Starting /dee2/code/volunteer_pipeline.sh SRR7172701 current disk space = 3059005693952 free memory = 1450742640 SRR7172701 SRAfilesize d458609590d67beae44ac15fee28d544 SRR7172701.sra SRR7172701.sra file validated SRR7172701 is paired end SRR7172701 is conventional basespace SRR7172701 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172701_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.99875 33.0 27.0 33.0 18.0 34.0 2 31.522 33.0 32.0 33.0 27.0 34.0 3 31.7235 33.0 31.0 33.0 28.0 34.0 4 31.8245 33.0 32.0 33.0 30.0 34.0 5 32.33775 33.0 33.0 33.0 31.0 34.0 6 36.74625 38.0 37.0 38.0 34.0 38.0 7 37.25325 38.0 38.0 38.0 36.0 38.0 8 37.5365 38.0 38.0 38.0 38.0 38.0 9 37.6655 38.0 38.0 38.0 38.0 38.0 10-14 37.65835 38.0 38.0 38.0 38.0 38.0 15-19 37.61319999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.624399999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.63945 38.0 38.0 38.0 38.0 38.0 30-34 37.65795 38.0 38.0 38.0 38.0 38.0 35-39 37.6302 38.0 38.0 38.0 38.0 38.0 40-44 37.5772 38.0 38.0 38.0 38.0 38.0 45-49 37.55335 38.0 38.0 38.0 38.0 38.0 50-54 37.4996 38.0 38.0 38.0 38.0 38.0 55-59 37.47695 38.0 38.0 38.0 37.6 38.0 60-64 37.42075 38.0 38.0 38.0 37.0 38.0 65-69 37.350699999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.3043 38.0 38.0 38.0 36.8 38.0 75-79 37.237700000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.11045 38.0 38.0 38.0 36.0 38.0 85-89 37.0199 38.0 38.0 38.0 36.0 38.0 90-94 37.031400000000005 38.0 38.0 38.0 35.8 38.0 95-99 37.006899999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.890249999999995 38.0 38.0 38.0 35.4 38.0 105-109 36.68755 38.0 38.0 38.0 34.6 38.0 110-114 36.476200000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.353449999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.326699999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.1046 38.0 37.2 38.0 33.2 38.0 130-134 35.6683 38.0 36.4 38.0 31.6 38.0 135-139 35.3539 38.0 36.0 38.0 31.0 38.0 140-144 35.211 38.0 35.8 38.0 29.2 38.0 145-149 34.8289 38.0 35.4 38.0 29.2 38.0 150-151 30.83625 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 2.0 20 0.0 21 2.0 22 3.0 23 6.0 24 8.0 25 9.0 26 4.0 27 11.0 28 20.0 29 19.0 30 25.0 31 44.0 32 39.0 33 95.0 34 134.0 35 246.0 36 635.0 37 2693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.380462724935736 13.753213367609254 13.470437017994858 44.39588688946016 2 18.25799898425597 20.924327069578467 40.07110208227527 20.7465718638903 3 20.724999999999998 25.7 25.95 27.625 4 24.275 31.874999999999996 21.7 22.15 5 22.275 34.475 24.95 18.3 6 17.65 35.35 26.25 20.75 7 13.900000000000002 21.775 45.6 18.725 8 18.875 21.4 30.825000000000003 28.9 9 18.375 22.625 33.050000000000004 25.95 10-14 20.31 29.465000000000003 27.150000000000002 23.075000000000003 15-19 19.67 28.64 28.044999999999998 23.645 20-24 19.75 28.525 27.810000000000002 23.915 25-29 20.31 28.37 27.525 23.794999999999998 30-34 19.685 28.549999999999997 27.85 23.915 35-39 19.81 28.365000000000002 28.310000000000002 23.515 40-44 19.775000000000002 28.754999999999995 28.285 23.185 45-49 20.424999999999997 28.12 27.555000000000003 23.9 50-54 20.16 28.275 28.199999999999996 23.365 55-59 20.365 28.225 27.525 23.885 60-64 20.294999999999998 27.565 28.384999999999998 23.755000000000003 65-69 20.36 27.365000000000002 28.585 23.69 70-74 20.16 28.205000000000002 27.82 23.815 75-79 20.625 27.6 28.515 23.26 80-84 20.5 28.175 27.615000000000002 23.71 85-89 19.72 28.375 28.110000000000003 23.794999999999998 90-94 20.669999999999998 27.744999999999997 27.950000000000003 23.635 95-99 20.22 28.165000000000003 28.12 23.494999999999997 100-104 20.31 28.854999999999997 27.615000000000002 23.22 105-109 21.195 28.465 27.575 22.765 110-114 20.815611708781585 28.10607955966975 27.450587940955717 23.627720790592946 115-119 20.196451839230228 