Starting /dee2/code/volunteer_pipeline.sh SRR7172698 current disk space = 3057514946560 free memory = 1579817788 SRR7172698 SRAfilesize 65c198586fff29aa76090f3b051121ff SRR7172698.sra SRR7172698.sra file validated SRR7172698 is paired end SRR7172698 is conventional basespace SRR7172698 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172698_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.70025 32.0 18.0 33.0 18.0 34.0 2 30.751 33.0 32.0 33.0 27.0 34.0 3 31.3165 33.0 31.0 33.0 27.0 34.0 4 32.01375 33.0 32.0 33.0 30.0 34.0 5 32.032 33.0 32.0 33.0 31.0 34.0 6 36.9705 38.0 37.0 38.0 35.0 38.0 7 37.403 38.0 38.0 38.0 37.0 38.0 8 37.51175 38.0 38.0 38.0 37.0 38.0 9 37.60175 38.0 38.0 38.0 38.0 38.0 10-14 37.6536 38.0 38.0 38.0 38.0 38.0 15-19 37.615950000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.6167 38.0 38.0 38.0 38.0 38.0 25-29 37.62904999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.6179 38.0 38.0 38.0 38.0 38.0 35-39 37.56795 38.0 38.0 38.0 38.0 38.0 40-44 37.521449999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.5099 38.0 38.0 38.0 38.0 38.0 50-54 37.46935 38.0 38.0 38.0 37.6 38.0 55-59 37.385450000000006 38.0 38.0 38.0 37.4 38.0 60-64 37.329899999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.3026 38.0 38.0 38.0 37.0 38.0 70-74 37.222249999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.1509 38.0 38.0 38.0 36.2 38.0 80-84 37.048700000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.00045 38.0 38.0 38.0 35.8 38.0 90-94 36.94799999999999 38.0 38.0 38.0 36.0 38.0 95-99 36.923899999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.78845 38.0 38.0 38.0 35.0 38.0 105-109 36.594849999999994 38.0 38.0 38.0 34.4 38.0 110-114 36.443200000000004 38.0 38.0 38.0 34.2 38.0 115-119 36.1751 38.0 37.8 38.0 33.8 38.0 120-124 36.33055 38.0 38.0 38.0 34.0 38.0 125-129 36.02 38.0 37.0 38.0 32.6 38.0 130-134 35.4815 38.0 36.2 38.0 30.4 38.0 135-139 35.2976 38.0 35.6 38.0 30.0 38.0 140-144 35.12245 38.0 35.8 38.0 28.6 38.0 145-149 34.69345 38.0 35.4 38.0 27.8 38.0 150-151 30.682875 35.5 29.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 3.0 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 1.0 25 8.0 26 10.0 27 20.0 28 15.0 29 20.0 30 25.0 31 44.0 32 54.0 33 100.0 34 140.0 35 271.0 36 667.0 37 2604.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.897435897435894 14.205128205128206 11.692307692307692 47.205128205128204 2 18.063694267515924 20.840764331210192 40.50955414012739 20.585987261146496 3 19.825 24.975 26.525 28.675 4 21.55 35.099999999999994 20.724999999999998 22.625 5 21.0 37.65 23.5 17.849999999999998 6 15.85 37.45 26.575 20.125 7 12.049999999999999 21.55 46.300000000000004 20.1 8 17.925 22.25 31.874999999999996 27.950000000000003 9 18.4 22.675 31.225 27.700000000000003 10-14 19.365 29.830000000000002 26.765 24.04 15-19 19.5 28.08 28.125 24.295 20-24 19.57 28.22 28.470000000000002 23.74 25-29 18.675 28.860000000000003 28.144999999999996 24.32 30-34 19.7 28.775000000000002 28.09 23.435 35-39 19.18 28.615000000000002 27.884999999999998 24.32 40-44 19.78 28.21 28.235 23.775 45-49 19.885 28.675 27.51 23.93 50-54 19.77 28.754999999999995 27.485 23.990000000000002 55-59 20.29 28.265 27.87 