Starting /dee2/code/volunteer_pipeline.sh SRR7172693 current disk space = 3059057283072 free memory = 1455995084 SRR7172693 SRAfilesize b9e8e8017af7f6ff25eaf3d034d78b93 SRR7172693.sra SRR7172693.sra file validated SRR7172693 is paired end SRR7172693 is conventional basespace SRR7172693 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172693_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.39225 18.0 18.0 27.0 18.0 32.0 2 22.028 18.0 18.0 27.0 18.0 31.0 3 29.2935 32.0 27.0 32.0 25.0 33.0 4 30.2895 32.0 31.0 33.0 25.0 33.0 5 31.41825 33.0 32.0 33.0 28.0 33.0 6 36.897 38.0 37.0 38.0 35.0 38.0 7 37.4585 38.0 38.0 38.0 37.0 38.0 8 37.62875 38.0 38.0 38.0 38.0 38.0 9 37.5595 38.0 38.0 38.0 38.0 38.0 10-14 37.65895 38.0 38.0 38.0 38.0 38.0 15-19 37.64025 38.0 38.0 38.0 38.0 38.0 20-24 37.61525 38.0 38.0 38.0 38.0 38.0 25-29 37.6661 38.0 38.0 38.0 38.0 38.0 30-34 37.63275 38.0 38.0 38.0 38.0 38.0 35-39 37.60865 38.0 38.0 38.0 38.0 38.0 40-44 37.56355 38.0 38.0 38.0 38.0 38.0 45-49 37.50235 38.0 38.0 38.0 37.6 38.0 50-54 37.46495 38.0 38.0 38.0 37.4 38.0 55-59 37.4068 38.0 38.0 38.0 37.0 38.0 60-64 37.37065 38.0 38.0 38.0 37.0 38.0 65-69 37.2846 38.0 38.0 38.0 36.8 38.0 70-74 37.25695 38.0 38.0 38.0 37.0 38.0 75-79 37.19250000000001 38.0 38.0 38.0 36.6 38.0 80-84 36.99385 38.0 38.0 38.0 35.8 38.0 85-89 36.955850000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.998 38.0 38.0 38.0 36.0 38.0 95-99 37.01350000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.84725 38.0 38.0 38.0 35.2 38.0 105-109 36.587849999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.335800000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.412 38.0 38.0 38.0 34.0 38.0 120-124 36.304050000000004 38.0 37.8 38.0 34.0 38.0 125-129 35.925399999999996 38.0 37.0 38.0 32.0 38.0 130-134 35.430600000000005 38.0 36.0 38.0 29.2 38.0 135-139 35.258 38.0 35.8 38.0 29.2 38.0 140-144 35.1222 38.0 35.4 38.0 29.2 38.0 145-149 34.92115 38.0 35.2 38.0 29.8 38.0 150-151 31.069250000000004 36.5 29.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 4.0 21 2.0 22 2.0 23 2.0 24 4.0 25 5.0 26 8.0 27 17.0 28 15.0 29 26.0 30 40.0 31 49.0 32 58.0 33 104.0 34 159.0 35 286.0 36 783.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.604753293722553 13.665719452337896 12.554895375871869 44.174631878067686 2 19.39287506271952 20.07024586051179 38.20873055694932 22.32814851981937 3 19.475 23.925 24.375 32.225 4 23.275000000000002 34.325 19.7 22.7 5 21.925 36.625 23.25 18.2 6 17.150000000000002 36.449999999999996 26.325 20.075000000000003 7 13.675 22.900000000000002 44.0 19.425 8 19.125 22.775000000000002 30.5 27.6 9 16.925 23.599999999999998 34.125 25.35 10-14 19.759999999999998 28.825 27.255000000000003 24.16 15-19 19.935 27.83 28.025 24.21 20-24 19.75 28.125 28.199999999999996 23.925 25-29 19.85 28.360000000000003 27.705000000000002 24.085 30-34 19.375 28.310000000000002 28.194999999999997 24.12 35-39 20.155 28.055000000000003 27.915 23.875 40-44 19.895 28.205000000000002 27.79 24.11 45-49 19.85 28.49 27.04 24.62 50-54 20.185 28.4 27.175 24.240000000000002 55-59 19.36 28.425 28.225 23.990000000000002 60-64 20.385 28.015 27.794999999999998 23.805 65-69 20.3 27.994999999999997 27.74 23.965 70-74 20.785 27.800000000000004 27.625 23.79 75-79 20.175 27.805000000000003 27.67 24.349999999999998 80-84 20.355 27.82 28.065 23.76 85-89 20.205000000000002 28.32 27.644999999999996 23.830000000000002 90-94 20.29 28.17 27.694999999999997 23.845 95-99 20.355 28.24 28.04 23.365 100-104 20.895 27.55 27.72 23.835 105-109 20.22 27.465 28.34 23.974999999999998 110-114 21.065 27.66 27.83 23.445 115-119 20.919999999999998 