Starting /dee2/code/volunteer_pipeline.sh SRR7172690 current disk space = 3058917257216 free memory = 1269897100 SRR7172690 SRAfilesize 9c8cd4b6dd7b44d006d683370f262e3a SRR7172690.sra SRR7172690.sra file validated SRR7172690 is paired end SRR7172690 is conventional basespace SRR7172690 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172690_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.50825 18.0 18.0 30.0 18.0 32.0 2 30.297 31.0 29.0 33.0 27.0 33.0 3 31.79225 33.0 32.0 33.0 30.0 33.0 4 31.63725 33.0 32.0 33.0 30.0 33.0 5 32.63425 33.0 33.0 33.0 32.0 34.0 6 37.0775 38.0 37.0 38.0 36.0 38.0 7 37.5095 38.0 38.0 38.0 37.0 38.0 8 37.5805 38.0 38.0 38.0 38.0 38.0 9 37.6365 38.0 38.0 38.0 38.0 38.0 10-14 37.650349999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.615300000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.5925 38.0 38.0 38.0 38.0 38.0 25-29 37.59095 38.0 38.0 38.0 38.0 38.0 30-34 37.595549999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.5569 38.0 38.0 38.0 38.0 38.0 40-44 37.5216 38.0 38.0 38.0 38.0 38.0 45-49 37.49145 38.0 38.0 38.0 38.0 38.0 50-54 37.4258 38.0 38.0 38.0 37.6 38.0 55-59 37.344899999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.308949999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.26375 38.0 38.0 38.0 37.0 38.0 70-74 37.2736 38.0 38.0 38.0 36.6 38.0 75-79 37.1556 38.0 38.0 38.0 36.6 38.0 80-84 37.0662 38.0 38.0 38.0 36.2 38.0 85-89 36.9733 38.0 38.0 38.0 36.0 38.0 90-94 36.9746 38.0 38.0 38.0 35.8 38.0 95-99 37.010149999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.82455 38.0 38.0 38.0 35.4 38.0 105-109 36.64525 38.0 38.0 38.0 34.8 38.0 110-114 36.4375 38.0 38.0 38.0 34.0 38.0 115-119 36.4933 38.0 38.0 38.0 34.0 38.0 120-124 36.3786 38.0 38.0 38.0 34.0 38.0 125-129 36.137950000000004 38.0 37.4 38.0 33.4 38.0 130-134 35.5932 38.0 36.4 38.0 31.0 38.0 135-139 35.30515 38.0 36.0 38.0 30.6 38.0 140-144 35.2336 38.0 36.0 38.0 30.4 38.0 145-149 35.12945 38.0 36.0 38.0 31.0 38.0 150-151 32.206 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 2.0 21 2.0 22 6.0 23 5.0 24 6.0 25 11.0 26 11.0 27 13.0 28 17.0 29 21.0 30 33.0 31 40.0 32 45.0 33 86.0 34 132.0 35 223.0 36 610.0 37 2727.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.288809584501657 12.286515421871016 16.951312770838644 41.47336222278869 2 19.3158953722334 20.4476861167002 38.90845070422535 21.32796780684105 3 19.7 25.75 25.900000000000002 28.65 4 22.375 33.475 22.025 22.125 5 22.5 36.075 24.4 17.025000000000002 6 17.525 36.4 26.05 20.025000000000002 7 12.6 21.05 45.425 20.925 8 17.925 22.325 32.375 27.375 9 18.4 22.175 33.775 25.650000000000002 10-14 19.445 29.160000000000004 27.650000000000002 23.745 15-19 19.765 28.275 27.965 23.995 20-24 19.139999999999997 28.110000000000003 28.775000000000002 23.974999999999998 25-29 19.8 28.565 28.17 23.465 30-34 20.055 28.389999999999997 28.32 23.235 35-39 20.135 29.005 27.389999999999997 23.47 40-44 19.38 29.409999999999997 27.744999999999997 23.465 45-49 20.005 27.925 28.249999999999996 23.82 50-54 19.88 28.375 27.85 23.895 55-59 19.685 29.03 27.68 23.605 60-64 19.7 28.065 28.375 23.86 65-69 20.03 28.07 27.834999999999997 24.065 70-74 20.055 28.060000000000002 28.12 23.765 75-79 19.97 28.59 27.839999999999996 23.599999999999998 80-84 20.225 27.415 28.470000000000002 23.89 85-89 20.064999999999998 28.360000000000003 27.965 23.61 90-94 20.28 28.16 27.584999999999997 23.974999999999998 95-99 19.88 27.744999999999997 28.065 24.310000000000002 100-104 20.26 28.96 27.375 23.405 105-109 20.055 28.465 27.82 23.66 110-114 20.195 28.16 28.01 23.635 115-119 