Starting /dee2/code/volunteer_pipeline.sh SRR7172696 current disk space = 3059105497088 free memory = 1238776852 SRR7172696 SRAfilesize 5749e92ba93ff6179aa42e1c697542ba SRR7172696.sra SRR7172696.sra file validated SRR7172696 is paired end SRR7172696 is conventional basespace SRR7172696 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0615 28.0 18.0 33.0 18.0 33.0 2 27.21725 29.0 18.0 31.0 18.0 33.0 3 28.40725 30.0 27.0 33.0 18.0 33.0 4 31.44025 32.0 32.0 33.0 27.0 33.0 5 32.637 33.0 33.0 33.0 32.0 33.0 6 36.851 38.0 37.0 38.0 35.0 38.0 7 37.17825 38.0 38.0 38.0 36.0 38.0 8 37.233 38.0 38.0 38.0 36.0 38.0 9 37.52775 38.0 38.0 38.0 37.0 38.0 10-14 37.5891 38.0 38.0 38.0 37.8 38.0 15-19 37.62545 38.0 38.0 38.0 38.0 38.0 20-24 37.63945 38.0 38.0 38.0 38.0 38.0 25-29 37.642250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.601299999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.61135 38.0 38.0 38.0 38.0 38.0 40-44 37.549400000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.511300000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.48395 38.0 38.0 38.0 37.8 38.0 55-59 37.40935 38.0 38.0 38.0 37.2 38.0 60-64 37.411199999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.3187 38.0 38.0 38.0 37.0 38.0 70-74 37.3309 38.0 38.0 38.0 37.0 38.0 75-79 37.2659 38.0 38.0 38.0 37.0 38.0 80-84 37.1918 38.0 38.0 38.0 36.2 38.0 85-89 37.10615 38.0 38.0 38.0 36.0 38.0 90-94 37.04345 38.0 38.0 38.0 36.0 38.0 95-99 36.92885 38.0 38.0 38.0 35.8 38.0 100-104 36.902049999999996 38.0 38.0 38.0 35.6 38.0 105-109 36.77445 38.0 38.0 38.0 35.0 38.0 110-114 36.6477 38.0 38.0 38.0 34.6 38.0 115-119 36.488699999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.41875 38.0 38.0 38.0 34.0 38.0 125-129 36.29295 38.0 38.0 38.0 34.0 38.0 130-134 36.008449999999996 38.0 37.2 38.0 33.0 38.0 135-139 35.79495 38.0 36.6 38.0 32.4 38.0 140-144 35.45575 38.0 36.0 38.0 31.6 38.0 145-149 34.91395 38.0 35.8 38.0 29.4 38.0 150-151 31.880499999999998 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 0.0 11 3.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 4.0 21 1.0 22 2.0 23 4.0 24 7.0 25 10.0 26 9.0 27 6.0 28 17.0 29 22.0 30 21.0 31 39.0 32 57.0 33 76.0 34 102.0 35 201.0 36 686.0 37 2727.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.482869379014986 13.9186295503212 12.901498929336189 36.69700214132762 2 20.025000000000002 19.325 37.2 23.45 3 19.25 26.450000000000003 25.874999999999996 28.425 4 22.425 33.225 23.175 21.175 5 21.575 34.75 24.125 19.55 6 16.375 35.225 27.05 21.349999999999998 7 13.575000000000001 21.65 44.975 19.8 8 18.825 22.05 30.25 28.875 9 17.1 23.400000000000002 32.375 27.125 10-14 19.85 28.9 27.279999999999998 23.97 15-19 19.950000000000003 28.26 27.944999999999997 23.845 20-24 19.855 28.355000000000004 27.715 24.075 25-29 19.525000000000002 28.694999999999997 27.455000000000002 24.325 30-34 19.81 28.265 28.38 23.544999999999998 35-39 20.26 28.389999999999997 27.82 23.53 40-44 19.975 27.994999999999997 28.189999999999998 23.84 45-49 19.605 27.834999999999997 28.43 24.13 50-54 20.335 28.4 27.215 24.05 55-59 19.78 28.34 28.025 23.855 60-64 20.275000000000002 27.66 28.08 23.985 65-69 20.825 28.050000000000004 27.250000000000004 23.875 70-74 20.544999999999998 28.315 27.560000000000002 23.580000000000002 75-79 20.369999999999997 27.779999999999998 27.694999999999997 24.154999999999998 80-84 20.630000000000003 28.155 27.38 23.835 85-89 20.72 28.23 26.810000000000002 24.240000000000002 90-94 20.825 29.03 26.55 23.595 95-99 21.060000000000002 27.900000000000002 27.265 23.775 100-104 20.48 28.139999999999997 27.675 23.705000000000002 105-109 20.615 28.065 27.715 23.605 110-114 20.32 28.110000000000003 27.22 24.349999999999998 115-119 