Starting /dee2/code/volunteer_pipeline.sh SRR7172697 current disk space = 3059060510720 free memory = 1021776896 SRR7172697 SRAfilesize 932af43d2e619e84a2f6fe964b30bf59 SRR7172697.sra SRR7172697.sra file validated SRR7172697 is paired end SRR7172697 is conventional basespace SRR7172697 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.623 25.0 18.0 32.0 18.0 33.0 2 30.7875 32.0 32.0 33.0 27.0 33.0 3 31.32225 33.0 32.0 33.0 27.0 33.0 4 32.121 33.0 32.0 33.0 31.0 33.0 5 32.50025 33.0 33.0 33.0 32.0 34.0 6 37.01725 38.0 37.0 38.0 36.0 38.0 7 37.23925 38.0 38.0 38.0 36.0 38.0 8 37.49675 38.0 38.0 38.0 37.0 38.0 9 37.56225 38.0 38.0 38.0 38.0 38.0 10-14 37.6177 38.0 38.0 38.0 38.0 38.0 15-19 37.5692 38.0 38.0 38.0 38.0 38.0 20-24 37.5324 38.0 38.0 38.0 38.0 38.0 25-29 37.49485 38.0 38.0 38.0 38.0 38.0 30-34 37.49765 38.0 38.0 38.0 38.0 38.0 35-39 37.5214 38.0 38.0 38.0 38.0 38.0 40-44 37.444950000000006 38.0 38.0 38.0 37.6 38.0 45-49 37.32555 38.0 38.0 38.0 37.0 38.0 50-54 37.32805 38.0 38.0 38.0 37.0 38.0 55-59 37.2688 38.0 38.0 38.0 37.0 38.0 60-64 37.1793 38.0 38.0 38.0 36.6 38.0 65-69 37.1933 38.0 38.0 38.0 36.8 38.0 70-74 37.1757 38.0 38.0 38.0 36.2 38.0 75-79 37.036 38.0 38.0 38.0 35.8 38.0 80-84 37.008449999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.75525 38.0 38.0 38.0 34.8 38.0 90-94 36.77055 38.0 38.0 38.0 34.8 38.0 95-99 36.87655 38.0 38.0 38.0 35.2 38.0 100-104 36.731700000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.50255 38.0 38.0 38.0 34.0 38.0 110-114 36.292 38.0 37.8 38.0 34.0 38.0 115-119 36.3422 38.0 38.0 38.0 33.6 38.0 120-124 36.20175 38.0 37.4 38.0 33.4 38.0 125-129 35.943650000000005 38.0 36.8 38.0 32.4 38.0 130-134 35.37405 38.0 36.2 38.0 28.8 38.0 135-139 35.2665 38.0 36.0 38.0 29.2 38.0 140-144 35.03515 38.0 35.4 38.0 29.2 38.0 145-149 34.7252 38.0 35.0 38.0 28.2 38.0 150-151 30.542125 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 3.0 22 6.0 23 2.0 24 3.0 25 11.0 26 11.0 27 18.0 28 24.0 29 21.0 30 37.0 31 52.0 32 63.0 33 92.0 34 154.0 35 267.0 36 707.0 37 2520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.29299363057325 14.420382165605094 10.929936305732484 36.35668789808918 2 20.527638190954775 20.150753768844222 37.713567839195974 21.608040201005025 3 18.15 28.299999999999997 27.525 26.025 4 22.8 33.025 23.200000000000003 20.974999999999998 5 22.5 36.4 23.625 17.474999999999998 6 16.650000000000002 34.525 26.85 21.975 7 13.125 21.5 45.525 19.85 8 17.9 21.2 31.624999999999996 29.275000000000002 9 17.7 23.1 31.825 27.375 10-14 19.845 28.999999999999996 26.68 24.474999999999998 15-19 19.82 28.49 27.735 23.955000000000002 20-24 19.81 28.285 28.38 23.525 25-29 19.705000000000002 28.625 27.66 24.01 30-34 20.0 28.34 27.315 24.345 35-39 19.935 28.265 27.505000000000003 24.295 40-44 19.919999999999998 28.060000000000002 27.634999999999998 24.385 45-49 19.794999999999998 28.01 27.815 24.38 50-54 20.565 28.48 27.295 23.66 55-59 20.29 28.310000000000002 27.165 24.235 60-64 20.405 28.470000000000002 27.445000000000004 23.68 65-69 20.345 27.88 28.01 23.765 70-74 20.41 27.98 27.229999999999997 24.38 75-79 20.5 28.68 27.905 22.915 80-84 20.055 28.095 27.905 23.945 85-89 20.18 28.175 27.474999999999998 24.169999999999998 90-94 19.685 28.32 27.73 24.265 95-99 19.939999999999998 28.005000000000003 28.110000000000003 23.945 100-104 20.29 28.299999999999997 27.705000000000002 23.705000000000002 105-109 20.244999999999997 27.825 28.34 23.59 110-114 20.162056719851947 27.989796428750065 27.63967388586005 24.20847296553794 115-119 20.055 28.494999999999997 27.650000000000002 23.799999999999997 120-124 