Starting /dee2/code/volunteer_pipeline.sh SRR7172694 current disk space = 3058907336704 free memory = 1021892224 SRR7172694 SRAfilesize 97e99583ced7c2c6b6ae05565b052564 SRR7172694.sra SRR7172694.sra file validated SRR7172694 is paired end SRR7172694 is conventional basespace SRR7172694 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.19875 32.0 25.0 33.0 18.0 33.0 2 26.6475 28.0 18.0 32.0 18.0 33.0 3 29.1935 31.0 27.0 33.0 25.0 33.0 4 31.6925 33.0 32.0 33.0 28.0 33.0 5 31.901 33.0 32.0 33.0 31.0 33.0 6 36.63325 38.0 37.0 38.0 34.0 38.0 7 37.242 38.0 38.0 38.0 37.0 38.0 8 37.49625 38.0 38.0 38.0 37.0 38.0 9 37.5545 38.0 38.0 38.0 38.0 38.0 10-14 37.62665 38.0 38.0 38.0 38.0 38.0 15-19 37.5728 38.0 38.0 38.0 38.0 38.0 20-24 37.57965 38.0 38.0 38.0 38.0 38.0 25-29 37.606700000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.595600000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.5787 38.0 38.0 38.0 38.0 38.0 40-44 37.53835 38.0 38.0 38.0 38.0 38.0 45-49 37.5094 38.0 38.0 38.0 38.0 38.0 50-54 37.46614999999999 38.0 38.0 38.0 37.6 38.0 55-59 37.3916 38.0 38.0 38.0 37.2 38.0 60-64 37.329299999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.24175 38.0 38.0 38.0 36.8 38.0 70-74 37.208400000000005 38.0 38.0 38.0 36.8 38.0 75-79 37.17225 38.0 38.0 38.0 36.4 38.0 80-84 37.01675 38.0 38.0 38.0 36.0 38.0 85-89 36.87250000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.93635 38.0 38.0 38.0 36.0 38.0 95-99 36.8789 38.0 38.0 38.0 35.4 38.0 100-104 36.80335 38.0 38.0 38.0 35.0 38.0 105-109 36.533699999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.3309 38.0 37.8 38.0 33.8 38.0 115-119 36.1448 38.0 37.6 38.0 33.4 38.0 120-124 36.28789999999999 38.0 37.8 38.0 33.8 38.0 125-129 36.07285 38.0 37.2 38.0 33.2 38.0 130-134 35.5643 38.0 36.2 38.0 30.6 38.0 135-139 35.18955 38.0 36.0 38.0 28.8 38.0 140-144 35.05985 38.0 36.0 38.0 28.6 38.0 145-149 34.616749999999996 38.0 35.4 38.0 28.0 38.0 150-151 30.5195 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 1.0 21 3.0 22 3.0 23 2.0 24 7.0 25 12.0 26 11.0 27 22.0 28 17.0 29 30.0 30 40.0 31 53.0 32 52.0 33 85.0 34 124.0 35 269.0 36 711.0 37 2552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.642029358743237 15.451970126191089 13.005408189544168 41.9005923255215 2 18.447094646028926 19.56356254757676 40.01522456229383 21.97411824410048 3 18.725 24.0 27.05 30.225 4 22.475 33.324999999999996 22.625 21.575 5 20.4 34.975 25.15 19.475 6 16.975 36.6 25.45 20.974999999999998 7 14.05 21.525 45.475 18.95 8 18.875 21.8 30.075000000000003 29.25 9 17.5 21.975 32.7 27.825 10-14 19.1 29.654999999999998 27.525 23.72 15-19 19.85 28.035 28.389999999999997 23.724999999999998 20-24 19.52 28.205000000000002 28.525 23.75 25-29 19.650000000000002 29.145 27.975 23.23 30-34 19.39 28.939999999999998 28.345 23.325000000000003 35-39 19.31 29.025000000000002 27.894999999999996 23.77 40-44 19.86 28.38 28.044999999999998 23.715 45-49 20.06 28.860000000000003 27.57 23.51 50-54 20.044999999999998 28.315 28.689999999999998 22.95 55-59 19.509999999999998 29.015 28.46 23.015 60-64 19.634999999999998 28.84 27.865000000000002 23.66 65-69 19.295 28.835 28.42 23.45 70-74 19.384999999999998 28.794999999999998 28.16 23.66 75-79 19.395 28.355000000000004 27.91 24.34 80-84 19.885 28.000000000000004 28.18 23.935000000000002 85-89 19.845 28.825 27.92 23.41 90-94 20.135 28.825 27.800000000000004 23.24 95-99 19.470000000000002 28.22 28.610000000000003 23.7 100-104 19.935 28.749999999999996 28.265 23.05 105-109 20.115 29.005 27.765 23.115 110-114 19.828794553464157 28.594313175810974 28.469162995594715 23.107729275130158 115-119 20.29211001806866 28.754266211604097 28.02650070267015 22.927123067657096 120-124 20.7 28.389999999999997 28.075 22.835 125-129 20.36 29.235 27.595 22.81 130-134 20.625 28.575 27.395000000000003 23.405 135-139 20.565 28.67 27.810000000000002 22.955000000000002 140-144 20.674999999999997 28.7 27.560000000000002 23.064999999999998 145-149 20.465 28.575 27.93 23.03 150-151 20.575 28.462500000000002 27.55 23.