20.685000000000002 28.255000000000003 27.400000000000002 23.66 120-124 20.61 27.85 27.884999999999998 23.655 125-129 20.07 28.310000000000002 27.800000000000004 23.82 130-134 20.195 28.48 27.83 23.494999999999997 135-139 20.380000000000003 27.694999999999997 28.18 23.745 140-144 20.7 28.444999999999997 27.175 23.68 145-149 20.49 28.544999999999998 27.325 23.64 150-151 21.05 27.3875 27.437499999999996 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 1.5 24 2.5 25 2.0 26 2.0 27 5.0 28 5.0 29 9.5 30 17.5 31 24.0 32 36.0 33 43.0 34 49.0 35 72.0 36 96.0 37 129.0 38 155.5 39 179.0 40 203.0 41 228.5 42 261.0 43 275.5 44 290.5 45 284.5 46 267.5 47 249.0 48 218.0 49 181.5 50 147.5 51 126.0 52 110.0 53 85.0 54 56.5 55 38.5 56 28.0 57 25.0 58 24.5 59 17.0 60 10.0 61 8.5 62 7.5 63 5.5 64 5.5 65 5.5 66 2.0 67 0.0 68 1.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.7000000000000002 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172690 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172690_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18475 34.0 33.0 34.0 33.0 34.0 2 33.219 34.0 33.0 34.0 33.0 34.0 3 33.25 34.0 33.0 34.0 33.0 34.0 4 33.297 34.0 33.0 34.0 33.0 34.0 5 33.2285 34.0 33.0 34.0 33.0 34.0 6 37.34 38.0 38.0 38.0 38.0 38.0 7 37.40075 38.0 38.0 38.0 38.0 38.0 8 37.41875 38.0 38.0 38.0 38.0 38.0 9 37.42675 38.0 38.0 38.0 38.0 38.0 10-14 37.3781 38.0 38.0 38.0 38.0 38.0 15-19 37.39945 38.0 38.0 38.0 38.0 38.0 20-24 37.38245 38.0 38.0 38.0 38.0 38.0 25-29 37.0971 38.0 38.0 38.0 37.6 38.0 30-34 36.610949999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.84905 38.0 38.0 38.0 37.0 38.0 40-44 37.20635 38.0 38.0 38.0 37.0 38.0 45-49 37.2383 38.0 38.0 38.0 37.0 38.0 50-54 37.23055 38.0 38.0 38.0 37.0 38.0 55-59 37.1438 38.0 38.0 38.0 37.0 38.0 60-64 36.9582 38.0 38.0 38.0 36.2 38.0 65-69 36.937650000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.920849999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.94735000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.9226 38.0 38.0 38.0 36.0 38.0 85-89 36.7974 38.0 38.0 38.0 36.0 38.0 90-94 36.7427 38.0 38.0 38.0 35.4 38.0 95-99 36.6822 38.0 38.0 38.0 35.0 38.0 100-104 36.64755 38.0 38.0 38.0 35.0 38.0 105-109 36.4464 38.0 38.0 38.0 34.0 38.0 110-114 36.3515 38.0 38.0 38.0 34.0 38.0 115-119 36.17665 38.0 38.0 38.0 33.8 38.0 120-124 35.9942 38.0 37.8 38.0 33.2 38.0 125-129 35.676 38.0 37.4 38.0 31.8 38.0 130-134 35.42155 38.0 36.4 38.0 31.0 38.0 135-139 35.09245 38.0 36.0 38.0 30.2 38.0 140-144 34.742200000000004 38.0 36.0 38.0 28.0 38.0 145-149 34.291 38.0 35.4 38.0 26.8 38.0 150-151 29.881625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 3.0 18 4.0 19 4.0 20 5.0 21 7.0 22 9.0 23 9.0 24 12.0 25 12.0 26 18.0 27 13.0 28 34.0 29 33.0 30 33.0 31 45.0 32 55.0 33 92.0 34 115.0 35 221.0 36 531.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.125 15.275 17.525 34.075 2 23.95 22.575 36.7 16.775000000000002 3 18.95 27.800000000000004 31.25 22.0 4 24.425 33.875 22.075 19.625 5 22.825 37.025000000000006 22.25 17.9 6 17.625 38.4 24.425 19.55 7 17.875 16.675 43.375 22.075 8 21.125 21.825 28.525 28.525 9 22.0 24.0 28.775000000000002 25.224999999999998 10-14 22.245 28.975 27.305 21.475 15-19 22.775000000000002 27.634999999999998 28.294999999999998 21.295 20-24 22.81 28.07 28.175 20.945 25-29 22.7393817542096 28.76602161347072 27.89143000753958 20.603166624780094 30-34 23.051815585475318 27.99877600979192 27.983476132190944 20.96593227254182 35-39 22.84374054272168 28.356703318874203 27.93806113184707 20.861495006557046 40-44 22.965 28.134999999999998 27.96 20.94 45-49 