19.91 28.21 27.589999999999996 24.29 125-129 20.380000000000003 28.125 27.73 23.765 130-134 20.495 27.63 27.584999999999997 24.29 135-139 21.055 28.315 27.16 23.47 140-144 20.995 27.834999999999997 26.875 24.295 145-149 21.255 28.365000000000002 26.740000000000002 23.64 150-151 21.087500000000002 27.700000000000003 27.1625 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 3.5 27 3.0 28 5.0 29 8.0 30 9.5 31 17.0 32 24.0 33 30.0 34 46.5 35 61.5 36 87.5 37 113.5 38 128.5 39 150.5 40 181.5 41 224.5 42 259.5 43 274.0 44 279.0 45 294.5 46 313.0 47 288.5 48 249.0 49 202.5 50 158.5 51 142.5 52 110.5 53 75.5 54 65.5 55 54.0 56 31.5 57 23.5 58 21.0 59 15.0 60 9.0 61 7.5 62 7.0 63 5.0 64 4.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.034999999999999996 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.4124999999999996 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172697 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172697_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00625 34.0 33.0 34.0 32.0 34.0 2 33.04825 34.0 33.0 34.0 32.0 34.0 3 33.0725 34.0 33.0 34.0 32.0 34.0 4 32.99075 34.0 33.0 34.0 32.0 34.0 5 33.05275 34.0 33.0 34.0 33.0 34.0 6 37.108 38.0 38.0 38.0 37.0 38.0 7 37.1695 38.0 38.0 38.0 37.0 38.0 8 37.1215 38.0 38.0 38.0 37.0 38.0 9 37.16075 38.0 38.0 38.0 37.0 38.0 10-14 37.072 38.0 38.0 38.0 36.8 38.0 15-19 37.10305 38.0 38.0 38.0 37.0 38.0 20-24 37.11715 38.0 38.0 38.0 37.0 38.0 25-29 36.76855 38.0 38.0 38.0 36.6 38.0 30-34 36.07965 38.0 38.0 38.0 35.2 38.0 35-39 36.36905 38.0 38.0 38.0 34.8 38.0 40-44 36.9397 38.0 38.0 38.0 36.0 38.0 45-49 36.9245 38.0 38.0 38.0 36.2 38.0 50-54 36.95835 38.0 38.0 38.0 36.4 38.0 55-59 36.83825 38.0 38.0 38.0 36.0 38.0 60-64 36.576049999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.48135 38.0 38.0 38.0 34.4 38.0 70-74 36.572050000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.55565 38.0 38.0 38.0 35.0 38.0 80-84 36.4876 38.0 38.0 38.0 34.2 38.0 85-89 36.3627 38.0 38.0 38.0 34.2 38.0 90-94 36.30815 38.0 38.0 38.0 34.0 38.0 95-99 36.1586 38.0 38.0 38.0 34.0 38.0 100-104 36.01395 38.0 38.0 38.0 33.2 38.0 105-109 35.9388 38.0 37.8 38.0 32.8 38.0 110-114 35.750350000000005 38.0 37.4 38.0 31.8 38.0 115-119 35.39425 38.0 36.8 38.0 30.6 38.0 120-124 35.03635 38.0 36.0 38.0 28.0 38.0 125-129 34.94185 38.0 36.0 38.0 27.8 38.0 130-134 34.5297 38.0 35.8 38.0 26.0 38.0 135-139 33.857749999999996 38.0 34.4 38.0 21.2 38.0 140-144 33.42725 38.0 33.0 38.0 21.0 38.0 145-149 32.2999 38.0 33.0 38.0 10.8 38.0 150-151 27.189 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 1.0 5 0.0 6 2.0 7 2.0 8 1.0 9 2.0 10 0.0 11 1.0 12 3.0 13 5.0 14 1.0 15 2.0 16 3.0 17 4.0 18 4.0 19 9.0 20 8.0 21 9.0 22 11.0 23 10.0 24 18.0 25 17.0 26 22.0 27 29.0 28 44.0 29 37.0 30 45.0 31 65.0 32 85.0 33 118.0 34 207.0 35 285.0 36 611.0 37 2325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.625 16.575 17.275 26.525 2 26.325 22.1 35.5 16.075 3 20.974999999999998 26.825 31.65 20.549999999999997 4 24.474999999999998 34.025 23.325000000000003 18.175 5 23.599999999999998 36.35 21.475 18.575 6 19.375 36.375 25.374999999999996 18.875 7 19.675 16.825000000000003 42.425000000000004 21.075 8 21.175 23.05 27.900000000000002 27.875 9 22.925 24.25 29.825000000000003 23.0 10-14 23.455000000000002 28.525 26.445 21.575 15-19 23.84 28.28 26.845000000000002 21.035 20-24 23.165 28.615000000000002 27.560000000000002 20.66 25-29 23.140120967741936 28.412298387096772 27.83266129032258 20.614919354838708 30-34 22.523354891694897 28.703418540190945 27.70762755363926 21.065599014474902 35-39 23.206686930091188 