.160024124239836 27.536814595165097 21.535909936171283 30-34 22.80970625798212 28.316730523627076 28.163473818646235 20.71008939974457 35-39 22.75137619312156 28.04908842987728 27.786475430533812 21.41305994646735 40-44 22.975 28.110000000000003 28.555000000000003 20.36 45-49 22.79 28.18 28.53 20.5 50-54 23.29 27.83 28.225 20.655 55-59 23.44 27.875 27.900000000000002 20.785 60-64 23.235 28.860000000000003 27.875 20.03 65-69 23.24 28.9 27.560000000000002 20.3 70-74 23.64 28.395 27.48 20.485 75-79 23.62 28.04 27.894999999999996 20.445 80-84 22.685 28.199999999999996 28.455000000000002 20.66 85-89 23.385 28.21 28.084999999999997 20.32 90-94 23.400000000000002 28.815 27.725 20.06 95-99 23.805 28.835 27.615000000000002 19.744999999999997 100-104 23.205000000000002 28.165000000000003 27.839999999999996 20.79 105-109 23.565 28.74 27.560000000000002 20.135 110-114 23.89 28.475 27.435 20.200000000000003 115-119 23.724999999999998 28.605000000000004 27.63 20.04 120-124 23.84 28.095 27.815 20.25 125-129 23.78 27.91 28.050000000000004 20.26 130-134 23.865 27.700000000000003 27.839999999999996 20.595 135-139 23.945 28.51 27.68 19.865 140-144 24.025 28.470000000000002 27.065 20.44 145-149 24.735 28.199999999999996 27.515 19.55 150-151 25.137500000000003 27.875 27.2625 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 3.5 27 3.5 28 2.5 29 6.0 30 11.0 31 17.5 32 28.0 33 42.5 34 57.0 35 67.0 36 81.5 37 105.0 38 140.0 39 190.5 40 238.0 41 264.5 42 289.5 43 301.0 44 290.5 45 274.5 46 259.0 47 250.5 48 216.5 49 170.5 50 144.0 51 126.0 52 99.0 53 75.5 54 59.5 55 39.0 56 31.0 57 29.5 58 25.5 59 16.0 60 9.5 61 9.5 62 6.5 63 4.0 64 2.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.515 30-34 2.125 35-39 0.9950000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.575 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGGT 10 0.006882143 144.6375 4 >>END_MODULE Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra Read 720420 spots for SRR7172689.sra Written 720420 spots for SRR7172689.sra Read 720402 spots for SRR7172689.sra Written 720402 spots for SRR7172689.sra SRR ids: ['SRR7172689.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ndzxj31j SRR7172689.sra spots: 14408058 blocks: [[1, 720402], [720403, 1440804], [1440805, 2161206], [2161207, 2881608], [2881609, 3602010], [3602011, 4322412], [4322413, 5042814], [5042815, 5763216], [5763217, 6483618], [6483619, 7204020], [7204021, 7924422], [7924423, 8644824], [8644825, 9365226], [9365227, 10085628], [10085629, 10806030], [10806031, 11526432], [11526433, 12246834], [12246835, 12967236], [12967237, 13687638], [13687639, 14408058]] SRR7172689 file size 4860717 SRR7172689 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172689 SRR7172689_1.fastq SRR7172689_2.fastq Input file: SRR7172689_1.fastq Paired file: SRR7172689_2.fastq trimmed: SRR7172689-trimmed-pair1.fastq, SRR7172689-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:17:23 2025 >> started Mon Feb 10 17:17:39 2025 >> done (15.515s) 14408058 read pairs processed; of these: 11287 ( 0.08%) short read pairs filtered out after trimming by size control 10967 ( 0.08%) empty read pairs filtered out after trimming by size control 14385804 (99.85%) read pairs available; of these: 6591147 (45.82%) trimmed read pairs available after processing 7794657 (54.