28.345193946075973 27.678660920116265 23.779693294577527 120-124 20.665 28.04 27.68 23.615 125-129 21.305 27.61 27.325 23.76 130-134 21.07 28.265 27.439999999999998 23.225 135-139 20.845 28.02 27.639999999999997 23.494999999999997 140-144 21.0 27.744999999999997 27.72 23.535 145-149 20.805 28.299999999999997 27.075 23.82 150-151 21.025 27.8375 26.6125 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 2.0 25 1.5 26 5.5 27 5.5 28 3.5 29 9.5 30 14.0 31 20.0 32 29.0 33 40.5 34 59.5 35 72.0 36 81.0 37 110.5 38 146.0 39 169.5 40 208.5 41 245.0 42 262.0 43 267.5 44 277.5 45 285.0 46 265.0 47 244.0 48 230.5 49 197.0 50 162.0 51 133.0 52 101.0 53 86.5 54 67.5 55 46.5 56 35.5 57 28.0 58 21.5 59 15.0 60 8.5 61 7.5 62 8.5 63 6.5 64 5.0 65 3.0 66 2.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 1.55 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.075 115-119 0.22999999999999998 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0250000000000004 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.1 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.387499999999999 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172701 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172701_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23875 34.0 33.0 34.0 33.0 34.0 2 33.347 34.0 33.0 34.0 33.0 34.0 3 33.2525 34.0 33.0 34.0 33.0 34.0 4 33.279 34.0 33.0 34.0 33.0 34.0 5 33.3295 34.0 33.0 34.0 33.0 34.0 6 37.44775 38.0 38.0 38.0 38.0 38.0 7 37.5085 38.0 38.0 38.0 38.0 38.0 8 37.4595 38.0 38.0 38.0 38.0 38.0 9 37.4035 38.0 38.0 38.0 38.0 38.0 10-14 37.451 38.0 38.0 38.0 38.0 38.0 15-19 37.42 38.0 38.0 38.0 38.0 38.0 20-24 37.431000000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.089 38.0 38.0 38.0 37.6 38.0 30-34 36.44225 38.0 38.0 38.0 37.0 38.0 35-39 36.739 38.0 38.0 38.0 36.8 38.0 40-44 37.316700000000004 38.0 38.0 38.0 37.6 38.0 45-49 37.36325 38.0 38.0 38.0 38.0 38.0 50-54 37.33005 38.0 38.0 38.0 38.0 38.0 55-59 37.25150000000001 38.0 38.0 38.0 37.4 38.0 60-64 37.1321 38.0 38.0 38.0 37.0 38.0 65-69 37.0709 38.0 38.0 38.0 36.6 38.0 70-74 37.043150000000004 38.0 38.0 38.0 36.6 38.0 75-79 37.043150000000004 38.0 38.0 38.0 36.8 38.0 80-84 36.9912 38.0 38.0 38.0 36.4 38.0 85-89 36.90745 38.0 38.0 38.0 36.0 38.0 90-94 36.8446 38.0 38.0 38.0 36.0 38.0 95-99 36.737049999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.625899999999994 38.0 38.0 38.0 34.8 38.0 105-109 36.56735 38.0 38.0 38.0 34.8 38.0 110-114 36.40235 38.0 38.0 38.0 34.0 38.0 115-119 36.2258 38.0 38.0 38.0 34.0 38.0 120-124 36.0108 38.0 38.0 38.0 33.2 38.0 125-129 35.8265 38.0 37.4 38.0 32.4 38.0 130-134 35.49655 38.0 36.4 38.0 31.0 38.0 135-139 35.3368 38.0 36.0 38.0 31.0 38.0 140-144 34.8613 38.0 36.0 38.0 28.8 38.0 145-149 33.966449999999995 38.0 34.0 38.0 25.0 38.0 150-151 30.130625000000002 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 0.0 16 2.0 17 4.0 18 1.0 19 6.0 20 7.0 21 1.0 22 3.0 23 10.0 24 5.0 25 12.0 26 6.0 27 25.0 28 33.0 29 34.0 30 42.0 31 43.0 32 51.0 33 74.0 34 125.0 35 253.0 36 487.0 37 2760.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.475 13.775 19.025 33.725 2 22.975 22.525000000000002 36.775000000000006 17.724999999999998 3 21.3 26.75 30.75 21.2 4 23.625 34.849999999999994 21.625 19.900000000000002 5 23.75 36.875 22.525000000000002 16.85 6 18.325 38.9 22.45 20.325 7 18.099999999999998 17.375 42.025 22.5 8 20.3 21.65 28.925 29.125 9 23.200000000000003 23.375 28.749999999999996 24.675 10-14 22.21 28.660000000000004 27.189999999999998 21.94 15-19 22.49 27.805000000000003 28.23 21.475 20-24 22.535 28.9 26.995 21.57 25-29 22.979174020472996 28.63193989208814 27.53769351016086 20.851192577278 30-34 22.859637409480765 28.031431359457653 28.195778337014023 20.913152894047556 35-39 23.024647530175475 28.15194238766609 