27.534999999999997 27.639999999999997 23.905 120-124 20.735 28.235 27.105 23.925 125-129 21.17 27.325 27.47 24.035 130-134 21.345 28.22 27.200000000000003 23.235 135-139 20.73 27.779999999999998 27.625 23.865 140-144 20.979999999999997 27.889999999999997 27.05 24.08 145-149 21.310000000000002 28.444999999999997 26.915 23.330000000000002 150-151 20.3375 28.65 26.775 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 2.0 24 1.5 25 1.5 26 3.0 27 5.0 28 7.0 29 5.5 30 9.5 31 21.0 32 23.5 33 28.0 34 37.5 35 54.5 36 77.0 37 100.5 38 127.0 39 158.5 40 191.5 41 233.5 42 267.5 43 288.5 44 302.5 45 286.0 46 278.5 47 275.5 48 247.5 49 206.5 50 172.5 51 148.0 52 110.5 53 77.5 54 65.0 55 54.5 56 38.5 57 24.5 58 15.5 59 10.0 60 9.5 61 7.5 62 5.0 63 5.0 64 3.5 65 1.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.65 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTCT 10 0.006841402 144.925 4 >>END_MODULE SRR7172693 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172693_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0395 34.0 33.0 34.0 32.0 34.0 2 33.10225 34.0 33.0 34.0 32.0 34.0 3 33.14425 34.0 33.0 34.0 32.0 34.0 4 33.08 34.0 33.0 34.0 33.0 34.0 5 33.018 34.0 33.0 34.0 33.0 34.0 6 37.284 38.0 38.0 38.0 37.0 38.0 7 37.242 38.0 38.0 38.0 37.0 38.0 8 37.31425 38.0 38.0 38.0 37.0 38.0 9 37.302 38.0 38.0 38.0 38.0 38.0 10-14 37.2345 38.0 38.0 38.0 37.2 38.0 15-19 37.20515 38.0 38.0 38.0 37.2 38.0 20-24 37.2137 38.0 38.0 38.0 37.0 38.0 25-29 36.972500000000004 38.0 38.0 38.0 36.8 38.0 30-34 36.232299999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.510749999999994 38.0 38.0 38.0 35.4 38.0 40-44 37.04595 38.0 38.0 38.0 37.0 38.0 45-49 37.0538 38.0 38.0 38.0 37.0 38.0 50-54 36.98115 38.0 38.0 38.0 36.6 38.0 55-59 36.89335 38.0 38.0 38.0 36.4 38.0 60-64 36.63365 38.0 38.0 38.0 35.2 38.0 65-69 36.4797 38.0 38.0 38.0 34.6 38.0 70-74 36.60965 38.0 38.0 38.0 35.0 38.0 75-79 36.61125 38.0 38.0 38.0 35.0 38.0 80-84 36.61985 38.0 38.0 38.0 35.0 38.0 85-89 36.49615 38.0 38.0 38.0 34.8 38.0 90-94 36.436800000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.37235 38.0 38.0 38.0 34.2 38.0 100-104 36.20185 38.0 38.0 38.0 33.8 38.0 105-109 36.0698 38.0 38.0 38.0 34.0 38.0 110-114 35.82175 38.0 37.6 38.0 33.0 38.0 115-119 35.716049999999996 38.0 37.2 38.0 31.8 38.0 120-124 35.4738 38.0 37.0 38.0 31.0 38.0 125-129 35.230250000000005 38.0 36.0 38.0 30.0 38.0 130-134 34.7207 38.0 35.2 38.0 27.4 38.0 135-139 34.32785 38.0 34.6 38.0 24.8 38.0 140-144 34.111 38.0 34.2 38.0 24.6 38.0 145-149 33.15075 38.0 33.2 38.0 18.4 38.0 150-151 28.758000000000003 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 4.0 5 2.0 6 2.0 7 0.0 8 1.0 9 3.0 10 4.0 11 1.0 12 0.0 13 4.0 14 5.0 15 1.0 16 2.0 17 4.0 18 4.0 19 4.0 20 6.0 21 7.0 22 7.0 23 13.0 24 9.0 25 12.0 26 21.0 27 22.0 28 29.0 29 44.0 30 43.0 31 57.0 32 62.0 33 96.0 34 174.0 35 286.0 36 594.0 37 2465.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.875 14.575 18.725 33.825 2 22.575 23.425 37.2 16.8 3 19.725 27.800000000000004 30.599999999999998 21.875 4 23.7 34.300000000000004 21.775 20.225 5 23.65 34.575 24.25 17.525 6 18.5 37.974999999999994 23.400000000000002 20.125 7 19.275000000000002 17.275 42.8 20.65 8 21.625 22.575 27.500000000000004 28.299999999999997 9 22.900000000000002 24.0 27.775 25.324999999999996 10-14 22.84 29.185 25.924999999999997 22.05 15-19 22.59 27.955000000000002 27.689999999999998 21.765 20-24 23.27 28.09 27.055 21.584999999999997 25-29 23.18702290076336 27.91783848935315 27.54620329449578 21.348935315387706 30-34 23.119877049180328 27.817622950819672 27.95594262295082 21.10655737704918 35-39 22.536491742007172 