21.63 28.199999999999996 27.415 22.755 120-124 20.715 28.375 27.169999999999998 23.74 125-129 21.22 27.500000000000004 27.54 23.74 130-134 21.415 28.23 27.060000000000002 23.294999999999998 135-139 20.705000000000002 28.305000000000003 26.96 24.03 140-144 20.485 27.900000000000002 27.465 24.15 145-149 21.265 27.900000000000002 27.35 23.485 150-151 20.6125 28.1125 27.1125 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 3.5 26 3.0 27 2.5 28 5.0 29 8.5 30 11.5 31 18.0 32 25.5 33 39.5 34 51.5 35 60.5 36 79.5 37 104.5 38 137.5 39 164.5 40 181.5 41 219.5 42 262.0 43 276.5 44 269.5 45 291.5 46 288.0 47 250.5 48 222.5 49 183.0 50 165.5 51 144.5 52 116.0 53 94.5 54 77.0 55 64.5 56 50.0 57 35.5 58 23.5 59 17.0 60 13.0 61 8.5 62 4.5 63 5.5 64 4.0 65 1.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.6 0.0 0.0 0.0 0.0 134-135 3.8875 0.0 0.0 0.0 0.0 136-137 4.262499999999999 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACAAT 10 0.0068378756 144.95 9 >>END_MODULE SRR7172696 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172696_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1475 33.0 33.0 34.0 33.0 34.0 2 33.20825 34.0 33.0 34.0 33.0 34.0 3 33.2595 34.0 33.0 34.0 33.0 34.0 4 33.239 34.0 33.0 34.0 33.0 34.0 5 33.20125 34.0 33.0 34.0 33.0 34.0 6 37.36075 38.0 38.0 38.0 38.0 38.0 7 37.42925 38.0 38.0 38.0 38.0 38.0 8 37.35 38.0 38.0 38.0 38.0 38.0 9 37.357 38.0 38.0 38.0 37.0 38.0 10-14 37.3162 38.0 38.0 38.0 37.8 38.0 15-19 37.355650000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.34315 38.0 38.0 38.0 37.8 38.0 25-29 37.31785 38.0 38.0 38.0 38.0 38.0 30-34 37.26705 38.0 38.0 38.0 37.4 38.0 35-39 37.2687 38.0 38.0 38.0 37.0 38.0 40-44 37.251099999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.2028 38.0 38.0 38.0 37.0 38.0 50-54 37.15505 38.0 38.0 38.0 37.0 38.0 55-59 37.12115 38.0 38.0 38.0 37.0 38.0 60-64 37.055150000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.0451 38.0 38.0 38.0 37.0 38.0 70-74 37.005399999999995 38.0 38.0 38.0 36.4 38.0 75-79 36.98325 38.0 38.0 38.0 36.2 38.0 80-84 36.904450000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.782349999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.652899999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.5818 38.0 38.0 38.0 35.0 38.0 100-104 36.45365 38.0 38.0 38.0 34.8 38.0 105-109 36.324799999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.1819 38.0 38.0 38.0 34.0 38.0 115-119 36.04169999999999 38.0 38.0 38.0 33.6 38.0 120-124 35.906400000000005 38.0 37.8 38.0 33.2 38.0 125-129 35.6038 38.0 36.8 38.0 31.8 38.0 130-134 35.3329 38.0 36.2 38.0 30.2 38.0 135-139 34.808099999999996 38.0 36.0 38.0 27.8 38.0 140-144 34.52354999999999 38.0 35.6 38.0 26.8 38.0 145-149 33.777049999999996 38.0 35.0 38.0 20.8 38.0 150-151 30.392874999999997 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 0.0 5 4.0 6 2.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 4.0 15 3.0 16 2.0 17 2.0 18 2.0 19 3.0 20 2.0 21 8.0 22 3.0 23 6.0 24 12.0 25 13.0 26 17.0 27 21.0 28 20.0 29 34.0 30 30.0 31 32.0 32 53.0 33 77.0 34 129.0 35 199.0 36 525.0 37 2778.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.15 16.7 17.549999999999997 28.599999999999998 2 24.15 23.1 35.35 17.4 3 21.125 25.55 31.474999999999998 21.85 4 24.425 34.925 22.55 18.099999999999998 5 23.625 36.6 22.05 17.724999999999998 6 18.4 38.2 24.125 19.275000000000002 7 18.9 16.45 42.775 21.875 8 21.05 22.225 27.775 28.95 9 21.575 25.45 27.900000000000002 25.074999999999996 10-14 22.814999999999998 28.645 26.51 22.03 15-19 22.905 27.474999999999998 27.794999999999998 21.825 20-24 23.175 28.23 27.650000000000002 20.945 25-29 22.71 27.884999999999998 27.939999999999998 21.465 30-34 22.615 28.505000000000003 