Starting /dee2/code/volunteer_pipeline.sh SRR7172703 current disk space = 3058998099968 free memory = 1158479548 SRR7172703 SRAfilesize f4dd93f35683f5d82cc7cfa1c834875d SRR7172703.sra SRR7172703.sra file validated SRR7172703 is paired end SRR7172703 is conventional basespace SRR7172703 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172703_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.429 25.0 18.0 32.0 18.0 33.0 2 27.76075 29.0 25.0 31.0 18.0 33.0 3 29.89775 31.0 29.0 33.0 25.0 33.0 4 31.19425 33.0 31.0 33.0 29.0 33.0 5 32.1305 33.0 33.0 33.0 29.0 34.0 6 37.07525 38.0 37.0 38.0 36.0 38.0 7 37.4455 38.0 38.0 38.0 37.0 38.0 8 37.52475 38.0 38.0 38.0 37.0 38.0 9 37.618 38.0 38.0 38.0 38.0 38.0 10-14 37.61565 38.0 38.0 38.0 38.0 38.0 15-19 37.5658 38.0 38.0 38.0 38.0 38.0 20-24 37.5452 38.0 38.0 38.0 38.0 38.0 25-29 37.518 38.0 38.0 38.0 38.0 38.0 30-34 37.46555 38.0 38.0 38.0 37.8 38.0 35-39 37.44445 38.0 38.0 38.0 37.8 38.0 40-44 37.33305 38.0 38.0 38.0 37.0 38.0 45-49 37.230599999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.2935 38.0 38.0 38.0 37.0 38.0 55-59 37.214999999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.14265 38.0 38.0 38.0 36.8 38.0 65-69 37.0607 38.0 38.0 38.0 36.2 38.0 70-74 37.09025 38.0 38.0 38.0 36.0 38.0 75-79 36.94855 38.0 38.0 38.0 36.0 38.0 80-84 36.88195 38.0 38.0 38.0 35.8 38.0 85-89 36.6255 38.0 38.0 38.0 34.8 38.0 90-94 36.71005 38.0 38.0 38.0 34.8 38.0 95-99 36.6643 38.0 38.0 38.0 34.8 38.0 100-104 36.64885 38.0 38.0 38.0 35.0 38.0 105-109 36.30375 38.0 38.0 38.0 34.0 38.0 110-114 36.14125 38.0 38.0 38.0 33.6 38.0 115-119 36.115300000000005 38.0 37.8 38.0 33.4 38.0 120-124 36.00005 38.0 37.4 38.0 33.0 38.0 125-129 35.701350000000005 38.0 36.4 38.0 31.8 38.0 130-134 35.282849999999996 38.0 36.0 38.0 29.6 38.0 135-139 35.008799999999994 38.0 35.8 38.0 28.2 38.0 140-144 34.7308 38.0 35.0 38.0 27.6 38.0 145-149 34.3784 38.0 34.6 38.0 27.6 38.0 150-151 30.718375 35.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 3.0 18 2.0 19 4.0 20 2.0 21 5.0 22 5.0 23 8.0 24 10.0 25 12.0 26 10.0 27 18.0 28 33.0 29 26.0 30 43.0 31 38.0 32 62.0 33 102.0 34 132.0 35 273.0 36 715.0 37 2486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.278772378516624 15.65217391304348 13.503836317135551 39.565217391304344 2 19.191158000502387 18.638533031901535 38.03064556644059 24.139663401155488 3 21.325 23.724999999999998 26.3 28.65 4 22.35 31.7 22.25 23.7 5 22.425 31.45 26.775 19.35 6 18.275 34.575 27.575 19.575 7 13.725000000000001 23.575 44.25 18.45 8 17.7 24.2 31.874999999999996 26.224999999999998 9 19.075 23.7 31.724999999999998 25.5 10-14 19.11 30.095 27.825 22.97 15-19 19.16 29.095 28.384999999999998 23.36 20-24 19.305 29.270000000000003 28.544999999999998 22.88 25-29 19.49 29.175 28.03 23.305 30-34 19.525000000000002 28.565 28.595 23.315 35-39 20.27 28.199999999999996 28.24 23.29 40-44 19.634999999999998 29.04 27.775 23.549999999999997 45-49 19.650000000000002 29.020000000000003 28.189999999999998 23.14 50-54 19.37 29.025000000000002 27.77 23.835 55-59 19.82 29.049999999999997 27.855 23.275000000000002 60-64 