28.228698419112074 27.758977726147787 21.475832112732967 40-44 22.400000000000002 28.599999999999998 27.22 21.78 45-49 22.994999999999997 28.33 27.529999999999998 21.145 50-54 22.745 28.18 27.900000000000002 21.175 55-59 23.7 27.79 27.474999999999998 21.035 60-64 23.52 27.575 28.349999999999998 20.555 65-69 23.53 28.515 26.955000000000002 21.0 70-74 23.674999999999997 28.29 27.57 20.465 75-79 23.41 28.23 27.860000000000003 20.5 80-84 23.805 28.384999999999998 27.36 20.45 85-89 23.369999999999997 28.375 27.33 20.925 90-94 23.835 28.299999999999997 27.02 20.845 95-99 23.885 27.855 27.73 20.53 100-104 23.97 28.22 27.495000000000005 20.315 105-109 24.415 27.235 27.68 20.669999999999998 110-114 24.145 27.79 27.16 20.905 115-119 24.16 28.18 27.35 20.31 120-124 24.654999999999998 27.765 27.35 20.23 125-129 24.33 27.875 27.334999999999997 20.46 130-134 24.355 28.02 27.36 20.265 135-139 24.395 27.79 27.42 20.395 140-144 25.319999999999997 27.450000000000003 27.185 20.044999999999998 145-149 25.095 27.975 27.04 19.89 150-151 25.650000000000002 26.8625 27.625 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.0 27 4.0 28 4.5 29 5.0 30 10.0 31 12.5 32 15.0 33 25.5 34 40.5 35 56.0 36 72.5 37 89.5 38 124.5 39 167.5 40 195.5 41 221.0 42 268.0 43 301.5 44 298.0 45 297.5 46 297.0 47 272.0 48 241.0 49 204.0 50 172.0 51 144.0 52 116.5 53 98.5 54 70.5 55 43.5 56 30.0 57 27.0 58 20.0 59 14.0 60 12.0 61 9.5 62 5.0 63 2.5 64 3.5 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.44 30-34 2.4 35-39 1.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 0.9874999999999999 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 4.112500000000001 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCCAA 10 0.0069339755 144.27501 145 CAAACTC 10 0.0069339755 144.27501 4 >>END_MODULE Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868069 spots for SRR7172693.sra Written 868069 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra Read 868062 spots for SRR7172693.sra Written 868062 spots for SRR7172693.sra SRR ids: ['SRR7172693.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x3bheu_t SRR7172693.sra spots: 17361247 blocks: [[1, 868062], [868063, 1736124], [1736125, 2604186], [2604187, 3472248], [3472249, 4340310], [4340311, 5208372], [5208373, 6076434], [6076435, 6944496], [6944497, 7812558], [7812559, 8680620], [8680621, 9548682], [9548683, 10416744], [10416745, 11284806], [11284807, 12152868], [12152869, 13020930], [13020931, 13888992], [13888993, 14757054], [14757055, 15625116], [15625117, 16493178], [16493179, 17361247]] SRR7172693 file size 5861456 SRR7172693 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172693 SRR7172693_1.fastq SRR7172693_2.fastq Input file: SRR7172693_1.fastq Paired file: SRR7172693_2.fastq trimmed: SRR7172693-trimmed-pair1.fastq, SRR7172693-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:05:24 2025 >> started Mon Feb 10 14:05:44 2025 >> done (19.519s) 17361247 read pairs processed; of these: 20260 ( 0.12%) short read pairs filtered out after trimming by size control 20685 ( 0.12%) empty read pairs filtered out after trimming by size control 17320302 (99.76%) read pairs available; of these: 7032160 (40.60%) trimmed read pairs available after processing 10288142 (59.