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 0 0.00% 24 4 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 1 0.00% 33 4 0.00% 34 3 0.00% 35 3 0.00% 36 5 0.00% 37 1 0.00% 38 5 0.00% 39 6 0.00% 40 4 0.00% 41 7 0.00% 42 9 0.00% 43 3 0.00% 44 5 0.00% 45 10 0.00% 46 8 0.00% 47 17 0.00% 48 15 0.00% 49 10 0.00% 50 20 0.00% 51 14 0.00% 52 24 0.00% 53 24 0.00% 54 31 0.00% 55 36 0.00% 56 33 0.00% 57 38 0.00% 58 53 0.00% 59 57 0.00% 60 62 0.00% 61 77 0.00% 62 75 0.00% 63 96 0.00% 64 100 0.00% 65 118 0.00% 66 121 0.00% 67 125 0.00% 68 163 0.00% 69 164 0.00% 70 221 0.00% 71 235 0.00% 72 274 0.00% 73 337 0.00% 74 386 0.00% 75 384 0.00% 76 494 0.00% 77 516 0.00% 78 555 0.00% 79 701 0.00% 80 796 0.01% 81 869 0.01% 82 1046 0.01% 83 1123 0.01% 84 1843 0.01% 85 2264 0.02% 86 2359 0.02% 87 2667 0.02% 88 2730 0.02% 89 2884 0.02% 90 3178 0.02% 91 3366 0.02% 92 3622 0.03% 93 3932 0.03% 94 4263 0.03% 95 4584 0.03% 96 4994 0.03% 97 5232 0.04% 98 5602 0.04% 99 5852 0.04% 100 6272 0.04% 101 6767 0.05% 102 7324 0.05% 103 7838 0.05% 104 8390 0.06% 105 8963 0.06% 106 9344 0.06% 107 10084 0.07% 108 10348 0.07% 109 11055 0.08% 110 11694 0.08% 111 12124 0.08% 112 13279 0.09% 113 13806 0.10% 114 14940 0.10% 115 15537 0.11% 116 15995 0.11% 117 17077 0.12% 118 17854 0.12% 119 18508 0.13% 120 19590 0.14% 121 20744 0.14% 122 21447 0.15% 123 22774 0.16% 124 24465 0.17% 125 25477 0.18% 126 26938 0.19% 127 28329 0.20% 128 29270 0.20% 129 31081 0.22% 130 32937 0.23% 131 34277 0.24% 132 36450 0.25% 133 39271 0.27% 134 41706 0.29% 135 44729 0.31% 136 47733 0.33% 137 51170 0.36% 138 55393 0.39% 139 60347 0.42% 140 66535 0.46% 141 73898 0.51% 142 83202 0.58% 143 95015 0.66% 144 111123 0.77% 145 133579 0.93% 146 168823 1.17% 147 229564 1.60% 148 350811 2.44% 149 694891 4.83% 150 3583499 24.91% 151 7794657 54.18% 14385804 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=493.32 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=35.5 sequence=CTTCTTCTTTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=19 prefix-density=0.34 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=437.08 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=34.4 sequence=AAGAAGAAGAAA SRR7172689 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:18:34 Started mapping on | Feb 10 17:18:35 Finished on | Feb 10 17:20:21 Mapping speed, Million of reads per hour | 488.57 Number of input reads | 14385804 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13541454 Uniquely mapped reads % | 94.13% Average mapped length | 296.01 Number of splices: Total | 14231828 Number of splices: Annotated (sjdb) | 13998840 Number of splices: GT/AG | 14007916 Number of splices: GC/AG | 178974 Number of splices: AT/AC | 10380 Number of splices: Non-canonical | 34558 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383972 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 22510 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.99% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 470725 470725 470725 N_multimapping 383972 383972 383972 N_noFeature 319679 13439474 358646 N_ambiguous 134334 801 70860 UnstrandedReadsAssigned:13087441 PositiveStrandReadsAssigned:101179 NegativeStrandReadsAssigned:13111948 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172689 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172689-trimmed-pair1.fastq SRR7172689-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,385,804 reads, 13,022,648 reads pseudoaligned [quant] estimated average fragment length: 252.359 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7172689.ke.tsv 34699 SRR7172689.se.tsv 87100 total ==> SRR7172689.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.64 1201 50.5974 Potri.005G024800.1.v4.1 1035 783.641 376 35.7112 Potri.004G059700.1.v4.1 961 709.686 187 19.6114 Potri.007G009000.2.v4.1 1416 1164.64 0 0 Potri.003G141000.2.v4.1 2943 2691.64 476.44 13.1742 Potri.016G087400.1.v4.1 270 73.9422 990 996.498 Potri.015G069301.1.v4.1 564 318.315 0 0 Potri.010G195200.1.v4.1 1773 1521.64 118.777 5.8097 Potri.012G127500.1.v4.1 977 725.666 2193 224.924 ==> SRR7172689.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 447 SRR7172689 completed mapping pipeline successfully