Starting /dee2/code/volunteer_pipeline.sh SRR7172699 current disk space = 3057864896512 free memory = 1238242688 SRR7172699 SRAfilesize f208bfea91fb6161041adab3bfabb1b1 SRR7172699.sra SRR7172699.sra file validated SRR7172699 is paired end SRR7172699 is conventional basespace SRR7172699 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172699_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1125 33.0 33.0 34.0 32.0 34.0 2 32.655 33.0 33.0 34.0 32.0 34.0 3 32.10325 33.0 32.0 33.0 30.0 34.0 4 32.63275 33.0 33.0 34.0 31.0 34.0 5 32.861 33.0 33.0 34.0 32.0 34.0 6 37.269 38.0 38.0 38.0 36.0 38.0 7 37.53625 38.0 38.0 38.0 37.0 38.0 8 37.58875 38.0 38.0 38.0 38.0 38.0 9 37.62025 38.0 38.0 38.0 38.0 38.0 10-14 37.64875 38.0 38.0 38.0 38.0 38.0 15-19 37.6465 38.0 38.0 38.0 38.0 38.0 20-24 37.595800000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.603049999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.58325 38.0 38.0 38.0 38.0 38.0 35-39 37.541650000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.47435 38.0 38.0 38.0 38.0 38.0 45-49 37.49315 38.0 38.0 38.0 38.0 38.0 50-54 37.405899999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.2853 38.0 38.0 38.0 37.0 38.0 60-64 37.31224999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.197900000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.11039999999999 38.0 38.0 38.0 36.4 38.0 75-79 37.04995 38.0 38.0 38.0 36.0 38.0 80-84 36.98575000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.74595 38.0 38.0 38.0 35.2 38.0 90-94 36.89815 38.0 38.0 38.0 35.6 38.0 95-99 36.853449999999995 38.0 38.0 38.0 35.6 38.0 100-104 36.665 38.0 38.0 38.0 34.6 38.0 105-109 36.32205 38.0 38.0 38.0 34.0 38.0 110-114 36.15745 38.0 37.6 38.0 33.4 38.0 115-119 36.159749999999995 38.0 37.2 38.0 33.4 38.0 120-124 36.291399999999996 38.0 38.0 38.0 33.8 38.0 125-129 36.03545 38.0 37.4 38.0 33.4 38.0 130-134 35.540200000000006 38.0 36.0 38.0 30.4 38.0 135-139 35.209700000000005 38.0 36.0 38.0 28.4 38.0 140-144 35.22355 38.0 36.0 38.0 30.4 38.0 145-149 34.96915 38.0 36.0 38.0 30.4 38.0 150-151 31.241625 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 1.0 19 3.0 20 2.0 21 0.0 22 3.0 23 6.0 24 7.0 25 8.0 26 11.0 27 16.0 28 7.0 29 25.0 30 36.0 31 53.0 32 60.0 33 84.0 34 140.0 35 245.0 36 551.0 37 2733.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.613972463029064 12.850586435492096 12.11116777154513 38.424273329933705 2 19.66390770002508 19.212440431402054 39.12716328066215 21.996488587910708 3 20.525 25.0 26.525 27.950000000000003 4 23.575 33.050000000000004 21.85 21.525 5 22.875 35.6 23.25 18.275 6 16.625 35.725 27.525 20.125 7 14.424999999999999 20.974999999999998 45.475 19.125 8 16.575 23.1 31.424999999999997 28.9 9 19.05 22.675 33.275 25.0 10-14 19.165 29.39 27.52 23.925 15-19 19.71 28.115000000000002 28.65 23.525 20-24 19.36 27.74 28.895 24.005000000000003 25-29 19.384999999999998 28.48 28.525 23.61 30-34 19.195 28.110000000000003 28.794999999999998 23.9 35-39 19.215 28.549999999999997 27.96 24.275 40-44 19.99 28.050000000000004 27.83 24.13 45-49 20.21 28.12 27.889999999999997 23.78 50-54 20.255000000000003 28.265 27.689999999999998 23.79 55-59 19.715 28.575 28.105000000000004 23.605 60-64 19.31 28.37 28.025 24.295 65-69 20.165 28.549999999999997 27.765 23.52 70-74 19.93 28.63 27.794999999999998 23.645 75-79 20.349999999999998 27.700000000000003 28.360000000000003 23.59 80-84 19.994999999999997 27.76 28.37 23.875 85-89 19.84 28.305000000000003 28.345 23.51 90-94 20.055 28.38 27.744999999999997 23.82 95-99 19.939999999999998 28.505000000000003 27.83 23.724999999999998 100-104 19.99 27.195000000000004 28.88 23.935000000000002 105-109 20.57 28.599999999999998 27.61 23.22 110-114 20.412247348409046 28.47708625175105 27.41144686812087 