Starting /dee2/code/volunteer_pipeline.sh SRR7172700 current disk space = 3058915569664 free memory = 1222680764 SRR7172700 SRAfilesize b283ba39bf8af771aaf9f8a2a04ae160 SRR7172700.sra SRR7172700.sra file validated SRR7172700 is paired end SRR7172700 is conventional basespace SRR7172700 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172700_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.56075 25.0 18.0 32.0 18.0 33.0 2 28.88575 30.0 27.0 33.0 25.0 33.0 3 31.111 33.0 30.0 33.0 27.0 33.0 4 32.059 33.0 33.0 33.0 29.0 34.0 5 32.373 33.0 33.0 33.0 31.0 34.0 6 36.992 38.0 37.0 38.0 35.0 38.0 7 37.1845 38.0 38.0 38.0 36.0 38.0 8 37.39825 38.0 38.0 38.0 37.0 38.0 9 37.57675 38.0 38.0 38.0 38.0 38.0 10-14 37.58825 38.0 38.0 38.0 38.0 38.0 15-19 37.548950000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.50195 38.0 38.0 38.0 37.8 38.0 25-29 37.545100000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.53345 38.0 38.0 38.0 38.0 38.0 35-39 37.494899999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.452749999999995 38.0 38.0 38.0 37.6 38.0 45-49 37.26705 38.0 38.0 38.0 36.8 38.0 50-54 37.34635 38.0 38.0 38.0 37.0 38.0 55-59 37.2069 38.0 38.0 38.0 36.8 38.0 60-64 37.182399999999994 38.0 38.0 38.0 36.8 38.0 65-69 37.19045 38.0 38.0 38.0 36.2 38.0 70-74 37.1397 38.0 38.0 38.0 36.2 38.0 75-79 37.02185 38.0 38.0 38.0 36.0 38.0 80-84 36.9519 38.0 38.0 38.0 35.8 38.0 85-89 36.7178 38.0 38.0 38.0 34.6 38.0 90-94 36.8725 38.0 38.0 38.0 35.2 38.0 95-99 36.794799999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.72715 38.0 38.0 38.0 34.6 38.0 105-109 36.33275 38.0 38.0 38.0 33.8 38.0 110-114 36.24785 38.0 37.6 38.0 33.6 38.0 115-119 36.20675 38.0 37.4 38.0 33.8 38.0 120-124 36.28605 38.0 37.8 38.0 33.8 38.0 125-129 35.878750000000004 38.0 36.8 38.0 32.0 38.0 130-134 35.31875 38.0 36.0 38.0 29.2 38.0 135-139 35.0636 38.0 35.4 38.0 27.8 38.0 140-144 35.11855 38.0 35.6 38.0 29.4 38.0 145-149 34.5062 38.0 34.8 38.0 27.0 38.0 150-151 31.002375 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 3.0 22 1.0 23 7.0 24 7.0 25 6.0 26 9.0 27 12.0 28 30.0 29 29.0 30 50.0 31 65.0 32 84.0 33 93.0 34 142.0 35 266.0 36 699.0 37 2490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.84321815368747 15.471892728210419 11.0881897885508 37.59669932955131 2 20.0 17.333333333333336 36.22641509433962 26.440251572327046 3 18.075 25.424999999999997 26.875 29.625 4 23.125 31.775 23.3 21.8 5 22.0 34.5 23.7 19.8 6 18.75 35.75 25.224999999999998 20.275000000000002 7 13.5 22.8 44.0 19.7 8 17.925 23.125 30.7 28.249999999999996 9 17.349999999999998 23.549999999999997 33.900000000000006 25.2 10-14 19.28 29.854999999999997 26.965 23.9 15-19 20.365 28.34 27.93 23.365 20-24 20.32 27.92 28.21 23.549999999999997 25-29 19.615 28.705000000000002 27.96 23.72 30-34 19.345000000000002 28.294999999999998 28.244999999999997 24.115000000000002 35-39 19.86 28.79 27.815 23.535 40-44 20.04 28.299999999999997 28.139999999999997 23.52 45-49 19.935 28.299999999999997 27.889999999999997 23.875 50-54 20.34 28.93 27.43 23.3 55-59 20.185 28.694999999999997 27.500000000000004 23.62 60-64 19.96 28.57 27.62 23.849999999999998 65-69 19.685 27.834999999999997 28.115000000000002 24.365000000000002 70-74 20.24 28.494999999999997 27.994999999999997 23.27 75-79 20.72 27.815 27.66 23.805 80-84 20.165 28.675 27.87 23.29 85-89 20.46 27.834999999999997 27.794999999999998 23.91 90-94 20.225 28.21 28.000000000000004 23.565 95-99 20.05 28.439999999999998 27.97 23.54 100-104 20.810000000000002 28.189999999999998 27.634999999999998 23.365 105-109 20.169999999999998 28.395 27.834999999999997 23.599999999999998 110-114 20.285 28.17 28.17 23.375 115-119 20.505000000000003 28.470000000000002 27.685 23.34 