Starting /dee2/code/volunteer_pipeline.sh SRR7172692 current disk space = 3058887725056 free memory = 1125447656 SRR7172692 SRAfilesize e8a5dd5e7bd6a744fea81682b2d9c433 SRR7172692.sra SRR7172692.sra file validated SRR7172692 is paired end SRR7172692 is conventional basespace SRR7172692 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.5845 18.0 18.0 30.0 18.0 32.0 2 24.278 25.0 18.0 32.0 18.0 33.0 3 27.08425 28.0 25.0 31.0 18.0 33.0 4 31.1315 32.0 32.0 33.0 27.0 33.0 5 32.30125 33.0 32.0 33.0 32.0 33.0 6 37.15 38.0 37.0 38.0 36.0 38.0 7 37.45825 38.0 38.0 38.0 37.0 38.0 8 37.576 38.0 38.0 38.0 38.0 38.0 9 37.5465 38.0 38.0 38.0 37.0 38.0 10-14 37.60775 38.0 38.0 38.0 38.0 38.0 15-19 37.60275 38.0 38.0 38.0 38.0 38.0 20-24 37.561449999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.632349999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.60205 38.0 38.0 38.0 38.0 38.0 35-39 37.6182 38.0 38.0 38.0 38.0 38.0 40-44 37.50395 38.0 38.0 38.0 38.0 38.0 45-49 37.4814 38.0 38.0 38.0 38.0 38.0 50-54 37.41495 38.0 38.0 38.0 37.4 38.0 55-59 37.3203 38.0 38.0 38.0 37.0 38.0 60-64 37.254000000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.23375 38.0 38.0 38.0 36.6 38.0 70-74 37.13305 38.0 38.0 38.0 36.0 38.0 75-79 37.04010000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.92715 38.0 38.0 38.0 35.8 38.0 85-89 36.82770000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.856399999999994 38.0 38.0 38.0 35.6 38.0 95-99 36.8245 38.0 38.0 38.0 35.4 38.0 100-104 36.62855 38.0 38.0 38.0 34.4 38.0 105-109 36.41435 38.0 38.0 38.0 34.0 38.0 110-114 36.258599999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.05305 38.0 37.4 38.0 33.2 38.0 120-124 36.0418 38.0 37.4 38.0 33.4 38.0 125-129 35.816050000000004 38.0 36.8 38.0 32.0 38.0 130-134 35.31535 38.0 36.0 38.0 29.0 38.0 135-139 35.029399999999995 38.0 35.4 38.0 28.2 38.0 140-144 34.8722 38.0 35.2 38.0 28.2 38.0 145-149 34.38825 38.0 35.0 38.0 27.4 38.0 150-151 30.253375 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 1.0 19 0.0 20 3.0 21 4.0 22 3.0 23 6.0 24 9.0 25 12.0 26 12.0 27 12.0 28 14.0 29 32.0 30 23.0 31 58.0 32 68.0 33 100.0 34 168.0 35 285.0 36 800.0 37 2381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.69583118888317 12.660833762223367 13.973237261966032 36.67009778692743 2 19.74052403968456 18.621215975578735 41.56703128974816 20.07122869498855 3 18.025 25.575 29.025000000000002 27.375 4 21.3 34.925 23.799999999999997 19.975 5 20.9 36.199999999999996 25.025 17.875 6 16.275000000000002 37.75 25.174999999999997 20.8 7 13.475000000000001 20.724999999999998 46.85 18.95 8 17.9 22.225 29.65 30.225 9 18.35 22.975 31.900000000000002 26.775 10-14 20.095 29.439999999999998 27.279999999999998 23.185 15-19 20.16 28.58 27.575 23.685000000000002 20-24 19.605 28.68 28.415000000000003 23.3 25-29 19.88 28.375 28.165000000000003 23.580000000000002 30-34 19.71 28.915000000000003 27.735 23.64 35-39 19.29 29.455 27.71 23.544999999999998 40-44 19.525000000000002 28.744999999999997 27.91 23.82 45-49 19.5 28.549999999999997 27.99 23.96 50-54 20.48 27.925 28.425 23.169999999999998 55-59 20.095 29.099999999999998 27.62 23.185 60-64 20.135 28.549999999999997 27.694999999999997 23.62 65-69 19.759999999999998 29.005 27.61 23.625 70-74 20.330000000000002 28.549999999999997 28.07 23.05 75-79 20.75 28.62 27.665 22.965 80-84 19.885 28.744999999999997 27.62 23.75 85-89 20.68 28.299999999999997 28.215 22.805 90-94 19.875 29.21 27.700000000000003 23.215 95-99 20.549999999999997 27.875 27.905 23.669999999999998 100-104 20.13 29.04 27.515 23.315 105-109 20.255000000000003 27.96 28.115000000000002 23.669999999999998 110-114 20.81873686317686 27.985186668001198 27.709938945050546 23.486137523771394 115-119 20.687753772118903 28.602937490601033 27.344729059100708 23.364579678179357 120-124 20.49 28.74 27.26 23.51 125-129 21.005 28.48 27.345000000000002 23.169999999999998 130-134 20.150000000000002 28.17 28.499999999999996 23.18 135-139 20.73 27.96 27.77 23.54 140-144 20.945 28.494999999999997 27.38 23.18 145-149 20.935000000000002 28.050000000000004 27.68 23.335 150-151 21.087500000000002 28.0625 28.349999999999998 22.