19.67 29.2 27.99 23.14 65-69 19.525000000000002 27.925 28.910000000000004 23.64 70-74 19.755 28.655 28.115000000000002 23.474999999999998 75-79 19.935 28.689999999999998 27.905 23.47 80-84 20.21 28.050000000000004 28.04 23.7 85-89 19.830000000000002 28.549999999999997 27.689999999999998 23.93 90-94 19.950000000000003 28.53 27.975 23.544999999999998 95-99 19.3 28.634999999999998 28.32 23.745 100-104 19.564999999999998 28.299999999999997 28.389999999999997 23.745 105-109 20.07 28.299999999999997 27.705000000000002 23.925 110-114 20.150000000000002 27.77 28.415000000000003 23.665 115-119 20.43 28.515 27.650000000000002 23.405 120-124 20.66 27.93 27.700000000000003 23.71 125-129 20.59 28.425 27.665 23.32 130-134 20.745 28.610000000000003 27.534999999999997 23.11 135-139 20.25 28.53 27.935 23.285 140-144 21.099999999999998 27.994999999999997 27.400000000000002 23.505000000000003 145-149 20.775 28.994999999999997 26.99 23.24 150-151 20.05 28.1875 27.1625 24.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 1.0 17 1.5 18 1.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 3.0 26 6.0 27 6.0 28 6.5 29 12.5 30 25.5 31 41.0 32 47.5 33 58.0 34 77.5 35 104.0 36 121.5 37 125.5 38 142.0 39 180.0 40 196.0 41 215.0 42 251.0 43 269.0 44 272.0 45 257.0 46 240.0 47 227.5 48 213.5 49 190.5 50 152.5 51 118.5 52 105.5 53 81.5 54 56.0 55 42.0 56 36.5 57 29.5 58 18.0 59 14.0 60 10.5 61 6.5 62 6.5 63 6.0 64 3.0 65 2.5 66 1.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7319535588086825 1.4500000000000002 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172703 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172703_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.056 34.0 33.0 34.0 32.0 34.0 2 33.0865 34.0 33.0 34.0 32.0 34.0 3 33.168 34.0 33.0 34.0 33.0 34.0 4 33.0995 34.0 33.0 34.0 33.0 34.0 5 33.0685 34.0 33.0 34.0 33.0 34.0 6 37.19925 38.0 38.0 38.0 37.0 38.0 7 37.1365 38.0 38.0 38.0 37.0 38.0 8 37.16925 38.0 38.0 38.0 37.0 38.0 9 37.15875 38.0 38.0 38.0 37.0 38.0 10-14 37.1003 38.0 38.0 38.0 37.0 38.0 15-19 37.11465 38.0 38.0 38.0 37.0 38.0 20-24 37.08305 38.0 38.0 38.0 37.0 38.0 25-29 36.8643 38.0 38.0 38.0 37.0 38.0 30-34 36.31195 38.0 38.0 38.0 36.2 38.0 35-39 36.57585 38.0 38.0 38.0 36.0 38.0 40-44 36.9499 38.0 38.0 38.0 36.8 38.0 45-49 36.8917 38.0 38.0 38.0 36.8 38.0 50-54 36.8642 38.0 38.0 38.0 36.8 38.0 55-59 36.80515 38.0 38.0 38.0 36.4 38.0 60-64 36.709500000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.50789999999999 38.0 38.0 38.0 35.0 38.0 70-74 36.62215 38.0 38.0 38.0 35.6 38.0 75-79 36.615849999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.53255 38.0 38.0 38.0 35.0 38.0 85-89 36.456649999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.357499999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.21139999999999 38.0 38.0 38.0 33.8 38.0 100-104 36.1091 38.0 38.0 38.0 33.8 38.0 105-109 35.931349999999995 38.0 38.0 38.0 33.2 38.0 110-114 35.65814999999999 38.0 37.4 38.0 31.8 38.0 115-119 35.3558 38.0 37.0 38.0 29.8 38.0 120-124 35.10725 38.0 36.0 38.0 28.4 38.0 125-129 34.981700000000004 38.0 36.2 38.0 28.0 