Starting /dee2/code/volunteer_pipeline.sh SRR7172691 current disk space = 3058956681216 free memory = 1443590172 SRR7172691 SRAfilesize eab5ff16a17f577b32dd29a6ae6c3780 SRR7172691.sra SRR7172691.sra file validated SRR7172691 is paired end SRR7172691 is conventional basespace SRR7172691 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172691_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8365 33.0 33.0 33.0 31.0 34.0 2 32.54075 33.0 33.0 34.0 32.0 34.0 3 32.14575 33.0 32.0 33.0 30.0 34.0 4 32.203 33.0 33.0 33.0 30.0 34.0 5 32.73225 33.0 33.0 34.0 32.0 34.0 6 37.02325 38.0 37.0 38.0 36.0 38.0 7 37.435 38.0 38.0 38.0 37.0 38.0 8 37.54375 38.0 38.0 38.0 37.0 38.0 9 37.5835 38.0 38.0 38.0 38.0 38.0 10-14 37.6177 38.0 38.0 38.0 38.0 38.0 15-19 37.637950000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.60005 38.0 38.0 38.0 38.0 38.0 25-29 37.62135 38.0 38.0 38.0 38.0 38.0 30-34 37.62475 38.0 38.0 38.0 38.0 38.0 35-39 37.6026 38.0 38.0 38.0 38.0 38.0 40-44 37.526149999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.5208 38.0 38.0 38.0 38.0 38.0 50-54 37.45035 38.0 38.0 38.0 37.4 38.0 55-59 37.340500000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.334649999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2626 38.0 38.0 38.0 37.0 38.0 70-74 37.133599999999994 38.0 38.0 38.0 36.6 38.0 75-79 37.15325 38.0 38.0 38.0 36.4 38.0 80-84 37.0502 38.0 38.0 38.0 36.0 38.0 85-89 36.821349999999995 38.0 38.0 38.0 35.4 38.0 90-94 36.92725 38.0 38.0 38.0 35.8 38.0 95-99 36.90815 38.0 38.0 38.0 35.8 38.0 100-104 36.712500000000006 38.0 38.0 38.0 34.6 38.0 105-109 36.317350000000005 38.0 38.0 38.0 33.8 38.0 110-114 36.2069 38.0 37.6 38.0 33.4 38.0 115-119 36.168600000000005 38.0 37.4 38.0 33.6 38.0 120-124 36.25335 38.0 38.0 38.0 34.0 38.0 125-129 36.0236 38.0 37.4 38.0 33.4 38.0 130-134 35.7015 38.0 36.4 38.0 31.4 38.0 135-139 35.25555 38.0 36.0 38.0 28.8 38.0 140-144 35.35875 38.0 36.0 38.0 30.4 38.0 145-149 35.02315 38.0 35.8 38.0 30.0 38.0 150-151 31.549875 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 3.0 20 4.0 21 2.0 22 2.0 23 3.0 24 5.0 25 5.0 26 6.0 27 15.0 28 21.0 29 30.0 30 35.0 31 46.0 32 75.0 33 94.0 34 120.0 35 228.0 36 573.0 37 2728.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.547770700636946 13.121019108280255 11.668789808917197 40.66242038216561 2 19.05120481927711 18.90060240963855 40.81325301204819 21.234939759036145 3 19.5 24.8 27.675 28.025 4 21.825 34.275 21.675 22.225 5 22.8 34.599999999999994 25.0 17.599999999999998 6 16.400000000000002 36.825 26.3 20.474999999999998 7 12.775 23.1 44.75 19.375 8 18.95 21.675 30.875000000000004 28.499999999999996 9 17.424999999999997 22.55 33.6 26.424999999999997 10-14 20.419999999999998 29.185 27.02 23.375 15-19 19.555 28.285 28.065 24.095 20-24 19.919999999999998 28.585 28.470000000000002 23.025000000000002 25-29 20.05 28.410000000000004 27.92 23.62 30-34 19.400000000000002 28.715000000000003 27.894999999999996 23.990000000000002 35-39 20.044999999999998 28.42 27.575 23.96 40-44 20.61 28.1 27.755000000000003 23.535 45-49 19.845 28.005000000000003 28.24 23.91 50-54 19.785 28.525 28.449999999999996 23.24 55-59 20.285 28.54 27.43 23.745 60-64 19.685 28.549999999999997 28.365000000000002 23.400000000000002 65-69 19.805 28.205000000000002 28.09 23.9 70-74 20.36 28.04 28.185 23.415 75-79 20.095 28.055000000000003 28.18 23.669999999999998 80-84 20.080000000000002 27.725 28.449999999999996 23.745 85-89 20.46 28.275 27.939999999999998 23.325000000000003 90-94 20.115 28.07 28.605000000000004 23.21 95-99 20.625 28.134999999999998 28.249999999999996 22.99 100-104 20.79 28.51 27.245 23.455000000000002 105-109 20.7 28.595 27.089999999999996 23.615 110-114 21.093984586127515 28.790911820638577 27.07937143429086 23.03573215894305 115-119 21.43 28.405 27.169999999999998 22.994999999999997 120-124 20.8 28.549999999999997 27.105 