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 1.5 23 2.0 24 2.5 25 3.0 26 4.0 27 5.5 28 14.0 29 22.0 30 24.5 31 27.5 32 31.5 33 42.0 34 62.0 35 79.5 36 93.0 37 113.0 38 136.0 39 170.0 40 209.0 41 231.5 42 266.0 43 283.5 44 274.0 45 284.5 46 285.0 47 237.5 48 203.5 49 196.0 50 172.0 51 134.0 52 95.0 53 69.0 54 52.0 55 44.0 56 36.5 57 25.0 58 16.5 59 14.0 60 9.5 61 6.0 62 4.5 63 3.0 64 2.5 65 3.0 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 1.725 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.09 115-119 0.255 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.9625 0.0 0.0 0.0 0.0 120-121 1.0875 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138-139 2.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCAC 10 0.0068573058 144.8125 5 >>END_MODULE SRR7172692 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172692_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1495 34.0 33.0 34.0 33.0 34.0 2 33.17875 34.0 33.0 34.0 33.0 34.0 3 33.09875 34.0 33.0 34.0 33.0 34.0 4 33.15875 34.0 33.0 34.0 33.0 34.0 5 33.17575 34.0 33.0 34.0 33.0 34.0 6 37.32275 38.0 38.0 38.0 38.0 38.0 7 37.302 38.0 38.0 38.0 38.0 38.0 8 37.2825 38.0 38.0 38.0 38.0 38.0 9 37.29075 38.0 38.0 38.0 38.0 38.0 10-14 37.2558 38.0 38.0 38.0 37.8 38.0 15-19 37.264700000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.27065 38.0 38.0 38.0 37.6 38.0 25-29 36.898399999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.237700000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.522299999999994 38.0 38.0 38.0 36.0 38.0 40-44 37.1115 38.0 38.0 38.0 37.0 38.0 45-49 37.148849999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.12225 38.0 38.0 38.0 37.0 38.0 55-59 37.01255 38.0 38.0 38.0 36.8 38.0 60-64 36.92375 38.0 38.0 38.0 36.0 38.0 65-69 36.792649999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.7721 38.0 38.0 38.0 35.8 38.0 75-79 36.747400000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.6786 38.0 38.0 38.0 35.6 38.0 85-89 36.5689 38.0 38.0 38.0 35.0 38.0 90-94 36.5038 38.0 38.0 38.0 35.0 38.0 95-99 36.43835 38.0 38.0 38.0 34.6 38.0 100-104 36.262049999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.141749999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.01555 38.0 38.0 38.0 33.8 38.0 115-119 35.7977 38.0 37.6 38.0 32.6 38.0 120-124 35.56765 38.0 37.2 38.0 31.4 38.0 125-129 35.400850000000005 38.0 37.0 38.0 31.0 38.0 130-134 35.053450000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.857350000000004 38.0 36.0 38.0 28.0 38.0 140-144 34.37545 38.0 35.2 38.0 26.2 38.0 145-149 33.304700000000004 38.0 33.6 38.0 18.4 38.0 150-151 29.465 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 2.0 6 1.0 7 2.0 8 0.0 9 2.0 10 2.0 11 1.0 12 4.0 13 3.0 14 4.0 15 5.0 16 7.0 17 6.0 18 3.0 19 1.0 20 7.0 21 10.0 22 8.0 23 9.0 24 8.0 25 17.0 26 16.0 27 27.0 28 20.0 29 25.0 30 47.0 31 50.0 32 52.0 33 83.0 34 167.0 35 272.0 36 523.0 37 2605.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.475 16.5 14.975 30.049999999999997 2 24.525 23.1 34.475 17.9 3 19.400000000000002 27.05 30.95 22.6 4 23.325000000000003 35.699999999999996 22.1 18.875 5 23.95 36.95 21.725 17.375 6 18.05 36.9 25.025 20.025000000000002 7 18.25 17.375 42.699999999999996 21.675 8 20.9 22.675 28.075 28.349999999999998 9 22.1 24.175 28.749999999999996 24.975 10-14 22.715 28.194999999999997 27.034999999999997 22.055 15-19 22.264999999999997 28.265 28.115000000000002 21.355 20-24 22.445 28.715000000000003 27.765 21.075 25-29 22.04124855024961 28.873985174726442 27.78982401290908 21.294942262114873 30-34 