27.63 21.25 35-39 23.275000000000002 27.77 27.98 20.974999999999998 40-44 23.400000000000002 27.68 27.939999999999998 20.979999999999997 45-49 23.21 27.29 28.425 21.075 50-54 23.315 28.084999999999997 28.1 20.5 55-59 23.32 28.02 28.02 20.64 60-64 23.76 27.22 28.275 20.745 65-69 23.785 27.68 27.800000000000004 20.735 70-74 23.724999999999998 28.244999999999997 27.22 20.810000000000002 75-79 23.169999999999998 28.565 27.05 21.215 80-84 24.25 27.505000000000003 27.735 20.51 85-89 24.29 27.63 27.334999999999997 20.745 90-94 23.71 27.639999999999997 27.839999999999996 20.810000000000002 95-99 23.91 27.685 27.450000000000003 20.955 100-104 24.08 27.36 27.79 20.77 105-109 23.75 27.575 28.525 20.150000000000002 110-114 24.05 27.455000000000002 27.875 20.62 115-119 23.94 28.349999999999998 27.58 20.13 120-124 24.285 27.944999999999997 27.26 20.51 125-129 24.05 28.144999999999996 27.72 20.085 130-134 24.195 28.28 26.695 20.830000000000002 135-139 24.3 27.894999999999996 27.83 19.975 140-144 24.45 28.09 26.855 20.605 145-149 24.9 28.115000000000002 27.439999999999998 19.545 150-151 25.275 27.625 27.450000000000003 19.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 1.0 25 2.5 26 1.5 27 2.5 28 6.0 29 7.5 30 10.0 31 13.5 32 19.0 33 25.0 34 33.5 35 52.5 36 74.5 37 97.5 38 115.0 39 141.5 40 185.0 41 236.0 42 279.0 43 292.5 44 289.5 45 287.0 46 282.5 47 261.5 48 250.0 49 221.0 50 177.0 51 140.5 52 109.5 53 92.5 54 75.0 55 54.5 56 40.5 57 31.0 58 21.0 59 21.0 60 14.0 61 7.5 62 5.0 63 3.5 64 4.0 65 3.5 66 3.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 4.012499999999999 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATCT 10 0.006830828 145.0 1 CCCCCCC 30 0.0014437955 24.166668 25-29 >>END_MODULE Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701138 spots for SRR7172696.sra Written 701138 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra Read 701131 spots for SRR7172696.sra Written 701131 spots for SRR7172696.sra SRR ids: ['SRR7172696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_msi4lwnp SRR7172696.sra spots: 14022627 blocks: [[1, 701131], [701132, 1402262], [1402263, 2103393], [2103394, 2804524], [2804525, 3505655], [3505656, 4206786], [4206787, 4907917], [4907918, 5609048], [5609049, 6310179], [6310180, 7011310], [7011311, 7712441], [7712442, 8413572], [8413573, 9114703], [9114704, 9815834], [9815835, 10516965], [10516966, 11218096], [11218097, 11919227], [11919228, 12620358], [12620359, 13321489], [13321490, 14022627]] SRR7172696 file size 4730107 SRR7172696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172696 SRR7172696_1.fastq SRR7172696_2.fastq Input file: SRR7172696_1.fastq Paired file: SRR7172696_2.fastq trimmed: SRR7172696-trimmed-pair1.fastq, SRR7172696-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:41:45 2025 >> started Mon Feb 10 13:42:01 2025 >> done (16.244s) 14022627 read pairs processed; of these: 14028 ( 0.10%) short read pairs filtered out after trimming by size control 9423 ( 0.07%) empty read pairs filtered out after trimming by size control 13999176 (99.83%) read pairs available; of these: 6202140 (44.30%) trimmed read pairs available after processing 7797036 (55.