Starting /dee2/code/volunteer_pipeline.sh SRR7172695 current disk space = 3058981564416 free memory = 1436347684 SRR7172695 SRAfilesize b6850eef88166b5ce2ebbeef37aa8e55 SRR7172695.sra SRR7172695.sra file validated SRR7172695 is paired end SRR7172695 is conventional basespace SRR7172695 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.4845 25.0 18.0 32.0 18.0 33.0 2 27.0365 29.0 25.0 31.0 18.0 33.0 3 30.40375 31.0 29.0 33.0 27.0 33.0 4 30.5565 33.0 31.0 33.0 27.0 33.0 5 30.88 33.0 31.0 33.0 27.0 34.0 6 36.3705 38.0 37.0 38.0 34.0 38.0 7 37.0025 38.0 38.0 38.0 35.0 38.0 8 37.32925 38.0 38.0 38.0 37.0 38.0 9 37.49325 38.0 38.0 38.0 37.0 38.0 10-14 37.558049999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.562650000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.536950000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.55685 38.0 38.0 38.0 38.0 38.0 30-34 37.513400000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.509949999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.438 38.0 38.0 38.0 37.4 38.0 45-49 37.296350000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.370349999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.27130000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.212149999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.176 38.0 38.0 38.0 36.4 38.0 70-74 37.13925 38.0 38.0 38.0 36.2 38.0 75-79 37.0303 38.0 38.0 38.0 36.0 38.0 80-84 36.951550000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.73235 38.0 38.0 38.0 34.8 38.0 90-94 36.796800000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.82425 38.0 38.0 38.0 35.2 38.0 100-104 36.670049999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.334799999999994 38.0 37.8 38.0 33.6 38.0 110-114 36.199749999999995 38.0 37.6 38.0 33.6 38.0 115-119 36.209649999999996 38.0 37.6 38.0 33.6 38.0 120-124 36.06235 38.0 37.0 38.0 32.8 38.0 125-129 35.77795 38.0 36.6 38.0 32.0 38.0 130-134 35.25195 38.0 36.0 38.0 29.0 38.0 135-139 35.000600000000006 38.0 35.6 38.0 28.2 38.0 140-144 34.9248 38.0 35.2 38.0 28.2 38.0 145-149 34.391149999999996 38.0 34.8 38.0 26.4 38.0 150-151 31.00075 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 3.0 22 4.0 23 3.0 24 6.0 25 12.0 26 13.0 27 21.0 28 22.0 29 31.0 30 49.0 31 36.0 32 69.0 33 101.0 34 153.0 35 294.0 36 752.0 37 2418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.487892838742916 16.125708397733128 12.081401339515715 38.30499742400824 2 19.398496240601503 20.075187969924812 37.26817042606516 23.258145363408524 3 18.575 25.650000000000002 26.25 29.525000000000002 4 21.45 34.725 22.6 21.224999999999998 5 21.099999999999998 36.25 23.674999999999997 18.975 6 17.424999999999997 37.45 24.775 20.349999999999998 7 12.7 22.375 45.0 19.925 8 17.825 23.25 30.049999999999997 28.875 9 17.8 21.65 33.275 27.275 10-14 19.73 29.365000000000002 27.275 23.630000000000003 15-19 19.93 28.17 28.155 23.745 20-24 19.744999999999997 28.715000000000003 28.084999999999997 23.455000000000002 25-29 19.505 28.360000000000003 28.665000000000003 23.47 30-34 19.634999999999998 28.744999999999997 27.644999999999996 23.974999999999998 35-39 19.41 28.68 28.18 23.73 40-44 19.84 28.57 28.355000000000004 23.235 45-49 19.495 28.59 27.725 24.19 50-54 20.31 28.455000000000002 27.944999999999997 23.29 55-59 19.950000000000003 28.189999999999998 28.265 23.595 60-64 19.15 28.405 28.725 23.72 65-69 19.43 28.305000000000003 27.834999999999997 24.43 70-74 19.74 28.355000000000004 28.265 23.64 75-79 20.080000000000002 28.555000000000003 27.800000000000004 23.565 80-84 19.765 28.685 27.889999999999997 23.66 85-89 19.49 28.03 28.16 24.32 90-94 19.845 28.415000000000003 28.360000000000003 23.380000000000003 95-99 20.105 28.16 28.134999999999998 23.599999999999998 100-104 19.900000000000002 27.985 28.139999999999997 