23.69921953171903 115-119 20.3 28.01 28.32 23.369999999999997 120-124 20.235 28.335 27.860000000000003 23.57 125-129 20.735 27.450000000000003 27.83 23.985 130-134 20.775 27.775 27.639999999999997 23.810000000000002 135-139 20.75 28.115000000000002 27.685 23.45 140-144 20.18 28.215 27.52 24.085 145-149 20.745 28.59 27.150000000000002 23.515 150-151 21.375 27.474999999999998 27.125 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.5 26 3.5 27 7.5 28 11.5 29 12.0 30 15.0 31 19.0 32 28.5 33 35.5 34 42.0 35 62.0 36 94.5 37 118.0 38 137.0 39 171.0 40 205.5 41 242.5 42 275.0 43 293.5 44 281.5 45 277.5 46 278.0 47 257.5 48 228.0 49 194.5 50 169.0 51 130.5 52 100.0 53 78.0 54 58.0 55 44.0 56 33.0 57 24.5 58 14.5 59 9.5 60 8.0 61 6.0 62 5.5 63 5.0 64 2.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.06 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.4124999999999996 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 25 4.982678E-4 28.995 125-129 >>END_MODULE SRR7172699 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172699_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15525 34.0 33.0 34.0 33.0 34.0 2 33.2195 34.0 33.0 34.0 33.0 34.0 3 33.2225 34.0 33.0 34.0 33.0 34.0 4 33.198 34.0 33.0 34.0 33.0 34.0 5 33.2025 34.0 33.0 34.0 33.0 34.0 6 37.2985 38.0 38.0 38.0 38.0 38.0 7 37.30625 38.0 38.0 38.0 38.0 38.0 8 37.3375 38.0 38.0 38.0 38.0 38.0 9 37.2675 38.0 38.0 38.0 38.0 38.0 10-14 37.2776 38.0 38.0 38.0 38.0 38.0 15-19 37.291199999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.2089 38.0 38.0 38.0 37.8 38.0 25-29 36.89775 38.0 38.0 38.0 36.8 38.0 30-34 36.2382 38.0 38.0 38.0 36.2 38.0 35-39 36.554100000000005 38.0 38.0 38.0 35.8 38.0 40-44 37.09335 38.0 38.0 38.0 37.0 38.0 45-49 37.14975 38.0 38.0 38.0 37.0 38.0 50-54 37.10844999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.99210000000001 38.0 38.0 38.0 36.4 38.0 60-64 36.92155 38.0 38.0 38.0 36.2 38.0 65-69 36.777300000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.80929999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.7066 38.0 38.0 38.0 35.8 38.0 80-84 36.77575 38.0 38.0 38.0 35.8 38.0 85-89 36.68695 38.0 38.0 38.0 35.8 38.0 90-94 36.588499999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.6036 38.0 38.0 38.0 35.0 38.0 100-104 36.469449999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.42139999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.23655 38.0 38.0 38.0 34.0 38.0 115-119 36.07225 38.0 38.0 38.0 33.8 38.0 120-124 35.793350000000004 38.0 37.4 38.0 32.6 38.0 125-129 35.595600000000005 38.0 36.8 38.0 31.0 38.0 130-134 35.312 38.0 36.0 38.0 30.6 38.0 135-139 35.1715 38.0 36.0 38.0 30.6 38.0 140-144 34.562749999999994 38.0 35.8 38.0 27.4 38.0 145-149 33.689699999999995 38.0 33.2 38.0 23.2 38.0 150-151 29.359249999999996 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 6.0 6 2.0 7 0.0 8 0.0 9 2.0 10 1.0 11 2.0 12 1.0 13 0.0 14 2.0 15 2.0 16 4.0 17 2.0 18 2.0 19 4.0 20 4.0 21 7.0 22 5.0 23 13.0 24 11.0 25 10.0 26 12.0 27 17.0 28 28.0 29 30.0 30 39.0 31 38.0 32 72.0 33 96.0 34 144.0 35 252.0 36 517.0 37 2661.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.125 15.6 18.125 30.15 2 22.975 24.125 36.199999999999996 16.7 3 20.674999999999997 27.800000000000004 31.25 20.275000000000002 4 24.8 35.25 21.375 18.575 5 24.775 37.2 21.0 17.025000000000002 6 18.375 40.1 22.6 18.925 7 17.7 17.724999999999998 43.275000000000006 21.3 8 20.05 22.25 28.825 28.875 9 22.875 23.275000000000002 28.625 25.224999999999998 10-14 23.305 28.910000000000004 26.43 21.355 15-19 23.355 28.03 27.58 21.035 20-24 23.005 28.99 27.265 20.74 25-29 22.811791383219955 28.39506172839506 27.63920382968002 21.153943058704964 30-34 22.914634772342282 29.16688055027976 27.406190647297368 20.51229403008059 