Starting /dee2/code/volunteer_pipeline.sh SRR7172702 current disk space = 3058925142016 free memory = 1262814900 SRR7172702 SRAfilesize 91ceff7bceea715c7a130ef3513da1e4 SRR7172702.sra SRR7172702.sra file validated SRR7172702 is paired end SRR7172702 is conventional basespace SRR7172702 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172702_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31875 33.0 33.0 34.0 32.0 34.0 2 32.65725 33.0 33.0 34.0 32.0 34.0 3 32.92325 33.0 33.0 34.0 32.0 34.0 4 32.97425 34.0 33.0 34.0 31.0 34.0 5 33.043 34.0 33.0 34.0 32.0 34.0 6 37.23725 38.0 38.0 38.0 36.0 38.0 7 37.5325 38.0 38.0 38.0 37.0 38.0 8 37.59575 38.0 38.0 38.0 38.0 38.0 9 37.57625 38.0 38.0 38.0 38.0 38.0 10-14 37.61245 38.0 38.0 38.0 38.0 38.0 15-19 37.6348 38.0 38.0 38.0 38.0 38.0 20-24 37.56715 38.0 38.0 38.0 38.0 38.0 25-29 37.5817 38.0 38.0 38.0 38.0 38.0 30-34 37.605 38.0 38.0 38.0 38.0 38.0 35-39 37.5435 38.0 38.0 38.0 38.0 38.0 40-44 37.47645 38.0 38.0 38.0 38.0 38.0 45-49 37.5222 38.0 38.0 38.0 38.0 38.0 50-54 37.40755 38.0 38.0 38.0 37.2 38.0 55-59 37.29055 38.0 38.0 38.0 37.0 38.0 60-64 37.3053 38.0 38.0 38.0 37.0 38.0 65-69 37.2372 38.0 38.0 38.0 36.8 38.0 70-74 37.1089 38.0 38.0 38.0 36.4 38.0 75-79 37.03359999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.99445 38.0 38.0 38.0 36.0 38.0 85-89 36.7429 38.0 38.0 38.0 35.4 38.0 90-94 36.8312 38.0 38.0 38.0 35.2 38.0 95-99 36.8254 38.0 38.0 38.0 35.4 38.0 100-104 36.6569 38.0 38.0 38.0 34.6 38.0 105-109 36.35775 38.0 38.0 38.0 33.6 38.0 110-114 36.187549999999995 38.0 37.8 38.0 33.0 38.0 115-119 36.144 38.0 37.6 38.0 33.2 38.0 120-124 36.3707 38.0 38.0 38.0 34.0 38.0 125-129 36.06345 38.0 37.2 38.0 33.4 38.0 130-134 35.5721 38.0 36.2 38.0 31.0 38.0 135-139 35.2864 38.0 36.0 38.0 29.4 38.0 140-144 35.31185 38.0 36.0 38.0 30.0 38.0 145-149 35.082899999999995 38.0 36.0 38.0 30.4 38.0 150-151 31.58175 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 1.0 17 1.0 18 3.0 19 0.0 20 2.0 21 2.0 22 2.0 23 5.0 24 10.0 25 8.0 26 11.0 27 12.0 28 26.0 29 23.0 30 34.0 31 45.0 32 72.0 33 102.0 34 133.0 35 220.0 36 521.0 37 2763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.998986572080064 13.453255637192804 13.782619711173044 40.76513807955409 2 19.763640935378426 20.69399044505909 38.09404073422177 21.44832788534071 3 18.75 26.5 26.55 28.199999999999996 4 20.599999999999998 35.55 22.475 21.375 5 20.974999999999998 35.425000000000004 24.925 18.675 6 17.525 36.075 25.674999999999997 20.724999999999998 7 12.2 22.25 45.625 19.925 8 18.45 21.099999999999998 31.95 28.499999999999996 9 19.55 21.6 31.900000000000002 26.950000000000003 10-14 19.93 29.330000000000002 27.24 23.5 15-19 19.564999999999998 28.439999999999998 28.255000000000003 23.74 20-24 19.72 28.299999999999997 27.834999999999997 24.145 25-29 19.865 28.535 27.765 23.835 30-34 19.445 28.605000000000004 28.110000000000003 23.84 35-39 19.919999999999998 28.08 28.4 23.599999999999998 40-44 20.155 28.634999999999998 27.87 23.34 45-49 19.7 28.865000000000002 27.689999999999998 23.745 50-54 19.685 28.42 27.99 23.905 55-59 19.61 28.360000000000003 28.285 23.745 60-64 19.66 28.499999999999996 27.97 23.87 65-69 20.185 28.694999999999997 27.589999999999996 23.53 70-74 20.125 28.54 27.765 23.57 75-79 20.26 27.994999999999997 28.08 23.665 80-84 20.49 28.349999999999998 27.875 23.285 85-89 20.435 28.599999999999998 27.575 23.39 90-94 20.165 27.544999999999998 28.134999999999998 24.154999999999998 95-99 20.49 28.27 28.044999999999998 23.195 100-104 20.075000000000003 28.18 28.37 23.375 105-109 20.535 28.055000000000003 28.27 23.14 110-114 20.495247623811906 28.954477238619308 27.318659329664836 23.231615807903953 115-119 20.235 27.67 27.91 24.185000000000002 120-124 20.080000000000002 28.435 27.295 24.19 125-129 21.145 28.055000000000003 27.675 23.125 130-134 20.315 28.715000000000003 27.095000000000002 23.875 135-139 20.380000000000003 28.410000000000004 27.500000000000004 23.71 140-144 20.365 27.975 27.815 23.845 145-149 20.34 28.299999999999997 27.55 23.810000000000002 150-151 21.2 28.375 26.6125 23.