23.575 60-64 20.275000000000002 28.349999999999998 27.915 23.46 65-69 20.125 28.715000000000003 27.735 23.425 70-74 20.150000000000002 28.465 27.42 23.965 75-79 19.8 29.17 27.105 23.925 80-84 19.64 28.845 27.755000000000003 23.76 85-89 19.61 28.360000000000003 28.175 23.855 90-94 20.055 27.805000000000003 28.54 23.599999999999998 95-99 20.25 28.310000000000002 28.194999999999997 23.244999999999997 100-104 20.205000000000002 28.815 27.529999999999998 23.45 105-109 19.755 28.27 27.775 24.2 110-114 20.01501125844383 28.261195896922693 28.231173380035024 23.492619464598448 115-119 19.57666649947334 27.943020514621058 28.349300295932185 24.131012689973417 120-124 19.68 28.349999999999998 27.839999999999996 24.13 125-129 20.075000000000003 28.735 28.03 23.16 130-134 20.93 28.225 27.169999999999998 23.674999999999997 135-139 20.71 28.345 27.49 23.455000000000002 140-144 20.57 27.87 28.04 23.52 145-149 20.544999999999998 28.294999999999998 27.395000000000003 23.765 150-151 21.3125 27.8875 27.1375 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.0 25 2.5 26 4.5 27 5.5 28 8.0 29 15.0 30 21.5 31 27.0 32 34.0 33 39.0 34 57.5 35 80.0 36 96.5 37 106.5 38 132.0 39 162.5 40 186.0 41 228.0 42 269.5 43 289.0 44 289.0 45 285.5 46 273.0 47 250.5 48 229.0 49 198.5 50 169.5 51 135.5 52 103.5 53 81.5 54 58.0 55 45.5 56 36.0 57 30.0 58 18.0 59 6.0 60 4.0 61 4.0 62 3.5 63 2.0 64 1.5 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 1.875 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.315 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0125 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.037500000000000006 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.05 0.025 0.0 0.0 0.0 94-95 0.07500000000000001 0.025 0.0 0.0 0.0 96-97 0.1 0.025 0.0 0.0 0.0 98-99 0.1375 0.025 0.0 0.0 0.0 100-101 0.175 0.025 0.0 0.0 0.0 102-103 0.2 0.025 0.0 0.0 0.0 104-105 0.2625 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.375 0.025 0.0 0.0 0.0 110-111 0.5125 0.025 0.0 0.0 0.0 112-113 0.6625 0.025 0.0 0.0 0.0 114-115 0.8875 0.025 0.0 0.0 0.0 116-117 1.1 0.025 0.0 0.0 0.0 118-119 1.225 0.025 0.0 0.0 0.0 120-121 1.5625 0.025 0.0 0.0 0.0 122-123 1.9 0.025 0.0 0.0 0.0 124-125 2.0 0.025 0.0 0.0 0.0 126-127 2.175 0.025 0.0 0.0 0.0 128-129 2.3375 0.025 0.0 0.0 0.0 130-131 2.6375 0.025 0.0 0.0 0.0 132-133 2.9625 0.025 0.0 0.0 0.0 134-135 3.175 0.025 0.0 0.0 0.0 136-137 3.4375 0.025 0.0 0.0 0.0 138-139 3.6625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172698 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172698_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18875 34.0 33.0 34.0 33.0 34.0 2 33.25125 34.0 33.0 34.0 33.0 34.0 3 33.254 34.0 33.0 34.0 33.0 34.0 4 33.292 34.0 33.0 34.0 33.0 34.0 5 33.313 34.0 33.0 34.0 33.0 34.0 6 37.45925 38.0 38.0 38.0 38.0 38.0 7 37.45875 38.0 38.0 38.0 38.0 38.0 8 37.4005 38.0 38.0 38.0 38.0 38.0 9 37.43825 38.0 38.0 38.0 38.0 38.0 10-14 37.42665 38.0 38.0 38.0 38.0 38.0 15-19 37.38315 38.0 38.0 38.0 38.0 38.0 20-24 37.379 38.0 38.0 38.0 38.0 38.0 25-29 37.01105 38.0 38.0 38.0 37.4 38.0 30-34 36.5347 38.0 38.0 38.0 37.0 38.0 35-39 36.7509 38.0 38.0 38.0 36.8 38.0 40-44 37.26755 38.0 38.0 38.0 37.4 38.0 45-49 37.2659 