23.544999999999998 125-129 21.01 28.535 26.93 23.525 130-134 20.979999999999997 28.52 26.75 23.75 135-139 20.54 28.62 26.775 24.065 140-144 21.060000000000002 28.775000000000002 26.169999999999998 23.995 145-149 21.095 29.53 25.580000000000002 23.794999999999998 150-151 20.599999999999998 28.7375 26.424999999999997 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 2.5 25 4.5 26 6.5 27 8.5 28 8.5 29 8.0 30 11.0 31 19.5 32 27.5 33 43.0 34 72.0 35 74.0 36 81.0 37 113.5 38 138.5 39 168.0 40 216.0 41 247.5 42 259.0 43 276.5 44 280.0 45 278.0 46 272.0 47 246.5 48 216.0 49 198.5 50 166.0 51 124.5 52 96.0 53 78.5 54 70.5 55 54.5 56 33.0 57 23.5 58 18.0 59 10.5 60 7.5 61 7.5 62 6.5 63 6.5 64 5.0 65 2.5 66 3.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.9 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 5.925000000000001 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.7 0.0 0.0 0.0 0.0 132-133 8.399999999999999 0.0 0.0 0.0 0.0 134-135 9.024999999999999 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0035561158 20.694643 135-139 >>END_MODULE SRR7172691 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172691_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14675 34.0 33.0 34.0 33.0 34.0 2 33.25 34.0 33.0 34.0 33.0 34.0 3 33.249 34.0 33.0 34.0 33.0 34.0 4 33.24175 34.0 33.0 34.0 33.0 34.0 5 33.25425 34.0 33.0 34.0 33.0 34.0 6 37.392 38.0 38.0 38.0 38.0 38.0 7 37.40125 38.0 38.0 38.0 38.0 38.0 8 37.3385 38.0 38.0 38.0 38.0 38.0 9 37.2635 38.0 38.0 38.0 37.0 38.0 10-14 37.32645 38.0 38.0 38.0 38.0 38.0 15-19 37.318200000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.2996 38.0 38.0 38.0 37.8 38.0 25-29 37.0071 38.0 38.0 38.0 37.2 38.0 30-34 36.3979 38.0 38.0 38.0 36.4 38.0 35-39 36.63305 38.0 38.0 38.0 36.0 38.0 40-44 37.134699999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.17635 38.0 38.0 38.0 37.0 38.0 50-54 37.11555 38.0 38.0 38.0 37.0 38.0 55-59 37.046749999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.9687 38.0 38.0 38.0 36.0 38.0 65-69 36.8923 38.0 38.0 38.0 36.0 38.0 70-74 36.862199999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.800799999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.831 38.0 38.0 38.0 36.0 38.0 85-89 36.7217 38.0 38.0 38.0 35.6 38.0 90-94 36.58825 38.0 38.0 38.0 35.2 38.0 95-99 36.537600000000005 38.0 38.0 38.0 34.8 38.0 100-104 36.339549999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.312200000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.17725 38.0 38.0 38.0 34.0 38.0 115-119 36.00815000000001 38.0 37.8 38.0 33.4 38.0 120-124 35.74335 38.0 37.2 38.0 31.6 38.0 125-129 35.531400000000005 38.0 36.8 38.0 31.6 38.0 130-134 35.23075 38.0 36.0 38.0 29.6 38.0 135-139 34.98395000000001 38.0 36.0 38.0 28.4 38.0 140-144 34.434599999999996 38.0 35.6 38.0 26.0 38.0 145-149 33.44305 38.0 33.2 38.0 19.2 38.0 150-151 28.998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 2.0 6 2.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 2.0 15 4.0 16 4.0 17 3.0 18 2.0 19 0.0 20 6.0 21 5.0 22 10.0 23 12.0 24 9.0 25 14.0 26 14.0 27 18.0 28 17.0 29 32.0 30 46.0 31 45.0 32 58.0 33 98.0 34 146.0 35 293.0 36 520.0 37 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.375 14.174999999999999 18.6 31.85 2 24.075 22.400000000000002 36.575 16.950000000000003 3 21.349999999999998 25.4 31.974999999999998 21.275 4 23.9 34.825 21.475 19.8 5 24.175 35.3 23.225 17.299999999999997 6 18.85 37.15 24.425 19.575 7 18.375 16.725 43.725 21.175 8 20.5 22.3 29.375 27.825 9 23.275000000000002 23.375 28.625 24.725 10-14 22.675 28.34 27.250000000000004 21.735 15-19 22.71 27.62 28.395 21.275 20-24 22.82 28.575 27.905 20.7 25-29 23.55991943605237 28.036253776435043 28.036253776435043 20.367573011077543 30-34 22.87762416794675 28.42805939580133 27.880184331797235 20.814132104454686 35-39 23.012742718446603 28.236245954692556 27.771035598705502 