23.974999999999998 105-109 20.265 28.144999999999996 28.044999999999998 23.544999999999998 110-114 19.365 28.46 28.544999999999998 23.630000000000003 115-119 19.875 28.525 28.310000000000002 23.29 120-124 20.44 27.88 28.185 23.494999999999997 125-129 20.365 27.825 27.98 23.830000000000002 130-134 20.48 28.025 27.689999999999998 23.805 135-139 20.31 28.205000000000002 27.76 23.724999999999998 140-144 20.505000000000003 27.965 28.03 23.5 145-149 20.66 28.4 27.63 23.31 150-151 20.7375 27.962500000000002 27.212500000000002 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 3.5 25 3.5 26 2.0 27 1.5 28 9.5 29 14.5 30 12.0 31 17.0 32 22.5 33 36.0 34 48.5 35 67.0 36 92.5 37 115.5 38 147.5 39 183.5 40 217.5 41 247.0 42 271.0 43 293.0 44 314.5 45 303.0 46 259.5 47 240.5 48 233.5 49 190.0 50 153.5 51 130.0 52 91.5 53 68.0 54 53.0 55 39.0 56 37.5 57 26.0 58 13.5 59 11.5 60 6.5 61 2.0 62 3.0 63 3.5 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.975 0.0 0.0 0.0 0.0 134-135 3.4000000000000004 0.0 0.0 0.0 0.0 136-137 3.7125000000000004 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTTG 10 0.0068343505 144.975 3 TATGGAT 10 0.0068343505 144.975 7 >>END_MODULE SRR7172695 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172695_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.042 34.0 33.0 34.0 32.0 34.0 2 33.04975 34.0 33.0 34.0 32.0 34.0 3 33.082 34.0 33.0 34.0 32.0 34.0 4 33.0445 34.0 33.0 34.0 33.0 34.0 5 33.067 34.0 33.0 34.0 32.0 34.0 6 37.1055 38.0 38.0 38.0 37.0 38.0 7 37.071 38.0 38.0 38.0 37.0 38.0 8 37.0925 38.0 38.0 38.0 37.0 38.0 9 37.10625 38.0 38.0 38.0 37.0 38.0 10-14 37.097300000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.09185 38.0 38.0 38.0 37.0 38.0 20-24 37.06815 38.0 38.0 38.0 37.0 38.0 25-29 36.80335 38.0 38.0 38.0 36.6 38.0 30-34 36.1262 38.0 38.0 38.0 35.6 38.0 35-39 36.43975 38.0 38.0 38.0 35.6 38.0 40-44 36.924850000000006 38.0 38.0 38.0 36.8 38.0 45-49 36.969950000000004 38.0 38.0 38.0 36.6 38.0 50-54 36.915 38.0 38.0 38.0 36.2 38.0 55-59 36.835350000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.67685 38.0 38.0 38.0 35.4 38.0 65-69 36.520050000000005 38.0 38.0 38.0 34.8 38.0 70-74 36.5477 38.0 38.0 38.0 35.0 38.0 75-79 36.5182 38.0 38.0 38.0 34.8 38.0 80-84 36.493449999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.3759 38.0 38.0 38.0 34.0 38.0 90-94 36.232150000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.06365 38.0 38.0 38.0 33.6 38.0 100-104 35.99785 38.0 37.8 38.0 33.2 38.0 105-109 35.782650000000004 38.0 37.2 38.0 32.6 38.0 110-114 35.5496 38.0 37.0 38.0 30.6 38.0 115-119 35.2153 38.0 36.4 38.0 29.0 38.0 120-124 34.9524 38.0 36.0 38.0 27.8 38.0 125-129 34.73585 38.0 35.8 38.0 26.8 38.0 130-134 34.4348 38.0 35.2 38.0 25.2 38.0 135-139 33.635450000000006 38.0 33.4 38.0 21.2 38.0 140-144 32.8547 38.0 33.0 38.0 15.4 38.0 145-149 31.5773 38.0 31.8 38.0 8.2 38.0 150-151 26.383125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 11.0 4 2.0 5 2.0 6 1.0 7 2.0 8 0.0 9 2.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 4.0 16 1.0 17 3.0 18 3.0 19 11.0 20 4.0 21 11.0 22 7.0 23 11.0 24 13.0 25 17.0 26 19.0 27 27.0 28 41.0 29 41.0 30 56.0 31 72.0 32 83.0 33 116.0 34 195.0 35 340.0 36 731.0 37 2155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 17.625 16.85 27.875 2 24.925 24.55 34.65 15.875 3 20.724999999999998 27.750000000000004 31.55 19.975 4 23.35 37.425000000000004 21.875 17.349999999999998 5 24.0 35.975 21.9 18.125 6 19.25 38.15 23.75 18.85 7 18.15 17.9 43.7 20.25 8 20.225 22.725 28.050000000000004 28.999999999999996 9 22.0 24.425 29.849999999999998 23.724999999999998 10-14 22.955000000000002 28.71 27.139999999999997 21.195 15-19 23.05 28.189999999999998 27.810000000000002 20.95 20-24 22.869999999999997 29.025000000000002 27.575 20.53 25-29 