38.0 38.0 38.0 37.4 38.0 50-54 37.25964999999999 38.0 38.0 38.0 37.4 38.0 55-59 37.170100000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.1001 38.0 38.0 38.0 37.0 38.0 65-69 36.982899999999994 38.0 38.0 38.0 36.6 38.0 70-74 36.95875 38.0 38.0 38.0 36.2 38.0 75-79 36.92655 38.0 38.0 38.0 36.4 38.0 80-84 36.83005 38.0 38.0 38.0 35.8 38.0 85-89 36.72880000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.75025 38.0 38.0 38.0 35.6 38.0 95-99 36.661500000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.5733 38.0 38.0 38.0 34.6 38.0 105-109 36.41675 38.0 38.0 38.0 34.2 38.0 110-114 36.2967 38.0 38.0 38.0 34.0 38.0 115-119 36.1716 38.0 38.0 38.0 33.8 38.0 120-124 35.90070000000001 38.0 37.6 38.0 33.0 38.0 125-129 35.73915000000001 38.0 37.2 38.0 32.2 38.0 130-134 35.4387 38.0 36.4 38.0 31.4 38.0 135-139 35.26805 38.0 36.0 38.0 30.4 38.0 140-144 34.7444 38.0 35.8 38.0 27.6 38.0 145-149 33.93385 38.0 33.8 38.0 23.8 38.0 150-151 30.008375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 1.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 2.0 13 3.0 14 0.0 15 2.0 16 4.0 17 3.0 18 2.0 19 5.0 20 9.0 21 5.0 22 8.0 23 8.0 24 13.0 25 7.0 26 16.0 27 19.0 28 20.0 29 28.0 30 42.0 31 59.0 32 54.0 33 84.0 34 137.0 35 234.0 36 493.0 37 2732.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 14.000000000000002 17.125 34.075 2 22.650000000000002 22.425 38.525 16.400000000000002 3 20.75 25.2 31.724999999999998 22.325 4 23.275000000000002 34.675 22.725 19.325 5 22.975 36.7 22.425 17.9 6 17.8 38.324999999999996 24.8 19.075 7 17.95 17.025000000000002 44.275 20.75 8 20.45 22.125 29.675 27.750000000000004 9 22.675 22.725 30.25 24.349999999999998 10-14 21.95 29.185 26.840000000000003 22.025 15-19 23.18 27.47 28.050000000000004 21.3 20-24 22.8 28.215 27.894999999999996 21.09 25-29 23.062953995157383 28.208232445520583 28.041767554479417 20.687046004842617 30-34 23.145020980452358 28.211032647630745 27.85282980247672 20.79111656944018 35-39 22.28860759493671 27.964556962025316 28.48607594936709 21.260759493670886 40-44 22.8 28.465 27.96 20.775 45-49 22.725 28.67 28.355000000000004 20.25 50-54 22.975 27.944999999999997 28.410000000000004 20.669999999999998 55-59 22.71 27.950000000000003 28.299999999999997 21.04 60-64 22.345000000000002 27.74 29.255 20.66 65-69 23.369999999999997 27.445000000000004 28.49 20.695 70-74 23.39 27.99 28.425 20.195 75-79 22.625 28.38 28.355000000000004 20.64 80-84 22.78 27.994999999999997 28.935 20.29 85-89 23.345 28.285 28.139999999999997 20.23 90-94 23.369999999999997 27.49 28.51 20.630000000000003 95-99 23.525 27.925 28.17 20.380000000000003 100-104 24.375 27.965 27.785 19.875 105-109 23.565 27.439999999999998 28.939999999999998 20.055 110-114 23.705000000000002 28.32 27.950000000000003 20.025000000000002 115-119 23.23 28.375 27.644999999999996 20.75 120-124 23.919999999999998 27.735 28.595 19.75 125-129 24.07 27.700000000000003 28.060000000000002 20.169999999999998 130-134 23.925 28.48 27.55 20.044999999999998 135-139 24.625 28.144999999999996 27.72 19.509999999999998 140-144 24.435000000000002 27.195000000000004 27.794999999999998 20.575 145-149 24.39 27.750000000000004 27.595 20.265 150-151 25.45 27.3 27.987499999999997 19.