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 2.5 25 3.0 26 3.5 27 4.5 28 7.5 29 12.0 30 14.5 31 26.5 32 39.5 33 41.0 34 53.5 35 77.0 36 97.0 37 127.0 38 162.5 39 191.0 40 213.0 41 253.5 42 272.0 43 280.5 44 293.5 45 277.0 46 265.0 47 249.0 48 212.5 49 174.5 50 142.0 51 113.0 52 95.5 53 77.5 54 59.0 55 45.5 56 33.5 57 21.0 58 15.5 59 11.5 60 6.5 61 5.0 62 3.5 63 2.5 64 2.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 1.4749999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.12 115-119 0.38 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.5250000000000004 0.0 0.0 0.0 0.0 134-135 2.7750000000000004 0.0 0.0 0.0 0.0 136-137 3.0375 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACGC 10 0.0068519996 144.85 2 TGAGCGA 10 0.0068519996 144.85 8 >>END_MODULE SRR7172694 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172694_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11975 34.0 33.0 34.0 32.0 34.0 2 33.229 34.0 33.0 34.0 33.0 34.0 3 33.102 34.0 33.0 34.0 32.0 34.0 4 33.191 34.0 33.0 34.0 33.0 34.0 5 33.21125 34.0 33.0 34.0 33.0 34.0 6 37.358 38.0 38.0 38.0 38.0 38.0 7 37.377 38.0 38.0 38.0 38.0 38.0 8 37.36825 38.0 38.0 38.0 38.0 38.0 9 37.28125 38.0 38.0 38.0 38.0 38.0 10-14 37.34005 38.0 38.0 38.0 38.0 38.0 15-19 37.285 38.0 38.0 38.0 37.2 38.0 20-24 37.283249999999995 38.0 38.0 38.0 37.6 38.0 25-29 36.91185 38.0 38.0 38.0 37.2 38.0 30-34 36.302 38.0 38.0 38.0 36.2 38.0 35-39 36.573 38.0 38.0 38.0 36.0 38.0 40-44 37.1459 38.0 38.0 38.0 37.0 38.0 45-49 37.177350000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.1302 38.0 38.0 38.0 37.0 38.0 55-59 37.014300000000006 38.0 38.0 38.0 36.8 38.0 60-64 36.93579999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.804899999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.800399999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.795399999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.70845 38.0 38.0 38.0 35.4 38.0 85-89 36.65265000000001 38.0 38.0 38.0 35.2 38.0 90-94 36.53875 38.0 38.0 38.0 34.8 38.0 95-99 36.4654 38.0 38.0 38.0 34.6 38.0 100-104 36.36945 38.0 38.0 38.0 34.0 38.0 105-109 36.23285 38.0 38.0 38.0 34.0 38.0 110-114 36.11495 38.0 38.0 38.0 33.6 38.0 115-119 35.980000000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.649899999999995 38.0 37.2 38.0 31.4 38.0 125-129 35.5308 38.0 37.0 38.0 31.2 38.0 130-134 35.180899999999994 38.0 36.2 38.0 29.4 38.0 135-139 34.9892 38.0 36.0 38.0 28.4 38.0 140-144 34.48495 38.0 35.4 38.0 26.4 38.0 145-149 33.5717 38.0 33.8 38.0 20.2 38.0 150-151 29.69025 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 3.0 6 1.0 7 0.0 8 2.0 9 1.0 10 2.0 11 2.0 12 3.0 13 3.0 14 3.0 15 3.0 16 1.0 17 0.0 18 5.0 19 3.0 20 13.0 21 6.0 22 8.0 23 7.0 24 16.0 25 12.0 26 14.0 27 29.0 28 25.0 29 20.0 30 53.0 31 41.0 32 84.0 33 89.0 34 145.0 35 238.0 36 518.0 37 2643.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.825 16.125 18.0 31.05 2 24.725 23.75 34.65 16.875 3 20.424999999999997 28.000000000000004 31.275 20.3 4 24.05 35.275 21.775 18.9 5 23.075000000000003 37.075 22.525000000000002 17.325 6 17.375 37.925 25.424999999999997 19.275000000000002 7 18.125 16.85 43.35 21.675 8 20.65 23.200000000000003 28.549999999999997 27.6 9 20.825 24.85 29.875 24.45 10-14 22.305 29.085 26.939999999999998 21.67 15-19 22.314999999999998 27.955000000000002 28.52 21.21 20-24 22.405 29.45 27.705000000000002 20.44 25-29 22.622834924001413 28.975407766500027 27.803868100792812 20.59788920870575 30-34 21.75564681724846 