120-124 20.72 28.299999999999997 27.575 23.405 125-129 20.5 28.18 27.055 24.265 130-134 20.474999999999998 28.68 27.54 23.305 135-139 20.625 28.294999999999998 27.675 23.405 140-144 21.165 27.905 27.315 23.615 145-149 21.25 27.915 27.3 23.535 150-151 20.5375 27.9375 27.05 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.5 24 3.0 25 3.5 26 3.5 27 3.0 28 6.0 29 10.0 30 13.5 31 18.5 32 25.0 33 34.0 34 40.5 35 63.0 36 98.5 37 119.0 38 145.5 39 170.0 40 196.0 41 240.0 42 272.5 43 286.0 44 286.5 45 285.0 46 269.5 47 254.0 48 230.5 49 186.5 50 156.0 51 123.5 52 96.5 53 84.5 54 68.0 55 50.5 56 38.0 57 27.0 58 23.0 59 19.0 60 11.5 61 9.0 62 6.0 63 3.5 64 2.0 65 1.5 66 0.5 67 1.5 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.9 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 3.0875000000000004 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTTAG 10 0.006832588 144.9875 145 >>END_MODULE SRR7172700 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172700_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.056 34.0 33.0 34.0 32.0 34.0 2 33.006 34.0 33.0 34.0 32.0 34.0 3 33.09375 34.0 33.0 34.0 33.0 34.0 4 33.043 34.0 33.0 34.0 32.0 34.0 5 33.0415 34.0 33.0 34.0 32.0 34.0 6 37.1365 38.0 38.0 38.0 37.0 38.0 7 37.056 38.0 38.0 38.0 37.0 38.0 8 37.10725 38.0 38.0 38.0 37.0 38.0 9 37.1015 38.0 38.0 38.0 37.0 38.0 10-14 37.10185 38.0 38.0 38.0 37.0 38.0 15-19 37.0731 38.0 38.0 38.0 37.0 38.0 20-24 37.0369 38.0 38.0 38.0 37.0 38.0 25-29 36.737049999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.0012 38.0 38.0 38.0 35.0 38.0 35-39 36.334199999999996 38.0 38.0 38.0 35.2 38.0 40-44 36.845800000000004 38.0 38.0 38.0 36.6 38.0 45-49 36.8747 38.0 38.0 38.0 36.8 38.0 50-54 36.80310000000001 38.0 38.0 38.0 36.2 38.0 55-59 36.7231 38.0 38.0 38.0 36.0 38.0 60-64 36.55 38.0 38.0 38.0 35.2 38.0 65-69 36.34665 38.0 38.0 38.0 34.2 38.0 70-74 36.47955 38.0 38.0 38.0 34.8 38.0 75-79 36.498149999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.398900000000005 38.0 38.0 38.0 34.6 38.0 85-89 36.3186 38.0 38.0 38.0 34.4 38.0 90-94 36.172000000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.05565 38.0 38.0 38.0 33.4 38.0 100-104 35.98675000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.7893 38.0 37.4 38.0 32.6 38.0 110-114 35.40835 38.0 37.0 38.0 30.0 38.0 115-119 35.22665 38.0 36.8 38.0 28.8 38.0 120-124 34.90185 38.0 36.0 38.0 27.6 38.0 125-129 34.69165 38.0 36.0 38.0 26.4 38.0 130-134 34.3754 38.0 35.4 38.0 25.0 38.0 135-139 33.727999999999994 38.0 33.6 38.0 21.4 38.0 140-144 32.92225 38.0 33.0 38.0 14.2 38.0 145-149 31.7968 38.0 31.8 38.0 10.8 38.0 150-151 26.796999999999997 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 8.0 5 5.0 6 5.0 7 2.0 8 0.0 9 1.0 10 2.0 11 2.0 12 3.0 13 1.0 14 5.0 15 4.0 16 2.0 17 7.0 18 3.0 19 7.0 20 7.0 21 5.0 22 7.0 23 12.0 24 15.0 25 14.0 26 25.0 27 35.0 28 32.0 29 35.0 30 46.0 31 67.0 32 89.0 33 115.0 34 215.0 35 300.0 36 641.0 37 2266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15 17.275 15.8 27.775 2 25.4 23.425 32.875 18.3 3 22.175 26.950000000000003 30.9 19.975 4 24.5 34.55 22.225 18.725 5 24.725 36.825 20.45 18.0 6 18.3 37.0 24.025 20.674999999999997 7 18.875 18.5 40.425 22.2 8 21.099999999999998 23.575 27.125 28.199999999999996 9 23.200000000000003 25.874999999999996 27.375 23.549999999999997 10-14 22.6 28.675 26.97 21.755 15-19 21.905 27.99 28.52 21.584999999999997 20-24 23.22 28.53 27.43 20.82 25-29 23.246452651705745 28.675656636811915 27.42276340947972 20.655127302002615 30-34 23.56200933860126 27.95423059161578 27.99527938837293 20.488480681410024 35-39 22.71462538574392 29.14959275560277 27.520615166691965 20.61516669196135 40-44 23.18 28.565 27.650000000000002 20.605 45-49 