22.198275862068968 28.766420361247945 28.10960591133005 20.925697865353037 35-39 22.432322822670585 28.941498529859068 27.831288654567576 20.794889992902768 40-44 22.365 28.685 28.32 20.630000000000003 45-49 22.73 27.900000000000002 28.365000000000002 21.005 50-54 22.39 28.050000000000004 28.549999999999997 21.01 55-59 22.155 28.33 28.88 20.635 60-64 22.685 28.449999999999996 28.365000000000002 20.5 65-69 22.865 27.82 29.049999999999997 20.265 70-74 23.255 28.13 28.155 20.46 75-79 23.23 27.345000000000002 28.76 20.665 80-84 23.34 28.1 28.055000000000003 20.505000000000003 85-89 23.445 27.915 28.365000000000002 20.275000000000002 90-94 22.89 27.855 28.965000000000003 20.29 95-99 23.61 28.000000000000004 27.785 20.605 100-104 23.625 28.105000000000004 27.405 20.865000000000002 105-109 23.285 27.775 28.24 20.7 110-114 23.455000000000002 28.29 28.060000000000002 20.195 115-119 23.555 27.825 27.985 20.635 120-124 23.035 28.17 28.055000000000003 20.74 125-129 23.695 27.72 27.77 20.815 130-134 24.0 28.084999999999997 27.47 20.445 135-139 23.915 28.389999999999997 27.155 20.54 140-144 23.91 28.315 27.82 19.955000000000002 145-149 23.895 28.02 27.925 20.16 150-151 23.7125 28.4125 27.5875 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 2.0 22 3.5 23 3.0 24 1.5 25 1.5 26 4.5 27 5.0 28 7.0 29 9.0 30 16.0 31 23.5 32 25.5 33 36.0 34 48.5 35 71.0 36 96.0 37 108.5 38 136.5 39 189.0 40 232.5 41 254.0 42 265.5 43 279.0 44 293.5 45 293.0 46 275.5 47 243.0 48 211.5 49 181.5 50 160.0 51 135.5 52 94.5 53 66.0 54 55.5 55 46.0 56 33.5 57 27.5 58 21.0 59 13.5 60 10.0 61 6.0 62 2.0 63 1.5 64 1.0 65 0.0 66 0.0 67 0.5 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.845 30-34 2.56 35-39 1.37 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.1875 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.36250000000000004 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7749999999999999 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCAA 10 0.0069178343 144.3875 7 TTACAGC 10 0.0069178343 144.3875 6 ACTTCAA 10 0.0069178343 144.3875 145 >>END_MODULE Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761078 spots for SRR7172692.sra Written 761078 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra Read 761065 spots for SRR7172692.sra Written 761065 spots for SRR7172692.sra SRR ids: ['SRR7172692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2r2ps8_5 SRR7172692.sra spots: 15221313 blocks: [[1, 761065], [761066, 1522130], [1522131, 2283195], [2283196, 3044260], [3044261, 3805325], [3805326, 4566390], [4566391, 5327455], [5327456, 6088520], [6088521, 6849585], [6849586, 7610650], [7610651, 8371715], [8371716, 9132780], [9132781, 9893845], [9893846, 10654910], [10654911, 11415975], [11415976, 12177040], [12177041, 12938105], [12938106, 13699170], [13699171, 14460235], [14460236, 15221313]] SRR7172692 file size 5136303 SRR7172692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172692 SRR7172692_1.fastq SRR7172692_2.fastq Input file: SRR7172692_1.fastq Paired file: SRR7172692_2.fastq trimmed: SRR7172692-trimmed-pair1.fastq, SRR7172692-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:13:28 2025 >> started Mon Feb 10 13:13:45 2025 >> done (16.157s) 15221313 read pairs processed; of these: 13289 ( 0.09%) short read pairs filtered out after trimming by size control 9125 ( 0.06%) empty read pairs filtered out after trimming by size control 15198899 (99.85%) read pairs available; of these: 6042915 (39.76%) trimmed read pairs available after processing 9155984 (60.