22.535 28.310000000000002 28.92 20.235 50-54 23.3 27.71 28.985 20.005 55-59 23.525 28.355000000000004 27.735 20.385 60-64 23.075000000000003 28.035 28.375 20.515 65-69 23.549999999999997 28.155 28.095 20.200000000000003 70-74 23.54 27.839999999999996 27.825 20.794999999999998 75-79 23.375 27.96 27.97 20.695 80-84 23.565 27.994999999999997 27.785 20.655 85-89 23.974999999999998 27.55 28.15 20.325 90-94 23.400000000000002 27.98 28.325 20.294999999999998 95-99 23.585 28.18 27.200000000000003 21.035 100-104 23.84 28.355000000000004 27.47 20.335 105-109 23.69 28.28 28.444999999999997 19.585 110-114 23.865 27.800000000000004 27.855 20.48 115-119 23.65 27.875 28.134999999999998 20.34 120-124 23.674999999999997 28.34 27.63 20.355 125-129 23.22 28.395 27.465 20.919999999999998 130-134 24.39 28.075 28.249999999999996 19.285 135-139 24.93 28.265 26.979999999999997 19.825 140-144 23.855 28.499999999999996 27.505000000000003 20.14 145-149 24.16 27.875 27.76 20.205000000000002 150-151 23.9875 28.625 26.625 20.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.5 25 3.0 26 2.0 27 4.0 28 8.0 29 7.5 30 8.5 31 15.5 32 20.0 33 28.5 34 39.5 35 60.0 36 83.5 37 118.5 38 152.0 39 168.0 40 208.0 41 249.0 42 290.5 43 311.0 44 303.0 45 282.5 46 263.5 47 255.5 48 228.5 49 198.5 50 162.5 51 127.5 52 97.0 53 74.0 54 62.5 55 49.0 56 31.5 57 22.0 58 16.5 59 9.0 60 5.0 61 4.0 62 5.5 63 5.5 64 4.0 65 3.5 66 2.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.525 30-34 1.96 35-39 0.8699999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.6499999999999999 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.55 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.4 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTGCA 10 0.0068963906 144.5375 145 >>END_MODULE Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663768 spots for SRR7172690.sra Written 663768 spots for SRR7172690.sra Read 663771 spots for SRR7172690.sra Written 663771 spots for SRR7172690.sra SRR ids: ['SRR7172690.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l5m5oppz SRR7172690.sra spots: 13275363 blocks: [[1, 663768], [663769, 1327536], [1327537, 1991304], [1991305, 2655072], [2655073, 3318840], [3318841, 3982608], [3982609, 4646376], [4646377, 5310144], [5310145, 5973912], [5973913, 6637680], [6637681, 7301448], [7301449, 7965216], [7965217, 8628984], [8628985, 9292752], [9292753, 9956520], [9956521, 10620288], [10620289, 11284056], [11284057, 11947824], [11947825, 12611592], [12611593, 13275363]] SRR7172690 file size 4476884 SRR7172690 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172690 SRR7172690_1.fastq SRR7172690_2.fastq Input file: SRR7172690_1.fastq Paired file: SRR7172690_2.fastq trimmed: SRR7172690-trimmed-pair1.fastq, SRR7172690-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:25:02 2025 >> started Mon Feb 10 13:25:22 2025 >> done (19.754s) 13275363 read pairs processed; of these: 9318 ( 0.07%) short read pairs filtered out after trimming by size control 6994 ( 0.05%) empty read pairs filtered out after trimming by size control 13259051 (99.88%) read pairs available; of these: 5328601 (40.19%) trimmed read pairs available after processing 7930450 (59.