22.865 27.975 28.599999999999998 20.560000000000002 50-54 23.1 28.1 27.785 21.015 55-59 23.74 27.99 27.74 20.53 60-64 23.395 28.12 27.97 20.515 65-69 22.875 28.125 27.76 21.240000000000002 70-74 23.595 28.17 28.015 20.22 75-79 23.474999999999998 27.775 28.000000000000004 20.75 80-84 23.71 28.689999999999998 27.589999999999996 20.01 85-89 23.955000000000002 27.779999999999998 27.99 20.275000000000002 90-94 23.965 28.565 27.38 20.09 95-99 23.400000000000002 28.444999999999997 27.77 20.385 100-104 23.745 27.965 27.644999999999996 20.645 105-109 23.52 28.34 27.589999999999996 20.549999999999997 110-114 23.72 28.015 27.72 20.544999999999998 115-119 23.544999999999998 28.384999999999998 27.939999999999998 20.13 120-124 23.830000000000002 28.360000000000003 27.255000000000003 20.555 125-129 23.815 28.535 27.605 20.044999999999998 130-134 24.625 28.07 26.985 20.32 135-139 24.16 28.28 28.025 19.535 140-144 24.349999999999998 28.285 27.310000000000002 20.055 145-149 25.2 27.339999999999996 27.529999999999998 19.93 150-151 24.6 27.224999999999998 27.450000000000003 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.0 22 0.0 23 0.5 24 1.0 25 3.0 26 3.0 27 3.5 28 3.5 29 4.0 30 11.0 31 20.0 32 26.0 33 28.0 34 37.0 35 60.0 36 87.0 37 107.5 38 133.0 39 178.5 40 207.0 41 242.5 42 288.5 43 288.5 44 288.5 45 289.0 46 282.5 47 261.0 48 227.0 49 196.0 50 157.5 51 129.5 52 102.0 53 78.0 54 57.0 55 42.0 56 37.0 57 26.5 58 19.5 59 18.0 60 12.5 61 10.0 62 9.5 63 4.5 64 2.5 65 2.0 66 0.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.63 30-34 2.555 35-39 1.165 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.30135610246107486 0.6 3 0.0 0.0 4 0.05022601707684581 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.6124999999999998 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 902001 spots for SRR7172700.sra Written 902001 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra Read 901987 spots for SRR7172700.sra Written 901987 spots for SRR7172700.sra SRR ids: ['SRR7172700.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z6osduax SRR7172700.sra spots: 18039754 blocks: [[1, 901987], [901988, 1803974], [1803975, 2705961], [2705962, 3607948], [3607949, 4509935], [4509936, 5411922], [5411923, 6313909], [6313910, 7215896], [7215897, 8117883], [8117884, 9019870], [9019871, 9921857], [9921858, 10823844], [10823845, 11725831], [11725832, 12627818], [12627819, 13529805], [13529806, 14431792], [14431793, 15333779], [15333780, 16235766], [16235767, 17137753], [17137754, 18039754]] SRR7172700 file size 6091380 SRR7172700 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172700 SRR7172700_1.fastq SRR7172700_2.fastq Input file: SRR7172700_1.fastq Paired file: SRR7172700_2.fastq trimmed: SRR7172700-trimmed-pair1.fastq, SRR7172700-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:21:19 2025 >> started Mon Feb 10 14:21:47 2025 >> done (27.655s) 18039754 read pairs processed; of these: 27930 ( 0.15%) short read pairs filtered out after trimming by size control 18470 ( 0.10%) empty read pairs filtered out after trimming by size control 17993354 (99.74%) read pairs available; of these: 8023631 (44.59%) trimmed read pairs available after processing 9969723 (55.