20.97997572815534 40-44 23.085 28.12 27.875 20.919999999999998 45-49 22.685 28.515 28.24 20.560000000000002 50-54 23.595 28.22 27.884999999999998 20.3 55-59 23.185 28.255000000000003 28.52 20.04 60-64 23.36 28.205000000000002 27.77 20.665 65-69 23.24 28.155 28.144999999999996 20.46 70-74 23.165 28.305000000000003 28.12 20.41 75-79 23.294999999999998 28.17 27.825 20.71 80-84 23.415 28.910000000000004 27.38 20.294999999999998 85-89 23.16 28.549999999999997 27.46 20.830000000000002 90-94 23.400000000000002 28.53 27.235 20.835 95-99 23.645 28.685 27.405 20.265 100-104 23.98 27.725 28.249999999999996 20.044999999999998 105-109 24.075 27.51 28.335 20.080000000000002 110-114 24.035 27.889999999999997 27.544999999999998 20.53 115-119 24.33 28.335 27.345000000000002 19.99 120-124 24.425 28.29 27.015 20.27 125-129 24.779999999999998 28.365000000000002 26.945000000000004 19.91 130-134 24.775 28.610000000000003 26.82 19.794999999999998 135-139 24.865000000000002 27.985 26.900000000000002 20.25 140-144 25.069999999999997 28.444999999999997 27.13 19.355 145-149 25.965 27.725 27.034999999999997 19.275000000000002 150-151 25.5375 28.4125 26.9125 19.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 4.5 26 3.0 27 3.5 28 6.5 29 8.5 30 14.5 31 14.5 32 15.0 33 33.0 34 53.0 35 68.5 36 89.0 37 117.5 38 148.0 39 178.5 40 211.5 41 246.5 42 272.0 43 291.0 44 290.5 45 289.0 46 273.5 47 237.5 48 224.0 49 200.5 50 157.5 51 118.5 52 101.5 53 79.0 54 53.5 55 49.5 56 35.0 57 20.5 58 21.0 59 18.5 60 10.5 61 5.0 62 6.5 63 7.0 64 5.0 65 2.5 66 2.5 67 3.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.7000000000000001 30-34 2.35 35-39 1.1199999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.9 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.65 0.0 0.0 0.0 0.0 128-129 7.0875 0.0 0.0 0.0 0.0 130-131 7.6375 0.0 0.0 0.0 0.0 132-133 8.325 0.0 0.0 0.0 0.0 134-135 8.975000000000001 0.0 0.0 0.0 0.0 136-137 9.7 0.0 0.0 0.0 0.0 138-139 10.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 20 0.006046358 28.890001 80-84 AAAAAAA 50 0.0013641393 17.334 140-144 >>END_MODULE Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699954 spots for SRR7172691.sra Written 699954 spots for SRR7172691.sra Read 699965 spots for SRR7172691.sra Written 699965 spots for SRR7172691.sra SRR ids: ['SRR7172691.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w9p4xumr SRR7172691.sra spots: 13999091 blocks: [[1, 699954], [699955, 1399908], [1399909, 2099862], [2099863, 2799816], [2799817, 3499770], [3499771, 4199724], [4199725, 4899678], [4899679, 5599632], [5599633, 6299586], [6299587, 6999540], [6999541, 7699494], [7699495, 8399448], [8399449, 9099402], [9099403, 9799356], [9799357, 10499310], [10499311, 11199264], [11199265, 11899218], [11899219, 12599172], [12599173, 13299126], [13299127, 13999091]] SRR7172691 file size 4722132 SRR7172691 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172691 SRR7172691_1.fastq SRR7172691_2.fastq Input file: SRR7172691_1.fastq Paired file: SRR7172691_2.fastq trimmed: SRR7172691-trimmed-pair1.fastq, SRR7172691-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:23:22 2025 >> started Mon Feb 10 13:23:46 2025 >> done (23.077s) 13999091 read pairs processed; of these: 10325 ( 0.07%) short read pairs filtered out after trimming by size control 7875 ( 0.06%) empty read pairs filtered out after trimming by size control 13980891 (99.87%) read pairs available; of these: 7512131 (53.73%) trimmed read pairs available after processing 6468760 (46.