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 5.0 28 6.5 29 11.0 30 17.0 31 24.0 32 33.0 33 41.5 34 56.5 35 70.5 36 91.0 37 109.0 38 133.5 39 180.5 40 218.0 41 249.0 42 267.0 43 272.0 44 285.0 45 283.0 46 263.5 47 238.5 48 222.5 49 201.5 50 166.0 51 133.5 52 104.0 53 79.0 54 59.0 55 47.0 56 33.5 57 23.0 58 21.5 59 14.0 60 5.0 61 4.0 62 6.5 63 5.0 64 2.0 65 4.0 66 2.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6499999999999999 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.6 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172702 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172702_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1075 34.0 33.0 34.0 33.0 34.0 2 33.2415 34.0 33.0 34.0 33.0 34.0 3 33.23925 34.0 33.0 34.0 33.0 34.0 4 33.19175 34.0 33.0 34.0 33.0 34.0 5 33.197 34.0 33.0 34.0 33.0 34.0 6 37.28825 38.0 38.0 38.0 38.0 38.0 7 37.31575 38.0 38.0 38.0 38.0 38.0 8 37.2535 38.0 38.0 38.0 38.0 38.0 9 37.1765 38.0 38.0 38.0 37.0 38.0 10-14 37.24615 38.0 38.0 38.0 38.0 38.0 15-19 37.2668 38.0 38.0 38.0 38.0 38.0 20-24 37.2611 38.0 38.0 38.0 37.6 38.0 25-29 37.035450000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.58819999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.69955 38.0 38.0 38.0 36.0 38.0 40-44 37.14495 38.0 38.0 38.0 37.0 38.0 45-49 37.09875 38.0 38.0 38.0 37.0 38.0 50-54 37.0784 38.0 38.0 38.0 37.0 38.0 55-59 36.976600000000005 38.0 38.0 38.0 36.4 38.0 60-64 36.8779 38.0 38.0 38.0 36.0 38.0 65-69 36.808949999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.76595 38.0 38.0 38.0 36.0 38.0 75-79 36.67665 38.0 38.0 38.0 35.6 38.0 80-84 36.7504 38.0 38.0 38.0 36.0 38.0 85-89 36.689800000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.554249999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.43384999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.4414 38.0 38.0 38.0 34.6 38.0 105-109 36.39215 38.0 38.0 38.0 34.2 38.0 110-114 36.196600000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.9294 38.0 38.0 38.0 33.0 38.0 120-124 35.64635 38.0 37.4 38.0 31.8 38.0 125-129 35.43325 38.0 36.8 38.0 30.4 38.0 130-134 35.172200000000004 38.0 36.0 38.0 28.8 38.0 135-139 34.9484 38.0 36.0 38.0 28.0 38.0 140-144 34.5197 38.0 35.8 38.0 27.0 38.0 145-149 33.68135 38.0 33.2 38.0 21.2 38.0 150-151 29.35575 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 2.0 6 0.0 7 0.0 8 2.0 9 4.0 10 5.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 5.0 18 4.0 19 9.0 20 5.0 21 4.0 22 6.0 23 4.0 24 15.0 25 17.0 26 11.0 27 22.0 28 27.0 29 23.0 30 48.0 31 56.0 32 56.0 33 90.0 34 158.0 35 233.0 36 509.0 37 2664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.125 14.95 18.075 32.85 2 23.0 23.3 37.075 16.625 3 20.724999999999998 25.424999999999997 32.275 21.575 4 23.375 35.375 21.475 19.775000000000002 5 24.474999999999998 37.025000000000006 21.125 17.375 6 17.625 38.625 22.875 20.875 7 17.175 16.150000000000002 44.4 22.275 8 20.9 22.225 27.425 29.45 9 22.375 23.599999999999998 28.925 25.1 10-14 22.455 29.39 26.71 21.445 15-19 22.85 28.025 27.529999999999998 21.595 20-24 22.67 28.470000000000002 27.794999999999998 21.065 25-29 23.071127185051235 28.501105083383564 27.647177014265623 20.780590717299578 30-34 23.39267548321465 28.245167853509663 27.670396744659207 20.69175991861648 35-39 23.077310754964216 28.469912307227098 27.487148472936195 20.965628464872495 