35-39 23.16881802075424 28.458618071374335 27.71450265755505 20.658061250316376 40-44 23.135 28.365000000000002 27.295 21.205 45-49 23.105 27.985 28.34 20.57 50-54 23.565 28.07 27.62 20.745 55-59 23.39 28.59 27.595 20.424999999999997 60-64 23.415 28.38 27.555000000000003 20.65 65-69 23.3 27.994999999999997 27.965 20.74 70-74 23.835 28.215 27.634999999999998 20.315 75-79 24.05 28.685 27.205000000000002 20.06 80-84 23.72 27.944999999999997 27.785 20.549999999999997 85-89 23.94 27.744999999999997 27.634999999999998 20.68 90-94 23.49 28.605000000000004 28.04 19.865 95-99 23.580000000000002 28.060000000000002 28.185 20.175 100-104 23.395 28.325 28.139999999999997 20.14 105-109 24.315 28.175 27.77 19.74 110-114 23.68 28.26 27.839999999999996 20.22 115-119 23.799999999999997 27.389999999999997 28.810000000000002 20.0 120-124 23.65 28.449999999999996 27.51 20.39 125-129 24.485 28.43 27.07 20.015 130-134 24.07 27.99 27.765 20.175 135-139 24.22 28.15 27.589999999999996 20.04 140-144 24.275 28.52 27.384999999999998 19.82 145-149 24.610000000000003 28.53 27.175 19.685 150-151 24.925 27.375 27.4125 20.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 2.5 26 2.0 27 4.0 28 4.5 29 5.0 30 7.5 31 11.0 32 17.0 33 25.5 34 32.0 35 49.5 36 76.0 37 115.0 38 140.5 39 158.5 40 207.0 41 255.5 42 309.0 43 340.0 44 327.5 45 290.5 46 258.5 47 254.0 48 215.0 49 179.0 50 167.0 51 142.5 52 112.0 53 75.5 54 54.5 55 41.5 56 35.0 57 25.0 58 17.0 59 13.5 60 7.0 61 4.5 62 4.5 63 3.5 64 1.0 65 0.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.775 30-34 2.595 35-39 1.225 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.275 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAAGA 10 0.006899958 144.51251 2 CAAAGAT 10 0.006899958 144.51251 3 GCCAAAG 10 0.006899958 144.51251 1 >>END_MODULE Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726554 spots for SRR7172699.sra Written 726554 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra Read 726546 spots for SRR7172699.sra Written 726546 spots for SRR7172699.sra SRR ids: ['SRR7172699.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kf7nkqeh SRR7172699.sra spots: 14530928 blocks: [[1, 726546], [726547, 1453092], [1453093, 2179638], [2179639, 2906184], [2906185, 3632730], [3632731, 4359276], [4359277, 5085822], [5085823, 5812368], [5812369, 6538914], [6538915, 7265460], [7265461, 7992006], [7992007, 8718552], [8718553, 9445098], [9445099, 10171644], [10171645, 10898190], [10898191, 11624736], [11624737, 12351282], [12351283, 13077828], [13077829, 13804374], [13804375, 14530928]] SRR7172699 file size 4902354 SRR7172699 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172699 SRR7172699_1.fastq SRR7172699_2.fastq Input file: SRR7172699_1.fastq Paired file: SRR7172699_2.fastq trimmed: SRR7172699-trimmed-pair1.fastq, SRR7172699-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:52:05 2025 >> started Mon Feb 10 17:52:21 2025 >> done (16.043s) 14530928 read pairs processed; of these: 17154 ( 0.12%) short read pairs filtered out after trimming by size control 10889 ( 0.07%) empty read pairs filtered out after trimming by size control 14502885 (99.81%) read pairs available; of these: 7086401 (48.86%) trimmed read pairs available after processing 7416484 (51.