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 0 0.00% 25 3 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 0 0.00% 32 3 0.00% 33 5 0.00% 34 4 0.00% 35 6 0.00% 36 5 0.00% 37 3 0.00% 38 2 0.00% 39 5 0.00% 40 8 0.00% 41 4 0.00% 42 7 0.00% 43 12 0.00% 44 14 0.00% 45 22 0.00% 46 25 0.00% 47 16 0.00% 48 24 0.00% 49 33 0.00% 50 42 0.00% 51 56 0.00% 52 50 0.00% 53 55 0.00% 54 73 0.00% 55 89 0.00% 56 105 0.00% 57 102 0.00% 58 146 0.00% 59 139 0.00% 60 195 0.00% 61 189 0.00% 62 243 0.00% 63 262 0.00% 64 337 0.00% 65 357 0.00% 66 394 0.00% 67 429 0.00% 68 541 0.00% 69 597 0.00% 70 800 0.01% 71 834 0.01% 72 1021 0.01% 73 1236 0.01% 74 1290 0.01% 75 1495 0.01% 76 1672 0.01% 77 1868 0.01% 78 2124 0.02% 79 2316 0.02% 80 2704 0.02% 81 3087 0.02% 82 3537 0.03% 83 4216 0.03% 84 4986 0.04% 85 5960 0.04% 86 6438 0.05% 87 6866 0.05% 88 7547 0.05% 89 7915 0.06% 90 8669 0.06% 91 9578 0.07% 92 10251 0.07% 93 11185 0.08% 94 12014 0.09% 95 12991 0.09% 96 13993 0.10% 97 14716 0.11% 98 15439 0.11% 99 16475 0.12% 100 17538 0.13% 101 18478 0.13% 102 19687 0.14% 103 21113 0.15% 104 22115 0.16% 105 23435 0.17% 106 24602 0.18% 107 25893 0.19% 108 26698 0.19% 109 27500 0.20% 110 28510 0.20% 111 29974 0.21% 112 31458 0.23% 113 32407 0.23% 114 34068 0.24% 115 35326 0.25% 116 36549 0.26% 117 37800 0.27% 118 38494 0.28% 119 39091 0.28% 120 40747 0.29% 121 41893 0.30% 122 42864 0.31% 123 44487 0.32% 124 46683 0.33% 125 47686 0.34% 126 49542 0.35% 127 50691 0.36% 128 51945 0.37% 129 52787 0.38% 130 54394 0.39% 131 56063 0.40% 132 58098 0.42% 133 60110 0.43% 134 62814 0.45% 135 64784 0.46% 136 67278 0.48% 137 70152 0.50% 138 73312 0.52% 139 76723 0.55% 140 80682 0.58% 141 85351 0.61% 142 92013 0.66% 143 101111 0.72% 144 111753 0.80% 145 129314 0.92% 146 156286 1.12% 147 202511 1.45% 148 307724 2.20% 149 692879 4.96% 150 3670876 26.26% 151 6468760 46.27% 13980891 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=146.88 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.0 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=25 prefix-density=0.33 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=99.02 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=15.7 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172691 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:24:34 Started mapping on | Feb 10 13:24:34 Finished on | Feb 10 13:28:20 Mapping speed, Million of reads per hour | 222.70 Number of input reads | 13980891 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12945811 Uniquely mapped reads % | 92.60% Average mapped length | 291.53 Number of splices: Total | 12809161 Number of splices: Annotated (sjdb) | 12565506 Number of splices: GT/AG | 12604852 Number of splices: GC/AG | 161938 Number of splices: AT/AC | 9024 Number of splices: Non-canonical | 33347 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352844 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 78972 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.21% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 691741 691741 691741 N_multimapping 352844 352844 352844 N_noFeature 339399 12831863 386725 N_ambiguous 130291 700 63230 UnstrandedReadsAssigned:12476121 PositiveStrandReadsAssigned:113248 NegativeStrandReadsAssigned:12495856 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172691 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172691-trimmed-pair1.fastq SRR7172691-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,980,891 reads, 12,501,438 reads pseudoaligned [quant] estimated average fragment length: 223.218 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7172691.ke.tsv 34699 SRR7172691.se.tsv 87100 total ==> SRR7172691.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.78 1856 85.6815 Potri.005G024800.1.v4.1 1035 812.782 407 41.5129 Potri.004G059700.1.v4.1 961 738.799 9 1.0099 Potri.007G009000.2.v4.1 1416 1193.78 0 0 Potri.003G141000.2.v4.1 2943 2720.78 629 19.1655 Potri.016G087400.1.v4.1 270 90.6182 956 874.591 Potri.015G069301.1.v4.1 564 345.127 0 0 Potri.010G195200.1.v4.1 1773 1550.78 677 36.191 Potri.012G127500.1.v4.1 977 754.793 3991 438.345 ==> SRR7172691.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 167 SRR7172691 completed mapping pipeline successfully