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 6 0.00% 28 6 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 2 0.00% 36 3 0.00% 37 2 0.00% 38 6 0.00% 39 5 0.00% 40 5 0.00% 41 4 0.00% 42 6 0.00% 43 11 0.00% 44 10 0.00% 45 9 0.00% 46 13 0.00% 47 13 0.00% 48 6 0.00% 49 14 0.00% 50 16 0.00% 51 14 0.00% 52 24 0.00% 53 24 0.00% 54 17 0.00% 55 29 0.00% 56 29 0.00% 57 29 0.00% 58 36 0.00% 59 38 0.00% 60 51 0.00% 61 51 0.00% 62 70 0.00% 63 70 0.00% 64 74 0.00% 65 75 0.00% 66 83 0.00% 67 111 0.00% 68 130 0.00% 69 136 0.00% 70 167 0.00% 71 207 0.00% 72 223 0.00% 73 263 0.00% 74 331 0.00% 75 318 0.00% 76 485 0.00% 77 452 0.00% 78 468 0.00% 79 605 0.00% 80 671 0.00% 81 802 0.00% 82 894 0.00% 83 1059 0.01% 84 2487 0.01% 85 3319 0.02% 86 3481 0.02% 87 3617 0.02% 88 3618 0.02% 89 3626 0.02% 90 3729 0.02% 91 3916 0.02% 92 4083 0.02% 93 4420 0.02% 94 4656 0.03% 95 5122 0.03% 96 5296 0.03% 97 5543 0.03% 98 5915 0.03% 99 6505 0.04% 100 7144 0.04% 101 7620 0.04% 102 8083 0.04% 103 8664 0.05% 104 9333 0.05% 105 10105 0.06% 106 10885 0.06% 107 11553 0.06% 108 12243 0.07% 109 13002 0.07% 110 13418 0.07% 111 14717 0.08% 112 15834 0.09% 113 16774 0.09% 114 17835 0.10% 115 19066 0.11% 116 19763 0.11% 117 21130 0.12% 118 21742 0.12% 119 23206 0.13% 120 24427 0.14% 121 25344 0.14% 122 27075 0.15% 123 29029 0.16% 124 30545 0.17% 125 32104 0.18% 126 33633 0.19% 127 35302 0.20% 128 36949 0.21% 129 39348 0.22% 130 41488 0.23% 131 43403 0.24% 132 46755 0.26% 133 49751 0.28% 134 53188 0.30% 135 57315 0.32% 136 60630 0.34% 137 64831 0.36% 138 70198 0.39% 139 75128 0.42% 140 81912 0.46% 141 91305 0.51% 142 102457 0.57% 143 115353 0.64% 144 134428 0.75% 145 160759 0.89% 146 198521 1.10% 147 269221 1.50% 148 406523 2.26% 149 806855 4.48% 150 4420204 24.57% 151 9969723 55.41% 17993354 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=109.13 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=19.6 sequence=CATCTTCTTCTTTGCCCTCCATC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.35 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=3.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=362.07 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=27.5 sequence=AAGAAGAAGAAA SRR7172700 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:22:35 Started mapping on | Feb 10 14:22:35 Finished on | Feb 10 14:24:47 Mapping speed, Million of reads per hour | 490.73 Number of input reads | 17993354 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16903339 Uniquely mapped reads % | 93.94% Average mapped length | 296.16 Number of splices: Total | 17220209 Number of splices: Annotated (sjdb) | 16920368 Number of splices: GT/AG | 16944820 Number of splices: GC/AG | 219762 Number of splices: AT/AC | 12503 Number of splices: Non-canonical | 43124 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411011 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 58857 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 703981 703981 703981 N_multimapping 411011 411011 411011 N_noFeature 418117 16764579 477649 N_ambiguous 162141 1115 82143 UnstrandedReadsAssigned:16323081 PositiveStrandReadsAssigned:137645 NegativeStrandReadsAssigned:16343547 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172700 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172700-trimmed-pair1.fastq SRR7172700-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,993,354 reads, 16,262,340 reads pseudoaligned [quant] estimated average fragment length: 246.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7172700.ke.tsv 34699 SRR7172700.se.tsv 87100 total ==> SRR7172700.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.13 1363 48.9842 Potri.005G024800.1.v4.1 1035 789.134 210 16.9483 Potri.004G059700.1.v4.1 961 715.146 34 3.0279 Potri.007G009000.2.v4.1 1416 1170.13 0 0 Potri.003G141000.2.v4.1 2943 2697.13 580 13.6956 Potri.016G087400.1.v4.1 270 73.8693 901.485 777.232 Potri.015G069301.1.v4.1 564 321.965 0 0 Potri.010G195200.1.v4.1 1773 1527.13 370.772 15.4628 Potri.012G127500.1.v4.1 977 731.14 6907 601.652 ==> SRR7172700.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 415 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 213 SRR7172700 completed mapping pipeline successfully