28.73716632443532 28.321355236139627 21.18583162217659 35-39 22.219967532467532 28.926542207792206 28.1351461038961 20.718344155844157 40-44 22.6 28.095 29.020000000000003 20.285 45-49 22.475 28.27 28.37 20.885 50-54 23.015 28.7 27.939999999999998 20.345 55-59 22.68 28.349999999999998 28.4 20.57 60-64 22.665 28.015 28.605000000000004 20.715 65-69 22.575 28.375 28.694999999999997 20.355 70-74 22.61 28.605000000000004 28.205000000000002 20.580000000000002 75-79 22.96 27.875 28.735 20.43 80-84 23.075000000000003 28.134999999999998 28.749999999999996 20.04 85-89 23.03 27.794999999999998 28.875 20.3 90-94 23.25 29.185 27.700000000000003 19.865 95-99 23.244999999999997 27.93 29.134999999999998 19.689999999999998 100-104 23.465 28.349999999999998 28.64 19.545 105-109 22.965 28.365000000000002 28.16 20.51 110-114 23.29 28.610000000000003 28.144999999999996 19.955000000000002 115-119 23.465 27.965 28.365000000000002 20.205000000000002 120-124 23.7 28.395 28.165000000000003 19.74 125-129 23.275000000000002 28.499999999999996 28.17 20.055 130-134 24.11 27.82 27.905 20.165 135-139 23.71 28.685 28.384999999999998 19.220000000000002 140-144 23.87 28.804999999999996 27.55 19.775000000000002 145-149 24.27 28.945 27.384999999999998 19.400000000000002 150-151 25.137500000000003 27.8625 26.937499999999996 20.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 2.0 18 1.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.0 24 1.5 25 3.0 26 3.5 27 4.5 28 7.0 29 10.5 30 17.5 31 27.0 32 35.5 33 49.5 34 59.5 35 76.0 36 108.0 37 134.0 38 153.5 39 181.0 40 215.0 41 248.5 42 275.0 43 305.0 44 301.0 45 269.0 46 254.0 47 229.5 48 208.5 49 194.0 50 158.0 51 117.0 52 92.0 53 67.0 54 49.5 55 34.5 56 26.5 57 23.0 58 15.0 59 11.5 60 5.5 61 2.5 62 2.5 63 3.5 64 3.0 65 1.5 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.985 30-34 2.6 35-39 1.44 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.575 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.225 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATCGA 10 0.0068910434 144.575 2 >>END_MODULE Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670763 spots for SRR7172694.sra Written 670763 spots for SRR7172694.sra Read 670773 spots for SRR7172694.sra Written 670773 spots for SRR7172694.sra SRR ids: ['SRR7172694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m8f55dw_ SRR7172694.sra spots: 13415270 blocks: [[1, 670763], [670764, 1341526], [1341527, 2012289], [2012290, 2683052], [2683053, 3353815], [3353816, 4024578], [4024579, 4695341], [4695342, 5366104], [5366105, 6036867], [6036868, 6707630], [6707631, 7378393], [7378394, 8049156], [8049157, 8719919], [8719920, 9390682], [9390683, 10061445], [10061446, 10732208], [10732209, 11402971], [11402972, 12073734], [12073735, 12744497], [12744498, 13415270]] SRR7172694 file size 4524294 SRR7172694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172694 SRR7172694_1.fastq SRR7172694_2.fastq Input file: SRR7172694_1.fastq Paired file: SRR7172694_2.fastq trimmed: SRR7172694-trimmed-pair1.fastq, SRR7172694-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:17:36 2025 >> started Mon Feb 10 13:17:49 2025 >> done (13.646s) 13415270 read pairs processed; of these: 8633 ( 0.06%) short read pairs filtered out after trimming by size control 5466 ( 0.04%) empty read pairs filtered out after trimming by size control 13401171 (99.89%) read pairs available; of these: 5126252 (38.25%) trimmed read pairs available after processing 8274919 (61.