38.0 130-134 34.6188 38.0 36.0 38.0 26.6 38.0 135-139 33.9625 38.0 33.8 38.0 23.0 38.0 140-144 33.36075 38.0 33.0 38.0 20.6 38.0 145-149 32.158150000000006 38.0 33.0 38.0 10.8 38.0 150-151 26.920749999999998 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 9.0 4 4.0 5 4.0 6 3.0 7 1.0 8 4.0 9 1.0 10 3.0 11 1.0 12 2.0 13 4.0 14 4.0 15 1.0 16 5.0 17 2.0 18 2.0 19 4.0 20 5.0 21 6.0 22 4.0 23 7.0 24 13.0 25 17.0 26 26.0 27 23.0 28 31.0 29 48.0 30 60.0 31 55.0 32 71.0 33 103.0 34 202.0 35 286.0 36 532.0 37 2446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.475 14.075 19.15 31.3 2 21.65 24.15 36.5 17.7 3 21.8 26.650000000000002 30.599999999999998 20.95 4 25.95 33.650000000000006 22.025 18.375 5 23.35 35.225 23.799999999999997 17.625 6 19.55 37.724999999999994 25.0 17.724999999999998 7 18.775 18.175 40.875 22.175 8 20.925 23.65 28.675 26.75 9 23.7 24.85 28.025 23.425 10-14 23.115 29.060000000000002 26.755000000000003 21.07 15-19 22.3 28.785 27.775 21.14 20-24 23.14 29.13 27.445000000000004 20.285 25-29 22.849246231155778 28.537688442211056 27.542713567839193 21.07035175879397 30-34 23.04203821656051 28.723566878980893 27.60764331210191 20.626751592356687 35-39 22.856566471656244 29.22130320758523 27.551946741981038 20.370183578777485 40-44 23.064999999999998 28.439999999999998 27.77 20.724999999999998 45-49 22.93 28.335 27.625 21.11 50-54 22.955000000000002 28.904999999999998 27.450000000000003 20.69 55-59 23.025000000000002 28.875 28.24 19.86 60-64 23.78 28.060000000000002 27.839999999999996 20.32 65-69 22.900000000000002 28.804999999999996 27.775 20.52 70-74 23.995 28.410000000000004 27.26 20.335 75-79 23.05 28.65 27.615000000000002 20.685000000000002 80-84 23.815 27.91 28.244999999999997 20.03 85-89 23.51 28.485 27.905 20.1 90-94 23.705000000000002 27.935 28.03 20.330000000000002 95-99 23.865 28.694999999999997 27.939999999999998 19.5 100-104 24.18 28.62 27.68 19.52 105-109 23.515 28.384999999999998 27.650000000000002 20.45 110-114 23.835 28.28 27.87 20.015 115-119 23.77 28.470000000000002 27.889999999999997 19.869999999999997 120-124 24.215 28.305000000000003 27.589999999999996 19.89 125-129 23.79 28.49 27.705000000000002 20.015 130-134 24.104999999999997 28.52 28.01 19.365 135-139 24.37 28.249999999999996 28.025 19.355 140-144 24.345 28.475 27.79 19.39 145-149 25.230000000000004 28.375 26.76 19.634999999999998 150-151 25.4 27.712500000000002 27.287499999999998 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 3.0 26 2.0 27 3.5 28 6.5 29 8.5 30 17.0 31 26.5 32 26.0 33 26.0 34 41.0 35 64.0 36 89.5 37 112.0 38 153.5 39 189.5 40 218.5 41 250.5 42 274.0 43 297.5 44 285.0 45 281.0 46 270.5 47 255.0 48 230.5 49 183.5 50 159.5 51 126.5 52 94.5 53 68.0 54 52.0 55 44.0 56 33.0 57 25.5 58 17.5 59 12.5 60 10.5 61 8.5 62 6.0 63 4.5 64 2.5 65 3.0 66 3.5 67 1.