22.686326807911026 28.58436918121886 27.960344220220424 20.768959790649692 30-34 23.07179487179487 28.492307692307694 28.015384615384615 20.42051282051282 35-39 22.961764110863847 28.499898846854137 27.847461056038842 20.690875986243174 40-44 22.81 28.754999999999995 27.77 20.665 45-49 23.03 28.035 28.08 20.855 50-54 23.03 28.17 27.915 20.885 55-59 23.31 28.255000000000003 27.915 20.52 60-64 22.81 28.16 28.48 20.549999999999997 65-69 23.06 28.335 27.99 20.615 70-74 23.235 28.665000000000003 27.595 20.505000000000003 75-79 23.325000000000003 28.59 27.54 20.544999999999998 80-84 23.18 28.17 28.299999999999997 20.349999999999998 85-89 23.580000000000002 27.700000000000003 28.53 20.19 90-94 23.65 28.28 27.79 20.28 95-99 23.425 28.665000000000003 27.57 20.34 100-104 23.74 28.08 28.084999999999997 20.095 105-109 23.89 28.005000000000003 28.03 20.075000000000003 110-114 23.3 27.845 28.634999999999998 20.22 115-119 24.060000000000002 28.455000000000002 27.450000000000003 20.035 120-124 23.535 28.939999999999998 27.35 20.175 125-129 24.065 27.85 27.965 20.119999999999997 130-134 24.48 27.77 27.85 19.900000000000002 135-139 24.27 28.235 27.845 19.650000000000002 140-144 24.26 27.950000000000003 27.639999999999997 20.150000000000002 145-149 24.52 28.74 27.150000000000002 19.59 150-151 25.687500000000004 26.650000000000002 28.037499999999998 19.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 2.0 24 2.0 25 1.5 26 3.5 27 3.5 28 5.0 29 9.0 30 17.0 31 20.5 32 20.5 33 30.5 34 43.5 35 61.5 36 90.0 37 122.0 38 164.0 39 202.0 40 214.0 41 246.0 42 275.0 43 298.0 44 296.0 45 281.5 46 270.5 47 240.5 48 223.5 49 192.5 50 146.5 51 119.5 52 106.0 53 74.0 54 51.0 55 40.5 56 34.0 57 27.5 58 17.0 59 12.0 60 10.0 61 8.5 62 6.5 63 3.0 64 1.0 65 1.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.645 30-34 2.5 35-39 1.1400000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8999999999999999 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.925 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 4.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733483 spots for SRR7172695.sra Written 733483 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra Read 733464 spots for SRR7172695.sra Written 733464 spots for SRR7172695.sra SRR ids: ['SRR7172695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0o5d6wlq SRR7172695.sra spots: 14669299 blocks: [[1, 733464], [733465, 1466928], [1466929, 2200392], [2200393, 2933856], [2933857, 3667320], [3667321, 4400784], [4400785, 5134248], [5134249, 5867712], [5867713, 6601176], [6601177, 7334640], [7334641, 8068104], [8068105, 8801568], [8801569, 9535032], [9535033, 10268496], [10268497, 11001960], [11001961, 11735424], [11735425, 12468888], [12468889, 13202352], [13202353, 13935816], [13935817, 14669299]] SRR7172695 file size 4949243 SRR7172695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172695 SRR7172695_1.fastq SRR7172695_2.fastq Input file: SRR7172695_1.fastq Paired file: SRR7172695_2.fastq trimmed: SRR7172695-trimmed-pair1.fastq, SRR7172695-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:12:35 2025 >> started Mon Feb 10 14:12:57 2025 >> done (22.493s) 14669299 read pairs processed; of these: 15559 ( 0.11%) short read pairs filtered out after trimming by size control 12639 ( 0.09%) empty read pairs filtered out after trimming by size control 14641101 (99.81%) read pairs available; of these: 6610038 (45.15%) trimmed read pairs available after processing 8031063 (54.