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 3 0.00% 24 3 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 4 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 6 0.00% 35 5 0.00% 36 2 0.00% 37 1 0.00% 38 1 0.00% 39 1 0.00% 40 6 0.00% 41 6 0.00% 42 8 0.00% 43 7 0.00% 44 4 0.00% 45 7 0.00% 46 12 0.00% 47 8 0.00% 48 15 0.00% 49 12 0.00% 50 21 0.00% 51 23 0.00% 52 19 0.00% 53 26 0.00% 54 17 0.00% 55 27 0.00% 56 42 0.00% 57 28 0.00% 58 36 0.00% 59 43 0.00% 60 50 0.00% 61 66 0.00% 62 60 0.00% 63 62 0.00% 64 84 0.00% 65 105 0.00% 66 93 0.00% 67 135 0.00% 68 117 0.00% 69 170 0.00% 70 167 0.00% 71 203 0.00% 72 216 0.00% 73 258 0.00% 74 302 0.00% 75 339 0.00% 76 454 0.00% 77 472 0.00% 78 495 0.00% 79 574 0.00% 80 662 0.00% 81 822 0.01% 82 893 0.01% 83 1009 0.01% 84 1819 0.01% 85 2283 0.02% 86 2346 0.02% 87 2530 0.02% 88 2567 0.02% 89 2812 0.02% 90 3007 0.02% 91 3236 0.02% 92 3346 0.02% 93 3731 0.02% 94 3904 0.03% 95 4314 0.03% 96 4477 0.03% 97 4770 0.03% 98 4984 0.03% 99 5433 0.04% 100 5760 0.04% 101 6147 0.04% 102 6783 0.04% 103 7261 0.05% 104 7680 0.05% 105 8205 0.05% 106 8717 0.06% 107 9197 0.06% 108 9793 0.06% 109 10468 0.07% 110 11062 0.07% 111 11487 0.08% 112 12117 0.08% 113 12926 0.09% 114 13717 0.09% 115 14652 0.10% 116 15402 0.10% 117 15994 0.11% 118 16942 0.11% 119 17766 0.12% 120 18472 0.12% 121 19077 0.13% 122 20174 0.13% 123 21257 0.14% 124 22529 0.15% 125 23680 0.16% 126 24745 0.16% 127 26004 0.17% 128 27212 0.18% 129 28763 0.19% 130 30218 0.20% 131 31674 0.21% 132 33651 0.22% 133 36171 0.24% 134 38609 0.25% 135 40569 0.27% 136 43115 0.28% 137 45863 0.30% 138 49256 0.32% 139 52742 0.35% 140 58086 0.38% 141 63612 0.42% 142 71249 0.47% 143 80256 0.53% 144 93335 0.61% 145 110612 0.73% 146 138588 0.91% 147 189217 1.24% 148 296246 1.95% 149 591215 3.89% 150 3430858 22.57% 151 9155984 60.24% 15198899 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=437.08 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.88 fanout-score-rank=21 prefix-density=0.36 prefix-fanout=3.9 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=363.78 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=31.8 sequence=GAAGAAGAAGAAA SRR7172692 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:14:40 Started mapping on | Feb 10 13:14:41 Finished on | Feb 10 13:16:13 Mapping speed, Million of reads per hour | 594.74 Number of input reads | 15198899 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14406784 Uniquely mapped reads % | 94.79% Average mapped length | 296.67 Number of splices: Total | 14908920 Number of splices: Annotated (sjdb) | 14670140 Number of splices: GT/AG | 14668092 Number of splices: GC/AG | 194114 Number of splices: AT/AC | 10413 Number of splices: Non-canonical | 36301 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429220 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 29126 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 377190 377190 377190 N_multimapping 429220 429220 429220 N_noFeature 323554 14297331 366463 N_ambiguous 140901 1242 73553 UnstrandedReadsAssigned:13942329 PositiveStrandReadsAssigned:108211 NegativeStrandReadsAssigned:13966768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172692 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172692-trimmed-pair1.fastq SRR7172692-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,198,899 reads, 13,865,103 reads pseudoaligned [quant] estimated average fragment length: 260.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7172692.ke.tsv 34699 SRR7172692.se.tsv 87100 total ==> SRR7172692.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.37 991 39.2606 Potri.005G024800.1.v4.1 1035 775.367 311 27.9413 Potri.004G059700.1.v4.1 961 701.457 116 11.5199 Potri.007G009000.2.v4.1 1416 1156.37 0 0 Potri.003G141000.2.v4.1 2943 2683.37 536.29 13.9224 Potri.016G087400.1.v4.1 270 72.0268 997 964.26 Potri.015G069301.1.v4.1 564 311.454 0 0 Potri.010G195200.1.v4.1 1773 1513.37 69 3.17613 Potri.012G127500.1.v4.1 977 717.451 2194 213.028 ==> SRR7172692.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 370 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 216 SRR7172692 completed mapping pipeline successfully