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.5 25 2.0 26 2.5 27 6.5 28 7.5 29 11.0 30 16.0 31 20.0 32 32.5 33 38.5 34 45.5 35 67.5 36 85.5 37 112.0 38 143.5 39 180.0 40 220.5 41 253.5 42 285.0 43 290.5 44 274.0 45 277.5 46 279.5 47 245.5 48 209.5 49 189.0 50 171.0 51 136.5 52 102.0 53 79.0 54 60.5 55 46.5 56 33.0 57 21.0 58 11.5 59 9.5 60 6.5 61 4.5 62 5.0 63 3.0 64 2.5 65 3.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.88 30-34 2.29 35-39 1.25 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.47500000000000003 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.8625 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.6375 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCC 10 0.0069071017 144.46251 6 >>END_MODULE Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676588 spots for SRR7172698.sra Written 676588 spots for SRR7172698.sra Read 676606 spots for SRR7172698.sra Written 676606 spots for SRR7172698.sra SRR ids: ['SRR7172698.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i6jhu91m SRR7172698.sra spots: 13531778 blocks: [[1, 676588], [676589, 1353176], [1353177, 2029764], [2029765, 2706352], [2706353, 3382940], [3382941, 4059528], [4059529, 4736116], [4736117, 5412704], [5412705, 6089292], [6089293, 6765880], [6765881, 7442468], [7442469, 8119056], [8119057, 8795644], [8795645, 9472232], [9472233, 10148820], [10148821, 10825408], [10825409, 11501996], [11501997, 12178584], [12178585, 12855172], [12855173, 13531778]] SRR7172698 file size 4563775 SRR7172698 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172698 SRR7172698_1.fastq SRR7172698_2.fastq Input file: SRR7172698_1.fastq Paired file: SRR7172698_2.fastq trimmed: SRR7172698-trimmed-pair1.fastq, SRR7172698-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:29:41 2025 >> started Mon Feb 10 18:29:56 2025 >> done (14.283s) 13531778 read pairs processed; of these: 6888 ( 0.05%) short read pairs filtered out after trimming by size control 5306 ( 0.04%) empty read pairs filtered out after trimming by size control 13519584 (99.91%) read pairs available; of these: 5171407 (38.25%) trimmed read pairs available after processing 8348177 (61.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 5 0.00% 29 4 0.00% 30 1 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 2 0.00% 37 5 0.00% 38 3 0.00% 39 3 0.00% 40 7 0.00% 41 3 0.00% 42 3 0.00% 43 8 0.00% 44 4 0.00% 45 3 0.00% 46 5 0.00% 47 14 0.00% 48 6 0.00% 49 13 0.00% 50 11 0.00% 51 20 0.00% 52 13 0.00% 53 10 0.00% 54 22 0.00% 55 25 0.00% 56 23 0.00% 57 25 0.00% 58 30 0.00% 59 37 0.00% 60 33 0.00% 61 43 0.00% 62 48 0.00% 63 63 0.00% 64 57 0.00% 65 71 0.00% 66 100 0.00% 67 102 0.00% 68 115 0.00% 69 131 0.00% 70 169 0.00% 71 166 0.00% 72 207 0.00% 73 255 0.00% 74 266 0.00% 75 331 0.00% 76 376 0.00% 77 398 0.00% 78 447 0.00% 79 485 0.00% 80 583 0.00% 81 704 0.01% 82 744 0.01% 83 855 0.01% 84 1372 0.01% 85 1607 0.01% 86 1821 0.01% 87 1898 0.01% 88 2180 0.02% 89 2198 0.02% 90 2489 0.02% 91 2544 0.02% 92 2758 0.02% 93 3219 0.02% 94 3356 0.02% 95 3705 0.03% 96 3872 0.03% 97 4228 0.03% 98 4684 0.03% 99 4995 0.04% 100 5299 0.04% 101 5624 0.04% 102 5936 0.04% 103 6630 0.05% 104 6898 0.05% 105 7576 0.06% 106 