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 0 0.00% 23 2 0.00% 24 4 0.00% 25 0 0.00% 26 4 0.00% 27 1 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 4 0.00% 37 3 0.00% 38 3 0.00% 39 5 0.00% 40 5 0.00% 41 11 0.00% 42 8 0.00% 43 3 0.00% 44 9 0.00% 45 8 0.00% 46 10 0.00% 47 4 0.00% 48 11 0.00% 49 12 0.00% 50 19 0.00% 51 27 0.00% 52 15 0.00% 53 22 0.00% 54 29 0.00% 55 24 0.00% 56 28 0.00% 57 32 0.00% 58 44 0.00% 59 37 0.00% 60 41 0.00% 61 54 0.00% 62 74 0.00% 63 85 0.00% 64 79 0.00% 65 99 0.00% 66 106 0.00% 67 117 0.00% 68 149 0.00% 69 193 0.00% 70 220 0.00% 71 236 0.00% 72 227 0.00% 73 311 0.00% 74 339 0.00% 75 426 0.00% 76 454 0.00% 77 443 0.00% 78 576 0.00% 79 649 0.00% 80 717 0.00% 81 845 0.01% 82 938 0.01% 83 1176 0.01% 84 1866 0.01% 85 2365 0.02% 86 2569 0.02% 87 2742 0.02% 88 2738 0.02% 89 2919 0.02% 90 3090 0.02% 91 3394 0.02% 92 3591 0.02% 93 3907 0.03% 94 4217 0.03% 95 4606 0.03% 96 4955 0.03% 97 5095 0.03% 98 5353 0.04% 99 5878 0.04% 100 6466 0.04% 101 6861 0.05% 102 7346 0.05% 103 7931 0.05% 104 8399 0.06% 105 9020 0.06% 106 9487 0.06% 107 9851 0.07% 108 10673 0.07% 109 11402 0.08% 110 11941 0.08% 111 12520 0.09% 112 13270 0.09% 113 14213 0.10% 114 15044 0.10% 115 16047 0.11% 116 16456 0.11% 117 17327 0.12% 118 17981 0.12% 119 18729 0.13% 120 19598 0.13% 121 21036 0.14% 122 21908 0.15% 123 23419 0.16% 124 24544 0.17% 125 26070 0.18% 126 27047 0.18% 127 28668 0.20% 128 29948 0.20% 129 31398 0.21% 130 33024 0.23% 131 34760 0.24% 132 37180 0.25% 133 39835 0.27% 134 42701 0.29% 135 45483 0.31% 136 48831 0.33% 137 52015 0.36% 138 56205 0.38% 139 60804 0.42% 140 67001 0.46% 141 73734 0.50% 142 82672 0.56% 143 94621 0.65% 144 111033 0.76% 145 133338 0.91% 146 166337 1.14% 147 226156 1.54% 148 342084 2.34% 149 681831 4.66% 150 3617542 24.71% 151 8031063 54.85% 14641101 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=28 prefix-density=0.19 prefix-fanout=2.1 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=87.32 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.5 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=354.24 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=32.4 sequence=GAAGAAGAAGAAA SRR7172695 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:13:48 Started mapping on | Feb 10 14:13:48 Finished on | Feb 10 14:15:21 Mapping speed, Million of reads per hour | 566.75 Number of input reads | 14641101 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13858621 Uniquely mapped reads % | 94.66% Average mapped length | 295.97 Number of splices: Total | 14200024 Number of splices: Annotated (sjdb) | 13969478 Number of splices: GT/AG | 13979464 Number of splices: GC/AG | 178972 Number of splices: AT/AC | 9949 Number of splices: Non-canonical | 31639 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357250 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 29663 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439087 439087 439087 N_multimapping 357250 357250 357250 N_noFeature 324451 13741257 378211 N_ambiguous 139004 741 74903 UnstrandedReadsAssigned:13395166 PositiveStrandReadsAssigned:116623 NegativeStrandReadsAssigned:13405507 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172695 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172695-trimmed-pair1.fastq SRR7172695-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,641,101 reads, 13,312,829 reads pseudoaligned [quant] estimated average fragment length: 251.711 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR7172695.ke.tsv 34699 SRR7172695.se.tsv 87100 total ==> SRR7172695.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.29 883 38.3478 Potri.005G024800.1.v4.1 1035 784.289 356 34.8387 Potri.004G059700.1.v4.1 961 710.316 19 2.053 Potri.007G009000.2.v4.1 1416 1165.29 0 0 Potri.003G141000.2.v4.1 2943 2692.29 426 12.1444 Potri.016G087400.1.v4.1 270 74.7729 893 916.631 Potri.015G069301.1.v4.1 564 318.699 0 0 Potri.010G195200.1.v4.1 1773 1522.29 112.657 5.68003 Potri.012G127500.1.v4.1 977 726.3 3156 333.51 ==> SRR7172695.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 90 SRR7172695 completed mapping pipeline successfully