28.419452887537993 27.8419452887538 20.53191489361702 40-44 23.155 27.884999999999998 28.425 20.535 45-49 23.665 27.935 27.800000000000004 20.599999999999998 50-54 23.22 27.99 28.189999999999998 20.599999999999998 55-59 23.29 28.12 27.845 20.745 60-64 23.465 27.955000000000002 28.349999999999998 20.23 65-69 23.765 27.935 27.785 20.515 70-74 23.775 27.77 27.515 20.94 75-79 23.615 28.04 27.815 20.53 80-84 23.895 28.43 27.68 19.994999999999997 85-89 23.395 28.055000000000003 27.92 20.630000000000003 90-94 23.735 28.53 27.325 20.41 95-99 23.7 27.834999999999997 27.77 20.695 100-104 24.154999999999998 27.315 27.765 20.765 105-109 23.455000000000002 27.950000000000003 28.065 20.53 110-114 23.68 27.83 27.765 20.724999999999998 115-119 24.27 27.73 27.415 20.585 120-124 23.595 27.310000000000002 28.515 20.580000000000002 125-129 24.37 28.03 27.66 19.939999999999998 130-134 24.725 27.375 28.310000000000002 19.59 135-139 25.080000000000002 27.644999999999996 27.310000000000002 19.965 140-144 24.97 27.97 27.034999999999997 20.025000000000002 145-149 25.39 27.595 27.62 19.395 150-151 25.162499999999998 27.762500000000003 27.212500000000002 19.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 3.0 27 3.5 28 3.5 29 8.5 30 11.0 31 12.5 32 19.5 33 28.0 34 36.0 35 50.0 36 88.5 37 119.5 38 138.5 39 165.0 40 213.0 41 253.0 42 264.5 43 287.0 44 301.0 45 294.0 46 284.5 47 258.0 48 223.5 49 205.0 50 171.5 51 120.5 52 93.5 53 79.5 54 64.5 55 51.0 56 39.0 57 35.5 58 23.0 59 11.5 60 8.0 61 6.0 62 5.5 63 5.0 64 3.0 65 2.0 66 2.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.8 30-34 2.59 35-39 1.3 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0014753727 24.077084 1 >>END_MODULE Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749608 spots for SRR7172697.sra Written 749608 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra Read 749607 spots for SRR7172697.sra Written 749607 spots for SRR7172697.sra SRR ids: ['SRR7172697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5qdhnui4 SRR7172697.sra spots: 14992141 blocks: [[1, 749607], [749608, 1499214], [1499215, 2248821], [2248822, 2998428], [2998429, 3748035], [3748036, 4497642], [4497643, 5247249], [5247250, 5996856], [5996857, 6746463], [6746464, 7496070], [7496071, 8245677], [8245678, 8995284], [8995285, 9744891], [9744892, 10494498], [10494499, 11244105], [11244106, 11993712], [11993713, 12743319], [12743320, 13492926], [13492927, 14242533], [14242534, 14992141]] SRR7172697 file size 5058644 SRR7172697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172697 SRR7172697_1.fastq SRR7172697_2.fastq Input file: SRR7172697_1.fastq Paired file: SRR7172697_2.fastq trimmed: SRR7172697-trimmed-pair1.fastq, SRR7172697-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 13:47:35 2025 >> started Mon Feb 10 13:47:51 2025 >> done (15.308s) 14992141 read pairs processed; of these: 18918 ( 0.13%) short read pairs filtered out after trimming by size control 12103 ( 0.08%) empty read pairs filtered out after trimming by size control 14961120 (99.79%) read pairs available; of these: 7704556 (51.50%) trimmed read pairs available after processing 7256564 (48.