7994 0.06% 107 8335 0.06% 108 9037 0.07% 109 9375 0.07% 110 9969 0.07% 111 10699 0.08% 112 11289 0.08% 113 11987 0.09% 114 12622 0.09% 115 13499 0.10% 116 14121 0.10% 117 14813 0.11% 118 15420 0.11% 119 16043 0.12% 120 17156 0.13% 121 17798 0.13% 122 18575 0.14% 123 19488 0.14% 124 20884 0.15% 125 21870 0.16% 126 22945 0.17% 127 24257 0.18% 128 25246 0.19% 129 26087 0.19% 130 27695 0.20% 131 29121 0.22% 132 30456 0.23% 133 32157 0.24% 134 34080 0.25% 135 35837 0.27% 136 37708 0.28% 137 40418 0.30% 138 43315 0.32% 139 46280 0.34% 140 49883 0.37% 141 54315 0.40% 142 60856 0.45% 143 67699 0.50% 144 77298 0.57% 145 91059 0.67% 146 113088 0.84% 147 153023 1.13% 148 237085 1.75% 149 477004 3.53% 150 2961558 21.91% 151 8348177 61.75% 13519584 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.2 sequence=AAGGATCTCTCTCCTTTAACGACACCATCATTGTAAAGGAACAACTGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=160.28 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.8 sequence=GAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=3.6 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=344.88 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=27.6 sequence=AAGAAGAAGAAA SRR7172698 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:30:46 Started mapping on | Feb 10 18:30:47 Finished on | Feb 10 18:32:03 Mapping speed, Million of reads per hour | 640.40 Number of input reads | 13519584 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12980475 Uniquely mapped reads % | 96.01% Average mapped length | 296.84 Number of splices: Total | 13320552 Number of splices: Annotated (sjdb) | 13098316 Number of splices: GT/AG | 13112351 Number of splices: GC/AG | 167645 Number of splices: AT/AC | 9798 Number of splices: Non-canonical | 30758 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337323 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 36346 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 208951 208951 208951 N_multimapping 337323 337323 337323 N_noFeature 326527 12877875 369037 N_ambiguous 125850 611 65444 UnstrandedReadsAssigned:12528098 PositiveStrandReadsAssigned:101989 NegativeStrandReadsAssigned:12545994 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172698 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172698-trimmed-pair1.fastq SRR7172698-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,519,584 reads, 12,445,889 reads pseudoaligned [quant] estimated average fragment length: 253.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7172698.ke.tsv 34699 SRR7172698.se.tsv 87100 total ==> SRR7172698.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.17 822 37.1817 Potri.005G024800.1.v4.1 1035 782.171 480 48.9986 Potri.004G059700.1.v4.1 961 708.206 13 1.46564 Potri.007G009000.2.v4.1 1416 1163.17 0 0 Potri.003G141000.2.v4.1 2943 2690.17 475.302 14.107 Potri.016G087400.1.v4.1 270 74.0551 781.111 842.175 Potri.015G069301.1.v4.1 564 317.342 0 0 Potri.010G195200.1.v4.1 1773 1520.17 84 4.41195 Potri.012G127500.1.v4.1 977 724.189 1840 202.866 ==> SRR7172698.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 321 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 109 SRR7172698 completed mapping pipeline successfully