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 6 0.00% 31 1 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 8 0.00% 36 4 0.00% 37 3 0.00% 38 1 0.00% 39 3 0.00% 40 2 0.00% 41 2 0.00% 42 3 0.00% 43 6 0.00% 44 1 0.00% 45 0 0.00% 46 5 0.00% 47 8 0.00% 48 5 0.00% 49 2 0.00% 50 12 0.00% 51 8 0.00% 52 11 0.00% 53 11 0.00% 54 24 0.00% 55 20 0.00% 56 17 0.00% 57 33 0.00% 58 28 0.00% 59 35 0.00% 60 41 0.00% 61 36 0.00% 62 50 0.00% 63 62 0.00% 64 46 0.00% 65 72 0.00% 66 76 0.00% 67 113 0.00% 68 106 0.00% 69 120 0.00% 70 127 0.00% 71 148 0.00% 72 176 0.00% 73 220 0.00% 74 245 0.00% 75 288 0.00% 76 338 0.00% 77 398 0.00% 78 488 0.00% 79 509 0.00% 80 532 0.00% 81 659 0.00% 82 749 0.01% 83 939 0.01% 84 1549 0.01% 85 2084 0.01% 86 2262 0.02% 87 2387 0.02% 88 2594 0.02% 89 2881 0.02% 90 2948 0.02% 91 3126 0.02% 92 3392 0.02% 93 3610 0.03% 94 3781 0.03% 95 4097 0.03% 96 4506 0.03% 97 4823 0.03% 98 5153 0.04% 99 5639 0.04% 100 6068 0.04% 101 6652 0.05% 102 7117 0.05% 103 7717 0.06% 104 8257 0.06% 105 8875 0.06% 106 9661 0.07% 107 10272 0.07% 108 10965 0.08% 109 11699 0.08% 110 12441 0.09% 111 13133 0.09% 112 13874 0.10% 113 14783 0.11% 114 16098 0.11% 115 16872 0.12% 116 17721 0.13% 117 18833 0.13% 118 19846 0.14% 119 20662 0.15% 120 21663 0.15% 121 22965 0.16% 122 24033 0.17% 123 25356 0.18% 124 26633 0.19% 125 27728 0.20% 126 29069 0.21% 127 30831 0.22% 128 32198 0.23% 129 33407 0.24% 130 35577 0.25% 131 37179 0.27% 132 39340 0.28% 133 41366 0.30% 134 43530 0.31% 135 46297 0.33% 136 49180 0.35% 137 52242 0.37% 138 55625 0.40% 139 59600 0.43% 140 63870 0.46% 141 70025 0.50% 142 76624 0.55% 143 84259 0.60% 144 98189 0.70% 145 116225 0.83% 146 144297 1.03% 147 194565 1.39% 148 306964 2.19% 149 635780 4.54% 150 3364300 24.03% 151 7797036 55.70% 13999176 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=27 prefix-density=0.31 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=162.46 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=17.0 sequence=TCCACCACCTTGTTTACCACCTGATCCTGATCCTGCTCGAGACCCAGCATAGGAACCCGCTTCAGAGCCCGCGTCAGACCCGCCATTAGAGCTTGAACTGGACCTGGATGAGGATGAAGAGGACGAACTTGACCCGGAACTTGATCCTGAACCAGAACCAGA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=13.52 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.3 sequence=AGACCATCACCTTGGAGGTGGAGAGC SRR7172696 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:43:08 Started mapping on | Feb 10 13:43:09 Finished on | Feb 10 13:44:54 Mapping speed, Million of reads per hour | 479.97 Number of input reads | 13999176 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13132618 Uniquely mapped reads % | 93.81% Average mapped length | 295.82 Number of splices: Total | 13051887 Number of splices: Annotated (sjdb) | 12824354 Number of splices: GT/AG | 12850428 Number of splices: GC/AG | 159384 Number of splices: AT/AC | 10445 Number of splices: Non-canonical | 31630 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298615 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 43146 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581380 581380 581380 N_multimapping 298615 298615 298615 N_noFeature 326305 13022024 366887 N_ambiguous 137458 482 67346 UnstrandedReadsAssigned:12668855 PositiveStrandReadsAssigned:110112 NegativeStrandReadsAssigned:12698385 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172696 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172696-trimmed-pair1.fastq SRR7172696-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,999,176 reads, 12,578,510 reads pseudoaligned [quant] estimated average fragment length: 241.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR7172696.ke.tsv 34699 SRR7172696.se.tsv 87100 total ==> SRR7172696.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.6 1610 72.4558 Potri.005G024800.1.v4.1 1035 794.603 810 81.5486 Potri.004G059700.1.v4.1 961 720.661 8 0.888057 Potri.007G009000.2.v4.1 1416 1175.6 0 0 Potri.003G141000.2.v4.1 2943 2702.6 1035.3 30.6454 Potri.016G087400.1.v4.1 270 77.7507 824 847.823 Potri.015G069301.1.v4.1 564 327.804 0 0 Potri.010G195200.1.v4.1 1773 1532.6 297 15.5028 Potri.012G127500.1.v4.1 977 736.638 2070 224.801 ==> SRR7172696.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 154 SRR7172696 completed mapping pipeline successfully