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 5 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 3 0.00% 29 0 0.00% 30 0 0.00% 31 5 0.00% 32 2 0.00% 33 3 0.00% 34 1 0.00% 35 4 0.00% 36 1 0.00% 37 4 0.00% 38 2 0.00% 39 1 0.00% 40 8 0.00% 41 4 0.00% 42 4 0.00% 43 5 0.00% 44 4 0.00% 45 1 0.00% 46 3 0.00% 47 6 0.00% 48 7 0.00% 49 7 0.00% 50 12 0.00% 51 14 0.00% 52 13 0.00% 53 18 0.00% 54 21 0.00% 55 17 0.00% 56 24 0.00% 57 23 0.00% 58 38 0.00% 59 32 0.00% 60 42 0.00% 61 40 0.00% 62 45 0.00% 63 51 0.00% 64 42 0.00% 65 63 0.00% 66 76 0.00% 67 85 0.00% 68 92 0.00% 69 100 0.00% 70 137 0.00% 71 164 0.00% 72 173 0.00% 73 171 0.00% 74 241 0.00% 75 249 0.00% 76 319 0.00% 77 354 0.00% 78 379 0.00% 79 405 0.00% 80 519 0.00% 81 590 0.00% 82 696 0.00% 83 927 0.01% 84 1862 0.01% 85 2385 0.02% 86 2479 0.02% 87 2694 0.02% 88 2655 0.02% 89 2692 0.02% 90 2800 0.02% 91 2951 0.02% 92 3055 0.02% 93 3203 0.02% 94 3422 0.02% 95 3679 0.03% 96 3940 0.03% 97 4399 0.03% 98 4610 0.03% 99 4986 0.03% 100 5356 0.04% 101 5767 0.04% 102 6178 0.04% 103 6516 0.04% 104 7104 0.05% 105 7724 0.05% 106 8408 0.06% 107 8934 0.06% 108 9456 0.07% 109 10112 0.07% 110 10643 0.07% 111 11535 0.08% 112 12147 0.08% 113 12722 0.09% 114 13868 0.10% 115 14710 0.10% 116 15523 0.11% 117 16124 0.11% 118 17063 0.12% 119 17863 0.12% 120 18472 0.13% 121 19862 0.14% 122 20797 0.14% 123 22120 0.15% 124 23247 0.16% 125 24309 0.17% 126 25580 0.18% 127 27256 0.19% 128 28317 0.20% 129 29700 0.20% 130 31573 0.22% 131 33920 0.23% 132 35674 0.25% 133 37691 0.26% 134 40449 0.28% 135 42678 0.29% 136 45485 0.31% 137 49337 0.34% 138 52430 0.36% 139 57106 0.39% 140 61599 0.42% 141 67733 0.47% 142 76154 0.53% 143 86107 0.59% 144 99154 0.68% 145 118786 0.82% 146 149759 1.03% 147 204385 1.41% 148 325037 2.24% 149 769671 5.31% 150 4186176 28.86% 151 7416484 51.14% 14502885 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=141.80 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=23.2 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=5.65 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=3.7 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=104.99 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.5 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTT SRR7172699 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:53:04 Started mapping on | Feb 10 17:53:05 Finished on | Feb 10 17:54:41 Mapping speed, Million of reads per hour | 543.86 Number of input reads | 14502885 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13601391 Uniquely mapped reads % | 93.78% Average mapped length | 296.33 Number of splices: Total | 13849290 Number of splices: Annotated (sjdb) | 13609924 Number of splices: GT/AG | 13635282 Number of splices: GC/AG | 172205 Number of splices: AT/AC | 9991 Number of splices: Non-canonical | 31812 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342551 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 35557 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576172 576172 576172 N_multimapping 342551 342551 342551 N_noFeature 286425 13478278 335849 N_ambiguous 138638 933 64255 UnstrandedReadsAssigned:13176328 PositiveStrandReadsAssigned:122180 NegativeStrandReadsAssigned:13201287 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172699 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172699-trimmed-pair1.fastq SRR7172699-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,502,885 reads, 13,118,686 reads pseudoaligned [quant] estimated average fragment length: 246.667 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7172699.ke.tsv 34699 SRR7172699.se.tsv 87100 total ==> SRR7172699.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.33 1027 45.1453 Potri.005G024800.1.v4.1 1035 789.333 152 15.0028 Potri.004G059700.1.v4.1 961 715.339 37 4.02974 Potri.007G009000.2.v4.1 1416 1170.33 0 0 Potri.003G141000.2.v4.1 2943 2697.33 622 17.9657 Potri.016G087400.1.v4.1 270 73.4888 891 944.592 Potri.015G069301.1.v4.1 564 321.592 0 0 Potri.010G195200.1.v4.1 1773 1527.33 214 10.9161 Potri.012G127500.1.v4.1 977 731.339 2039 217.213 ==> SRR7172699.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 491 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 194 SRR7172699 completed mapping pipeline successfully