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.5 30-34 1.875 35-39 0.86 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85844748858447 97.425 2 0.91324200913242 1.7999999999999998 3 0.17757483510908167 0.525 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.025367833587011668 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.2249999999999996 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.237500000000001 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTG 10 0.0068573058 144.8125 4 >>END_MODULE Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645661 spots for SRR7172703.sra Written 645661 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra Read 645657 spots for SRR7172703.sra Written 645657 spots for SRR7172703.sra SRR ids: ['SRR7172703.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kj2ukvh7 SRR7172703.sra spots: 12913144 blocks: [[1, 645657], [645658, 1291314], [1291315, 1936971], [1936972, 2582628], [2582629, 3228285], [3228286, 3873942], [3873943, 4519599], [4519600, 5165256], [5165257, 5810913], [5810914, 6456570], [6456571, 7102227], [7102228, 7747884], [7747885, 8393541], [8393542, 9039198], [9039199, 9684855], [9684856, 10330512], [10330513, 10976169], [10976170, 11621826], [11621827, 12267483], [12267484, 12913144]] SRR7172703 file size 4354140 SRR7172703 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172703 SRR7172703_1.fastq SRR7172703_2.fastq Input file: SRR7172703_1.fastq Paired file: SRR7172703_2.fastq trimmed: SRR7172703-trimmed-pair1.fastq, SRR7172703-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:07:20 2025 >> started Mon Feb 10 14:07:42 2025 >> done (22.746s) 12913144 read pairs processed; of these: 25167 ( 0.19%) short read pairs filtered out after trimming by size control 19736 ( 0.15%) empty read pairs filtered out after trimming by size control 12868241 (99.65%) read pairs available; of these: 5998717 (46.62%) trimmed read pairs available after processing 6869524 (53.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 12 0.00% 22 11 0.00% 23 7 0.00% 24 9 0.00% 25 11 0.00% 26 6 0.00% 27 6 0.00% 28 9 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 6 0.00% 33 4 0.00% 34 4 0.00% 35 3 0.00% 36 5 0.00% 37 10 0.00% 38 2 0.00% 39 4 0.00% 40 7 0.00% 41 5 0.00% 42 5 0.00% 43 8 0.00% 44 11 0.00% 45 8 0.00% 46 10 0.00% 47 12 0.00% 48 19 0.00% 49 17 0.00% 50 24 0.00% 51 20 0.00% 52 27 0.00% 53 38 0.00% 54 39 0.00% 55 34 0.00% 56 46 0.00% 57 46 0.00% 58 62 0.00% 59 63 0.00% 60 65 0.00% 61 76 0.00% 62 70 0.00% 63 89 0.00% 64 101 0.00% 65 114 0.00% 66 123 0.00% 67 130 0.00% 68 181 0.00% 69 217 0.00% 70 223 0.00% 71 253 0.00% 72 312 0.00% 73 364 0.00% 74 419 0.00% 75 441 0.00% 76 632 0.00% 77 663 0.01% 78 604 0.00% 79 753 0.01% 80 916 0.01% 81 1035 0.01% 82 1252 0.01% 83 1496 0.01% 84 2967 0.02% 85 4145 0.03% 86 4488 0.03% 87 5242 0.04% 88 5252 0.04% 89 4951 0.04% 90 5080 0.04% 91 5193 0.04% 92 5380 0.04% 93 5442 0.04% 94 5815 0.05% 95 6279 0.05% 96 6335 0.05% 97 6960 0.05% 98 7471 0.06% 99 8103 0.06% 100 8579 0.07% 101 9154 0.07% 102 9826 0.08% 103 10613 0.08% 104 11511 0.09% 105 12293 0.10% 106 13116 0.10% 107 13890 0.11% 108 14804 0.12% 109 15816 0.12% 110 16480 0.13% 111 17681 0.14% 112 18802 0.15% 113 20167 0.16% 114 21945 0.17% 115 23000 0.18% 116 23800 0.18% 117 24277 0.19% 118 25110 0.20% 119 26205 0.20% 120 27311 0.21% 121 28469 0.22% 122 29454 0.23% 123 30870 