40-44 23.14 28.13 28.165000000000003 20.565 45-49 23.52 27.51 28.28 20.69 50-54 22.81 28.62 27.694999999999997 20.875 55-59 23.285 28.285 27.894999999999996 20.535 60-64 23.485 27.779999999999998 28.115000000000002 20.62 65-69 23.305 28.67 27.79 20.235 70-74 23.205000000000002 27.67 28.365000000000002 20.76 75-79 23.419999999999998 28.244999999999997 28.494999999999997 19.84 80-84 23.674999999999997 28.08 27.779999999999998 20.465 85-89 23.525 28.285 28.04 20.150000000000002 90-94 24.005000000000003 27.860000000000003 27.500000000000004 20.635 95-99 23.265 28.660000000000004 27.48 20.595 100-104 23.555 28.23 27.33 20.885 105-109 24.11 28.625 27.87 19.395 110-114 23.330000000000002 28.235 27.92 20.515 115-119 23.905 28.560000000000002 27.389999999999997 20.145 120-124 23.935000000000002 28.4 27.644999999999996 20.02 125-129 24.11 27.71 27.715 20.465 130-134 23.985 28.08 28.110000000000003 19.825 135-139 24.695 27.755000000000003 27.500000000000004 20.05 140-144 24.645 28.810000000000002 26.900000000000002 19.645000000000003 145-149 24.87 28.625 26.82 19.685 150-151 26.200000000000003 27.675 26.6 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.0 24 1.5 25 0.5 26 4.0 27 6.0 28 6.5 29 7.5 30 10.0 31 18.5 32 23.5 33 30.0 34 43.0 35 54.0 36 76.5 37 107.0 38 139.5 39 183.5 40 215.0 41 250.5 42 271.0 43 290.0 44 320.5 45 300.0 46 267.0 47 249.0 48 219.5 49 192.5 50 152.5 51 110.5 52 97.0 53 86.0 54 63.0 55 49.0 56 38.5 57 26.5 58 22.5 59 17.5 60 13.5 61 10.0 62 7.0 63 3.5 64 3.0 65 3.5 66 2.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.45999999999999996 30-34 1.7000000000000002 35-39 0.79 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.15 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.775 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138-139 4.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAAAT 10 0.006875036 144.6875 7 >>END_MODULE Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642768 spots for SRR7172702.sra Written 642768 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra Read 642766 spots for SRR7172702.sra Written 642766 spots for SRR7172702.sra SRR ids: ['SRR7172702.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2s0p1c39 SRR7172702.sra spots: 12855322 blocks: [[1, 642766], [642767, 1285532], [1285533, 1928298], [1928299, 2571064], [2571065, 3213830], [3213831, 3856596], [3856597, 4499362], [4499363, 5142128], [5142129, 5784894], [5784895, 6427660], [6427661, 7070426], [7070427, 7713192], [7713193, 8355958], [8355959, 8998724], [8998725, 9641490], [9641491, 10284256], [10284257, 10927022], [10927023, 11569788], [11569789, 12212554], [12212555, 12855322]] SRR7172702 file size 4334546 SRR7172702 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172702 SRR7172702_1.fastq SRR7172702_2.fastq Input file: SRR7172702_1.fastq Paired file: SRR7172702_2.fastq trimmed: SRR7172702-trimmed-pair1.fastq, SRR7172702-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:20:23 2025 >> started Mon Feb 10 14:20:37 2025 >> done (13.766s) 12855322 read pairs processed; of these: 8863 ( 0.07%) short read pairs filtered out after trimming by size control 6871 ( 0.05%) empty read pairs filtered out after trimming by size control 12839588 (99.88%) read pairs available; of these: 6200828 (48.29%) trimmed read pairs available after processing 6638760 (51.