27.99472563140278 20.828684450755656 40-44 22.91 27.97 28.144999999999996 20.974999999999998 45-49 23.244999999999997 28.09 27.584999999999997 21.08 50-54 23.095 28.275 28.02 20.61 55-59 23.62 27.935 27.615000000000002 20.830000000000002 60-64 23.125 28.325 27.41 21.14 65-69 23.56 28.000000000000004 27.49 20.95 70-74 23.54 28.17 27.21 21.08 75-79 23.235 28.46 27.205000000000002 21.099999999999998 80-84 23.7 28.675 27.63 19.994999999999997 85-89 23.56 28.73 27.205000000000002 20.505000000000003 90-94 23.515 28.09 27.700000000000003 20.695 95-99 23.415 28.689999999999998 27.584999999999997 20.31 100-104 23.755000000000003 27.79 27.915 20.54 105-109 23.715 27.860000000000003 27.655 20.77 110-114 23.43 28.065 28.105000000000004 20.4 115-119 24.12 28.095 27.395000000000003 20.39 120-124 23.75 27.57 27.74 20.94 125-129 23.82 28.244999999999997 27.485 20.45 130-134 23.945 27.950000000000003 27.88 20.225 135-139 24.21 28.555000000000003 26.974999999999998 20.26 140-144 24.385 28.075 27.355 20.185 145-149 24.945 27.839999999999996 27.495000000000005 19.72 150-151 24.975 27.625 27.6625 19.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 1.0 26 1.5 27 2.5 28 5.0 29 7.5 30 11.5 31 15.0 32 24.0 33 33.5 34 43.0 35 62.5 36 82.5 37 104.0 38 134.0 39 169.5 40 220.5 41 244.5 42 240.0 43 289.5 44 311.5 45 288.0 46 270.0 47 254.0 48 231.0 49 192.5 50 169.5 51 140.0 52 108.5 53 80.5 54 57.5 55 50.0 56 37.0 57 22.5 58 19.0 59 16.5 60 15.0 61 12.5 62 8.5 63 6.0 64 3.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.845 30-34 2.645 35-39 1.41 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.4 0.0 0.0 0.0 0.0 126-127 2.85 0.0 0.0 0.0 0.0 128-129 3.15 0.0 0.0 0.0 0.0 130-131 3.5374999999999996 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.362500000000001 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCATT 10 0.006914255 144.41249 2 >>END_MODULE Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685911 spots for SRR7172701.sra Written 685911 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra Read 685900 spots for SRR7172701.sra Written 685900 spots for SRR7172701.sra SRR ids: ['SRR7172701.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ixnavj5 SRR7172701.sra spots: 13718011 blocks: [[1, 685900], [685901, 1371800], [1371801, 2057700], [2057701, 2743600], [2743601, 3429500], [3429501, 4115400], [4115401, 4801300], [4801301, 5487200], [5487201, 6173100], [6173101, 6859000], [6859001, 7544900], [7544901, 8230800], [8230801, 8916700], [8916701, 9602600], [9602601, 10288500], [10288501, 10974400], [10974401, 11660300], [11660301, 12346200], [12346201, 13032100], [13032101, 13718011]] SRR7172701 file size 4626883 SRR7172701 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172701 SRR7172701_1.fastq SRR7172701_2.fastq Input file: SRR7172701_1.fastq Paired file: SRR7172701_2.fastq trimmed: SRR7172701-trimmed-pair1.fastq, SRR7172701-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:08:33 2025 >> started Mon Feb 10 14:08:56 2025 >> done (22.938s) 13718011 read pairs processed; of these: 8511 ( 0.06%) short read pairs filtered out after trimming by size control 6923 ( 0.05%) empty read pairs filtered out after trimming by size control 13702577 (99.89%) read pairs available; of these: 5358651 (39.11%) trimmed read pairs available after processing 8343926 (60.