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 3 0.00% 32 3 0.00% 33 2 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 1 0.00% 38 0 0.00% 39 2 0.00% 40 7 0.00% 41 2 0.00% 42 4 0.00% 43 10 0.00% 44 3 0.00% 45 4 0.00% 46 8 0.00% 47 3 0.00% 48 5 0.00% 49 8 0.00% 50 12 0.00% 51 13 0.00% 52 13 0.00% 53 19 0.00% 54 17 0.00% 55 25 0.00% 56 20 0.00% 57 31 0.00% 58 27 0.00% 59 38 0.00% 60 30 0.00% 61 60 0.00% 62 45 0.00% 63 68 0.00% 64 67 0.00% 65 84 0.00% 66 93 0.00% 67 101 0.00% 68 117 0.00% 69 122 0.00% 70 157 0.00% 71 186 0.00% 72 184 0.00% 73 221 0.00% 74 250 0.00% 75 291 0.00% 76 372 0.00% 77 406 0.00% 78 439 0.00% 79 524 0.00% 80 571 0.00% 81 619 0.00% 82 738 0.01% 83 826 0.01% 84 1418 0.01% 85 1766 0.01% 86 1987 0.01% 87 2120 0.02% 88 2209 0.02% 89 2316 0.02% 90 2462 0.02% 91 2629 0.02% 92 2826 0.02% 93 3067 0.02% 94 3221 0.02% 95 3444 0.03% 96 3696 0.03% 97 4063 0.03% 98 4306 0.03% 99 4660 0.03% 100 4916 0.04% 101 5109 0.04% 102 5630 0.04% 103 6023 0.04% 104 6461 0.05% 105 6841 0.05% 106 7329 0.05% 107 7861 0.06% 108 8323 0.06% 109 8578 0.06% 110 9252 0.07% 111 9783 0.07% 112 10342 0.08% 113 10996 0.08% 114 11654 0.09% 115 12556 0.09% 116 13063 0.10% 117 13581 0.10% 118 14308 0.11% 119 14781 0.11% 120 15518 0.12% 121 16607 0.12% 122 17180 0.13% 123 18225 0.14% 124 19220 0.14% 125 20089 0.15% 126 21187 0.16% 127 22086 0.16% 128 23108 0.17% 129 24602 0.18% 130 25749 0.19% 131 27478 0.21% 132 28746 0.21% 133 30257 0.23% 134 32678 0.24% 135 34277 0.26% 136 36417 0.27% 137 38381 0.29% 138 41749 0.31% 139 45286 0.34% 140 49308 0.37% 141 53636 0.40% 142 60266 0.45% 143 67098 0.50% 144 77602 0.58% 145 91763 0.68% 146 114871 0.86% 147 155970 1.16% 148 242371 1.81% 149 481818 3.60% 150 2952249 22.03% 151 8274919 61.75% 13401171 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=14 prefix-density=0.30 prefix-fanout=3.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=12.36 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.6 sequence=TCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=28.62 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172694 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:18:38 Started mapping on | Feb 10 13:18:38 Finished on | Feb 10 13:20:18 Mapping speed, Million of reads per hour | 482.44 Number of input reads | 13401171 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12636666 Uniquely mapped reads % | 94.30% Average mapped length | 296.88 Number of splices: Total | 12789915 Number of splices: Annotated (sjdb) | 12555521 Number of splices: GT/AG | 12580883 Number of splices: GC/AG | 166594 Number of splices: AT/AC | 9533 Number of splices: Non-canonical | 32905 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 325721 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 17257 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448968 448968 448968 N_multimapping 325721 325721 325721 N_noFeature 363232 12534860 401531 N_ambiguous 135584 527 71919 UnstrandedReadsAssigned:12137850 PositiveStrandReadsAssigned:101279 NegativeStrandReadsAssigned:12163216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172694 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172694-trimmed-pair1.fastq SRR7172694-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,401,171 reads, 12,060,934 reads pseudoaligned [quant] estimated average fragment length: 256.577 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7172694.ke.tsv 34699 SRR7172694.se.tsv 87100 total ==> SRR7172694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.42 1026 46.53 Potri.005G024800.1.v4.1 1035 779.423 287 29.431 Potri.004G059700.1.v4.1 961 705.474 34 3.85207 Potri.007G009000.2.v4.1 1416 1160.42 0 0 Potri.003G141000.2.v4.1 2943 2687.42 620.211 18.4459 Potri.016G087400.1.v4.1 270 71.579 948 1058.57 Potri.015G069301.1.v4.1 564 314.332 0 0 Potri.010G195200.1.v4.1 1773 1517.42 272 14.3271 Potri.012G127500.1.v4.1 977 721.449 4286 474.835 ==> SRR7172694.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 215 SRR7172694 completed mapping pipeline successfully