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 2 0.00% 30 6 0.00% 31 1 0.00% 32 0 0.00% 33 5 0.00% 34 2 0.00% 35 3 0.00% 36 0 0.00% 37 1 0.00% 38 4 0.00% 39 1 0.00% 40 4 0.00% 41 4 0.00% 42 2 0.00% 43 5 0.00% 44 4 0.00% 45 6 0.00% 46 3 0.00% 47 1 0.00% 48 4 0.00% 49 15 0.00% 50 5 0.00% 51 17 0.00% 52 14 0.00% 53 15 0.00% 54 21 0.00% 55 20 0.00% 56 26 0.00% 57 23 0.00% 58 30 0.00% 59 43 0.00% 60 43 0.00% 61 34 0.00% 62 53 0.00% 63 85 0.00% 64 71 0.00% 65 83 0.00% 66 86 0.00% 67 89 0.00% 68 115 0.00% 69 119 0.00% 70 148 0.00% 71 198 0.00% 72 205 0.00% 73 212 0.00% 74 283 0.00% 75 310 0.00% 76 370 0.00% 77 413 0.00% 78 447 0.00% 79 457 0.00% 80 609 0.00% 81 636 0.00% 82 756 0.01% 83 915 0.01% 84 1450 0.01% 85 1847 0.01% 86 2032 0.02% 87 2099 0.02% 88 2244 0.02% 89 2386 0.02% 90 2705 0.02% 91 2674 0.02% 92 2985 0.02% 93 3347 0.03% 94 3649 0.03% 95 3877 0.03% 96 4261 0.03% 97 4609 0.04% 98 4876 0.04% 99 5245 0.04% 100 5586 0.04% 101 6173 0.05% 102 6545 0.05% 103 7054 0.05% 104 7661 0.06% 105 8021 0.06% 106 8706 0.07% 107 9080 0.07% 108 9705 0.08% 109 10383 0.08% 110 10985 0.09% 111 11740 0.09% 112 12696 0.10% 113 13353 0.10% 114 13985 0.11% 115 14874 0.12% 116 15450 0.12% 117 16258 0.13% 118 17333 0.13% 119 17749 0.14% 120 18626 0.15% 121 19913 0.16% 122 20590 0.16% 123 21928 0.17% 124 22961 0.18% 125 24357 0.19% 126 25155 0.20% 127 26984 0.21% 128 27837 0.22% 129 28972 0.23% 130 30257 0.24% 131 32029 0.25% 132 33910 0.26% 133 35648 0.28% 134 37914 0.30% 135 39840 0.31% 136 42183 0.33% 137 45251 0.35% 138 48505 0.38% 139 51422 0.40% 140 55950 0.44% 141 61211 0.48% 142 67275 0.52% 143 75044 0.58% 144 86094 0.67% 145 102900 0.80% 146 127714 0.99% 147 171108 1.33% 148 269606 2.10% 149 639333 4.98% 150 3629655 28.27% 151 6638760 51.71% 12839588 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=18 prefix-density=0.26 prefix-fanout=4.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=49.98 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=13.0 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=123.96 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.8 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATCT SRR7172702 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:21:24 Started mapping on | Feb 10 14:21:24 Finished on | Feb 10 14:23:06 Mapping speed, Million of reads per hour | 453.16 Number of input reads | 12839588 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12071633 Uniquely mapped reads % | 94.02% Average mapped length | 296.02 Number of splices: Total | 12401823 Number of splices: Annotated (sjdb) | 12186916 Number of splices: GT/AG | 12206585 Number of splices: GC/AG | 157673 Number of splices: AT/AC | 9356 Number of splices: Non-canonical | 28209 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305313 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 37945 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471473 471473 471473 N_multimapping 305313 305313 305313 N_noFeature 290719 11968720 335888 N_ambiguous 114305 569 56242 UnstrandedReadsAssigned:11666609 PositiveStrandReadsAssigned:102344 NegativeStrandReadsAssigned:11679503 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172702 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172702-trimmed-pair1.fastq SRR7172702-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,839,588 reads, 11,605,393 reads pseudoaligned [quant] estimated average fragment length: 245.271 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7172702.ke.tsv 34699 SRR7172702.se.tsv 87100 total ==> SRR7172702.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.73 973 48.2263 Potri.005G024800.1.v4.1 1035 790.729 133 14.7871 Potri.004G059700.1.v4.1 961 716.765 27 3.31166 Potri.007G009000.2.v4.1 1416 1171.73 0 0 Potri.003G141000.2.v4.1 2943 2698.73 420 13.682 Potri.016G087400.1.v4.1 270 76.6467 921 1056.39 Potri.015G069301.1.v4.1 564 323.932 0 0 Potri.010G195200.1.v4.1 1773 1528.73 223 12.8243 Potri.012G127500.1.v4.1 977 732.754 2527 303.183 ==> SRR7172702.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 134 SRR7172702 completed mapping pipeline successfully