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 0 0.00% 27 3 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 4 0.00% 36 2 0.00% 37 1 0.00% 38 3 0.00% 39 3 0.00% 40 2 0.00% 41 7 0.00% 42 5 0.00% 43 7 0.00% 44 5 0.00% 45 4 0.00% 46 8 0.00% 47 11 0.00% 48 8 0.00% 49 10 0.00% 50 14 0.00% 51 12 0.00% 52 17 0.00% 53 15 0.00% 54 26 0.00% 55 17 0.00% 56 32 0.00% 57 33 0.00% 58 40 0.00% 59 43 0.00% 60 35 0.00% 61 68 0.00% 62 55 0.00% 63 65 0.00% 64 69 0.00% 65 83 0.00% 66 97 0.00% 67 116 0.00% 68 141 0.00% 69 173 0.00% 70 177 0.00% 71 189 0.00% 72 240 0.00% 73 257 0.00% 74 307 0.00% 75 345 0.00% 76 426 0.00% 77 537 0.00% 78 553 0.00% 79 641 0.00% 80 700 0.01% 81 789 0.01% 82 943 0.01% 83 1054 0.01% 84 1635 0.01% 85 2162 0.02% 86 2265 0.02% 87 2800 0.02% 88 2843 0.02% 89 3103 0.02% 90 3183 0.02% 91 3418 0.02% 92 3748 0.03% 93 3994 0.03% 94 4155 0.03% 95 4595 0.03% 96 5159 0.04% 97 5336 0.04% 98 5837 0.04% 99 6167 0.05% 100 6760 0.05% 101 7344 0.05% 102 7907 0.06% 103 8264 0.06% 104 8860 0.06% 105 9549 0.07% 106 10322 0.08% 107 10930 0.08% 108 11305 0.08% 109 11940 0.09% 110 13030 0.10% 111 13917 0.10% 112 14479 0.11% 113 15639 0.11% 114 16420 0.12% 115 17458 0.13% 116 18058 0.13% 117 19067 0.14% 118 20049 0.15% 119 20862 0.15% 120 21929 0.16% 121 22688 0.17% 122 23634 0.17% 123 24897 0.18% 124 25688 0.19% 125 26641 0.19% 126 28311 0.21% 127 29680 0.22% 128 30318 0.22% 129 32239 0.24% 130 33533 0.24% 131 34590 0.25% 132 36500 0.27% 133 38294 0.28% 134 39970 0.29% 135 42610 0.31% 136 44252 0.32% 137 46957 0.34% 138 49372 0.36% 139 52793 0.39% 140 56787 0.41% 141 60619 0.44% 142 66544 0.49% 143 72674 0.53% 144 83241 0.61% 145 96738 0.71% 146 117537 0.86% 147 156090 1.14% 148 236923 1.73% 149 468990 3.42% 150 2926646 21.36% 151 8343926 60.89% 13702577 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=29 prefix-density=0.24 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=22.26 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.6 sequence=CACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTAGCAGTAGGCTGTGGGCCAAAATCCTTGACAAAATTATTCTTTTCATTGGACTCGGTTGTGTGGCAATCGGCTTTCTCATTGGAGACTGATGACAATGTGGT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=278.17 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.7 sequence=AGAAGAAGAGAGG SRR7172701 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:09:44 Started mapping on | Feb 10 14:09:44 Finished on | Feb 10 14:12:10 Mapping speed, Million of reads per hour | 337.87 Number of input reads | 13702577 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12735306 Uniquely mapped reads % | 92.94% Average mapped length | 296.08 Number of splices: Total | 13179028 Number of splices: Annotated (sjdb) | 12949800 Number of splices: GT/AG | 12971059 Number of splices: GC/AG | 169960 Number of splices: AT/AC | 9329 Number of splices: Non-canonical | 28680 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332561 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 29934 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 643903 643903 643903 N_multimapping 332561 332561 332561 N_noFeature 315988 12627014 366323 N_ambiguous 122897 610 64572 UnstrandedReadsAssigned:12296421 PositiveStrandReadsAssigned:107682 NegativeStrandReadsAssigned:12304411 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172701 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172701-trimmed-pair1.fastq SRR7172701-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,702,577 reads, 12,230,105 reads pseudoaligned [quant] estimated average fragment length: 241.877 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7172701.ke.tsv 34699 SRR7172701.se.tsv 87100 total ==> SRR7172701.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.12 989 45.6912 Potri.005G024800.1.v4.1 1035 794.123 159 16.4385 Potri.004G059700.1.v4.1 961 720.15 17 1.93812 Potri.007G009000.2.v4.1 1416 1175.12 0 0 Potri.003G141000.2.v4.1 2943 2702.12 435.145 13.2215 Potri.016G087400.1.v4.1 270 77.78 819 864.509 Potri.015G069301.1.v4.1 564 327.153 0 0 Potri.010G195200.1.v4.1 1773 1532.12 288.689 15.47 Potri.012G127500.1.v4.1 977 736.139 3429 382.438 ==> SRR7172701.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 371 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 221 SRR7172701 completed mapping pipeline successfully