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 3 0.00% 35 2 0.00% 36 6 0.00% 37 3 0.00% 38 4 0.00% 39 4 0.00% 40 2 0.00% 41 3 0.00% 42 5 0.00% 43 4 0.00% 44 12 0.00% 45 7 0.00% 46 13 0.00% 47 3 0.00% 48 11 0.00% 49 16 0.00% 50 18 0.00% 51 18 0.00% 52 19 0.00% 53 17 0.00% 54 18 0.00% 55 22 0.00% 56 33 0.00% 57 22 0.00% 58 37 0.00% 59 37 0.00% 60 34 0.00% 61 48 0.00% 62 58 0.00% 63 74 0.00% 64 82 0.00% 65 80 0.00% 66 102 0.00% 67 123 0.00% 68 103 0.00% 69 129 0.00% 70 136 0.00% 71 166 0.00% 72 213 0.00% 73 254 0.00% 74 262 0.00% 75 287 0.00% 76 382 0.00% 77 398 0.00% 78 471 0.00% 79 527 0.00% 80 585 0.00% 81 679 0.00% 82 785 0.01% 83 1064 0.01% 84 1985 0.01% 85 2463 0.02% 86 2683 0.02% 87 2761 0.02% 88 2890 0.02% 89 2937 0.02% 90 3057 0.02% 91 3295 0.02% 92 3462 0.02% 93 3847 0.03% 94 4007 0.03% 95 4331 0.03% 96 4748 0.03% 97 4866 0.03% 98 5345 0.04% 99 5702 0.04% 100 6330 0.04% 101 6473 0.04% 102 7376 0.05% 103 7948 0.05% 104 8539 0.06% 105 9090 0.06% 106 9809 0.07% 107 10393 0.07% 108 10952 0.07% 109 11524 0.08% 110 12473 0.08% 111 13366 0.09% 112 14342 0.10% 113 15422 0.10% 114 16434 0.11% 115 17275 0.12% 116 18378 0.12% 117 19108 0.13% 118 20024 0.13% 119 20956 0.14% 120 21949 0.15% 121 23244 0.16% 122 24671 0.16% 123 26226 0.18% 124 27585 0.18% 125 28853 0.19% 126 30802 0.21% 127 32007 0.21% 128 33300 0.22% 129 35049 0.23% 130 36972 0.25% 131 38979 0.26% 132 41012 0.27% 133 43715 0.29% 134 46035 0.31% 135 49263 0.33% 136 51955 0.35% 137 55380 0.37% 138 58948 0.39% 139 62935 0.42% 140 68132 0.46% 141 75046 0.50% 142 82603 0.55% 143 91842 0.61% 144 105932 0.71% 145 125185 0.84% 146 156007 1.04% 147 211116 1.41% 148 329497 2.20% 149 822468 5.50% 150 4545855 30.38% 151 7256564 48.50% 14961120 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.1 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=438.62 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.4 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.43 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=168.83 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=27.1 sequence=AGGAAGAAGAAGA SRR7172697 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 13:48:36 Started mapping on | Feb 10 13:48:36 Finished on | Feb 10 13:50:06 Mapping speed, Million of reads per hour | 598.44 Number of input reads | 14961120 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14056352 Uniquely mapped reads % | 93.95% Average mapped length | 295.75 Number of splices: Total | 14798505 Number of splices: Annotated (sjdb) | 14585270 Number of splices: GT/AG | 14570579 Number of splices: GC/AG | 184953 Number of splices: AT/AC | 9655 Number of splices: Non-canonical | 33318 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403376 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 64891 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 518693 518693 518693 N_multimapping 403376 403376 403376 N_noFeature 257483 13945431 305038 N_ambiguous 135897 831 71958 UnstrandedReadsAssigned:13662972 PositiveStrandReadsAssigned:110090 NegativeStrandReadsAssigned:13679356 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172697 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172697-trimmed-pair1.fastq SRR7172697-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,961,120 reads, 13,609,788 reads pseudoaligned [quant] estimated average fragment length: 240.163 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7172697.ke.tsv 34699 SRR7172697.se.tsv 87100 total ==> SRR7172697.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.84 1033 42.5171 Potri.005G024800.1.v4.1 1035 795.837 263 24.1953 Potri.004G059700.1.v4.1 961 721.857 10 1.01426 Potri.007G009000.2.v4.1 1416 1176.84 0 0 Potri.003G141000.2.v4.1 2943 2703.84 514 13.9182 Potri.016G087400.1.v4.1 270 75.811 1084 1046.88 Potri.015G069301.1.v4.1 564 328.218 0 0 Potri.010G195200.1.v4.1 1773 1533.84 201 9.59437 Potri.012G127500.1.v4.1 977 737.857 3298 327.249 ==> SRR7172697.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 164 SRR7172697 completed mapping pipeline successfully