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 2 0.00% 37 5 0.00% 38 3 0.00% 39 4 0.00% 40 6 0.00% 41 6 0.00% 42 6 0.00% 43 11 0.00% 44 12 0.00% 45 6 0.00% 46 6 0.00% 47 9 0.00% 48 7 0.00% 49 18 0.00% 50 9 0.00% 51 17 0.00% 52 15 0.00% 53 28 0.00% 54 22 0.00% 55 26 0.00% 56 37 0.00% 57 34 0.00% 58 52 0.00% 59 44 0.00% 60 69 0.00% 61 63 0.00% 62 91 0.00% 63 96 0.00% 64 114 0.00% 65 123 0.00% 66 131 0.00% 67 175 0.00% 68 164 0.00% 69 206 0.00% 70 221 0.00% 71 272 0.00% 72 336 0.00% 73 373 0.00% 74 434 0.00% 75 528 0.00% 76 638 0.00% 77 676 0.00% 78 718 0.00% 79 861 0.00% 80 947 0.01% 81 1134 0.01% 82 1288 0.01% 83 1518 0.01% 84 2538 0.01% 85 3132 0.02% 86 3361 0.02% 87 3494 0.02% 88 3851 0.02% 89 4040 0.02% 90 4291 0.02% 91 4685 0.03% 92 5042 0.03% 93 5467 0.03% 94 5859 0.03% 95 6384 0.04% 96 6852 0.04% 97 7634 0.04% 98 7872 0.05% 99 8500 0.05% 100 9200 0.05% 101 9629 0.06% 102 10371 0.06% 103 11421 0.07% 104 11930 0.07% 105 12906 0.07% 106 13767 0.08% 107 14369 0.08% 108 15489 0.09% 109 15993 0.09% 110 17388 0.10% 111 18188 0.11% 112 19635 0.11% 113 20176 0.12% 114 21763 0.13% 115 22790 0.13% 116 23783 0.14% 117 25011 0.14% 118 26465 0.15% 119 27089 0.16% 120 28576 0.16% 121 29805 0.17% 122 30915 0.18% 123 32669 0.19% 124 34547 0.20% 125 35929 0.21% 126 37640 0.22% 127 39508 0.23% 128 40875 0.24% 129 42908 0.25% 130 44811 0.26% 131 46403 0.27% 132 48969 0.28% 133 51286 0.30% 134 54465 0.31% 135 57704 0.33% 136 61088 0.35% 137 63896 0.37% 138 67896 0.39% 139 72495 0.42% 140 77679 0.45% 141 83714 0.48% 142 91952 0.53% 143 101780 0.59% 144 115949 0.67% 145 135513 0.78% 146 166278 0.96% 147 223372 1.29% 148 347126 2.00% 149 649875 3.75% 150 3674572 21.22% 151 10288142 59.40% 17320302 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=5 fanout-score=350.43 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=35.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=320.24 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=31.1 sequence=GAAGAAGAAGAAA SRR7172693 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:06:28 Started mapping on | Feb 10 14:06:28 Finished on | Feb 10 14:08:29 Mapping speed, Million of reads per hour | 515.31 Number of input reads | 17320302 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16436059 Uniquely mapped reads % | 94.89% Average mapped length | 295.68 Number of splices: Total | 17788378 Number of splices: Annotated (sjdb) | 17509955 Number of splices: GT/AG | 17515130 Number of splices: GC/AG | 219356 Number of splices: AT/AC | 13124 Number of splices: Non-canonical | 40768 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 497205 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 50742 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.87% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 402366 402366 402366 N_multimapping 497205 497205 497205 N_noFeature 288038 16312673 336725 N_ambiguous 152991 1175 77588 UnstrandedReadsAssigned:15995030 PositiveStrandReadsAssigned:122211 NegativeStrandReadsAssigned:16021746 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172693 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172693-trimmed-pair1.fastq SRR7172693-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,320,302 reads, 15,900,076 reads pseudoaligned [quant] estimated average fragment length: 240.123 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR7172693.ke.tsv 34699 SRR7172693.se.tsv 87100 total ==> SRR7172693.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.88 939 30.6296 Potri.005G024800.1.v4.1 1035 795.877 328 23.9138 Potri.004G059700.1.v4.1 961 721.918 120 9.64527 Potri.007G009000.2.v4.1 1416 1176.88 0 0 Potri.003G141000.2.v4.1 2943 2703.88 532 11.4168 Potri.016G087400.1.v4.1 270 78.3313 1545.48 1144.85 Potri.015G069301.1.v4.1 564 328.566 0 0 Potri.010G195200.1.v4.1 1773 1533.88 153 5.78791 Potri.012G127500.1.v4.1 977 737.905 3055 240.233 ==> SRR7172693.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 218 SRR7172693 completed mapping pipeline successfully