0.24% 124 32556 0.25% 125 33671 0.26% 126 35441 0.28% 127 36987 0.29% 128 38130 0.30% 129 39514 0.31% 130 41286 0.32% 131 42916 0.33% 132 45426 0.35% 133 47662 0.37% 134 49979 0.39% 135 51897 0.40% 136 54982 0.43% 137 57709 0.45% 138 60895 0.47% 139 65262 0.51% 140 69786 0.54% 141 74872 0.58% 142 82425 0.64% 143 90834 0.71% 144 103396 0.80% 145 119129 0.93% 146 143990 1.12% 147 189757 1.47% 148 278682 2.17% 149 540416 4.20% 150 3017690 23.45% 151 6869524 53.38% 12868241 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.1 sequence=AGGAAACCTCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=28.23 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.57 fanout-score-rank=16 prefix-density=0.49 prefix-fanout=3.7 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=22.88 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=8.6 sequence=GAGGTTGAGTACAGGTGCTTTGTTGGTGGCCTCGCATGGGCCACTACTGACCAATCCCTTCAAGAAGCGTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAACGATCGTGAAACTGGAAGATCTCGCGGCTTTGGATTTGTTAC SRR7172703 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:08:52 Started mapping on | Feb 10 14:08:55 Finished on | Feb 10 14:11:35 Mapping speed, Million of reads per hour | 289.54 Number of input reads | 12868241 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11553521 Uniquely mapped reads % | 89.78% Average mapped length | 294.19 Number of splices: Total | 10830542 Number of splices: Annotated (sjdb) | 10568201 Number of splices: GT/AG | 10646779 Number of splices: GC/AG | 137863 Number of splices: AT/AC | 10527 Number of splices: Non-canonical | 35373 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282880 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 67701 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.38% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1055383 1055383 1055383 N_multimapping 282880 282880 282880 N_noFeature 397576 11430213 455941 N_ambiguous 127184 804 61755 UnstrandedReadsAssigned:11028761 PositiveStrandReadsAssigned:122504 NegativeStrandReadsAssigned:11035825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172703 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172703-trimmed-pair1.fastq SRR7172703-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,868,241 reads, 10,955,401 reads pseudoaligned [quant] estimated average fragment length: 226.258 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7172703.ke.tsv 34699 SRR7172703.se.tsv 87100 total ==> SRR7172703.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.74 1109 45.7124 Potri.005G024800.1.v4.1 1035 809.742 422 38.5111 Potri.004G059700.1.v4.1 961 735.753 30 3.01307 Potri.007G009000.2.v4.1 1416 1190.74 0 0 Potri.003G141000.2.v4.1 2943 2717.74 329.217 8.95145 Potri.016G087400.1.v4.1 270 81.3781 873 792.732 Potri.015G069301.1.v4.1 564 340.649 0 0 Potri.010G195200.1.v4.1 1773 1547.74 258 12.318 Potri.012G127500.1.v4.1 977 751.753 8166 802.702 ==> SRR7172703.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 531 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 522 SRR7172703 completed mapping pipeline successfully