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 4 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 5 0.00% 39 4 0.00% 40 3 0.00% 41 4 0.00% 42 3 0.00% 43 2 0.00% 44 5 0.00% 45 4 0.00% 46 13 0.00% 47 9 0.00% 48 9 0.00% 49 10 0.00% 50 13 0.00% 51 13 0.00% 52 7 0.00% 53 19 0.00% 54 15 0.00% 55 16 0.00% 56 23 0.00% 57 24 0.00% 58 21 0.00% 59 36 0.00% 60 28 0.00% 61 40 0.00% 62 48 0.00% 63 54 0.00% 64 60 0.00% 65 80 0.00% 66 82 0.00% 67 94 0.00% 68 96 0.00% 69 126 0.00% 70 137 0.00% 71 136 0.00% 72 171 0.00% 73 225 0.00% 74 201 0.00% 75 260 0.00% 76 354 0.00% 77 361 0.00% 78 404 0.00% 79 447 0.00% 80 497 0.00% 81 595 0.00% 82 646 0.00% 83 880 0.01% 84 1388 0.01% 85 1765 0.01% 86 1854 0.01% 87 2165 0.02% 88 2121 0.02% 89 2192 0.02% 90 2390 0.02% 91 2470 0.02% 92 2697 0.02% 93 2955 0.02% 94 3086 0.02% 95 3353 0.03% 96 3664 0.03% 97 4049 0.03% 98 4047 0.03% 99 4397 0.03% 100 4841 0.04% 101 5057 0.04% 102 5607 0.04% 103 5827 0.04% 104 6379 0.05% 105 6865 0.05% 106 7356 0.06% 107 7613 0.06% 108 8402 0.06% 109 8626 0.07% 110 9269 0.07% 111 9986 0.08% 112 10627 0.08% 113 11352 0.09% 114 12086 0.09% 115 12777 0.10% 116 13104 0.10% 117 13902 0.10% 118 14679 0.11% 119 15426 0.12% 120 16153 0.12% 121 16913 0.13% 122 17744 0.13% 123 18538 0.14% 124 19635 0.15% 125 20884 0.16% 126 21700 0.16% 127 22833 0.17% 128 24013 0.18% 129 25150 0.19% 130 26305 0.20% 131 27907 0.21% 132 29284 0.22% 133 30887 0.23% 134 32881 0.25% 135 34736 0.26% 136 37176 0.28% 137 39720 0.30% 138 42371 0.32% 139 45499 0.34% 140 49006 0.37% 141 54355 0.41% 142 59464 0.45% 143 66948 0.50% 144 76789 0.58% 145 92402 0.70% 146 115970 0.87% 147 156018 1.18% 148 239752 1.81% 149 579775 4.37% 150 3047106 22.98% 151 7930450 59.81% 13259051 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=116.63 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.9 sequence=GCACCACCACCATG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=59.64 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=9.5 sequence=TGATTTTGATCAGTATGGCTGAGGAAAACAAGAGCCATGAGTATGAGACCAAAGTTGGTGAAGAGAGTGGT SRR7172690 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:26:09 Started mapping on | Feb 10 13:26:09 Finished on | Feb 10 13:27:52 Mapping speed, Million of reads per hour | 463.42 Number of input reads | 13259051 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12500668 Uniquely mapped reads % | 94.28% Average mapped length | 296.79 Number of splices: Total | 12706299 Number of splices: Annotated (sjdb) | 12474810 Number of splices: GT/AG | 12507649 Number of splices: GC/AG | 159485 Number of splices: AT/AC | 9246 Number of splices: Non-canonical | 29919 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316064 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 31757 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451425 451425 451425 N_multimapping 316064 316064 316064 N_noFeature 294632 12397848 338532 N_ambiguous 129288 914 69715 UnstrandedReadsAssigned:12076748 PositiveStrandReadsAssigned:101906 NegativeStrandReadsAssigned:12092421 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172690 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172690-trimmed-pair1.fastq SRR7172690-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,259,051 reads, 12,007,527 reads pseudoaligned [quant] estimated average fragment length: 253.798 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7172690.ke.tsv 34699 SRR7172690.se.tsv 87100 total ==> SRR7172690.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.2 1072 50.857 Potri.005G024800.1.v4.1 1035 782.202 698 74.7285 Potri.004G059700.1.v4.1 961 708.234 14 1.65539 Potri.007G009000.2.v4.1 1416 1163.2 0 0 Potri.003G141000.2.v4.1 2943 2690.2 550 17.1209 Potri.016G087400.1.v4.1 270 72.626 827 953.594 Potri.015G069301.1.v4.1 564 316.555 0 0 Potri.010G195200.1.v4.1 1773 1520.2 217.745 11.9949 Potri.012G127500.1.v4.1 977 724.228 734 84.8733 ==> SRR7172690.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 121 SRR7172690 completed mapping pipeline successfully