Starting /dee2/code/volunteer_pipeline.sh SRR7172704 current disk space = 3058958761984 free memory = 1057185364 SRR7172704 SRAfilesize 789e5bcf0357fe5c6cc4fa3ee71cc850 SRR7172704.sra SRR7172704.sra file validated SRR7172704 is paired end SRR7172704 is conventional basespace SRR7172704 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172704_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.35625 32.0 18.0 33.0 18.0 33.0 2 31.0825 33.0 30.0 33.0 27.0 34.0 3 31.626 33.0 32.0 33.0 27.0 34.0 4 31.98525 33.0 32.0 33.0 31.0 34.0 5 32.75225 33.0 33.0 33.0 32.0 34.0 6 37.2395 38.0 37.0 38.0 36.0 38.0 7 37.5275 38.0 38.0 38.0 37.0 38.0 8 37.60825 38.0 38.0 38.0 38.0 38.0 9 37.7115 38.0 38.0 38.0 38.0 38.0 10-14 37.67035 38.0 38.0 38.0 38.0 38.0 15-19 37.648 38.0 38.0 38.0 38.0 38.0 20-24 37.60195 38.0 38.0 38.0 38.0 38.0 25-29 37.614999999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.59435 38.0 38.0 38.0 38.0 38.0 35-39 37.54735 38.0 38.0 38.0 38.0 38.0 40-44 37.5407 38.0 38.0 38.0 38.0 38.0 45-49 37.4925 38.0 38.0 38.0 38.0 38.0 50-54 37.486450000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.34525 38.0 38.0 38.0 37.0 38.0 60-64 37.358250000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2882 38.0 38.0 38.0 37.0 38.0 70-74 37.2792 38.0 38.0 38.0 37.0 38.0 75-79 37.17905 38.0 38.0 38.0 36.8 38.0 80-84 37.11855 38.0 38.0 38.0 36.6 38.0 85-89 36.977050000000006 38.0 38.0 38.0 36.0 38.0 90-94 37.027750000000005 38.0 38.0 38.0 36.0 38.0 95-99 37.0723 38.0 38.0 38.0 36.0 38.0 100-104 36.91295 38.0 38.0 38.0 35.8 38.0 105-109 36.71325 38.0 38.0 38.0 34.8 38.0 110-114 36.5995 38.0 38.0 38.0 34.6 38.0 115-119 36.6077 38.0 38.0 38.0 34.6 38.0 120-124 36.47085 38.0 38.0 38.0 34.0 38.0 125-129 36.2067 38.0 38.0 38.0 33.8 38.0 130-134 35.802499999999995 38.0 36.6 38.0 32.2 38.0 135-139 35.4337 38.0 36.0 38.0 31.0 38.0 140-144 35.4165 38.0 36.0 38.0 30.6 38.0 145-149 35.29965 38.0 36.0 38.0 31.0 38.0 150-151 32.4655 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 3.0 14 0.0 15 1.0 16 1.0 17 3.0 18 0.0 19 1.0 20 5.0 21 1.0 22 4.0 23 4.0 24 4.0 25 9.0 26 7.0 27 13.0 28 13.0 29 20.0 30 25.0 31 34.0 32 58.0 33 85.0 34 121.0 35 198.0 36 528.0 37 2859.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.07456588355465 12.002042900919307 13.406537282941777 36.51685393258427 2 19.386472215237617 17.67664068393261 39.04953482524516 23.88735227558461 3 18.975 21.775 27.200000000000003 32.05 4 23.575 29.725 22.125 24.575 5 21.275 34.325 25.974999999999998 18.425 6 16.525000000000002 33.7 27.85 21.925 7 13.025 23.775 43.675000000000004 19.525000000000002 8 17.575 23.25 33.825 25.35 9 18.45 24.75 31.075000000000003 25.724999999999998 10-14 19.6 29.59 28.175 22.634999999999998 15-19 19.435 28.884999999999998 28.52 23.16 20-24 18.875 28.815 28.249999999999996 24.060000000000002 25-29 19.295 29.189999999999998 27.875 23.64 30-34 19.23 29.515 27.634999999999998 23.62 35-39 19.39 28.37 28.465 23.775 40-44 19.68 28.575 28.405 23.34 45-49 19.985 28.16 27.55 24.305 50-54 19.185 28.549999999999997 28.275 23.990000000000002 55-59 20.155 28.605000000000004 27.58 23.66 60-64 19.285 27.894999999999996 28.444999999999997 24.375 65-69 19.445 27.915 28.28 24.36 70-74 19.81 28.965000000000003 27.825 23.400000000000002 75-79 19.744999999999997 28.125 28.205000000000002 23.925 80-84 20.11 28.1 28.110000000000003 23.68 85-89 19.939999999999998 28.1 28.03 23.93 90-94 19.985 28.125 27.950000000000003 23.94 95-99 20.150000000000002 28.384999999999998 27.865000000000002 23.599999999999998 100-104 19.775000000000002 28.4 28.175 23.65 105-109 20.135 27.87 28.655 23.34 110-114 20.78 28.335 27.884999999999998 23.0 115-119 20.095 28.53 27.794999999999998 23.580000000000002 120-124 20.345 28.360000000000003 27.3 23.995 125-129 20.53 27.765 27.76 23.945 130-134 20.555 28.389999999999997 27.339999999999996 23.715 135-139 21.04 28.299999999999997 27.325 23.335 140-144 21.115000000000002 27.800000000000004 27.0 24.085 145-149 21.205 28.52 26.82 23.455000000000002 150-151 21.3875 27.775 26.8 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 4.5 26 6.5 27 9.5 28 7.0 29 8.5 30 20.5 31 26.0 32 33.0 33 46.5 34 57.0 35 82.5 36 97.0 37 101.5 38 144.5 39 182.0 40 181.0 41 200.5 42 251.5 43 280.0 44 300.0 45 302.0 46 275.0 47 255.0 48 230.0 49 198.5 50 176.5 51 144.5 52 92.5 53 67.0 54 60.0 55 38.0 56 29.5 57 25.5 58 16.5 59 11.0 60 7.5 61 7.5 62 4.5 63 2.0 64 2.0 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98964384945693 97.975 2 0.9850972467794897 1.95 3 0.025258903763576663 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.262499999999999 0.0 0.0 0.0 0.0 132-133 5.862500000000001 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172704 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172704_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1535 34.0 33.0 34.0 33.0 34.0 2 33.163 34.0 33.0 34.0 33.0 34.0 3 33.1605 34.0 33.0 34.0 33.0 34.0 4 33.1755 34.0 33.0 34.0 33.0 34.0 5 33.1765 34.0 33.0 34.0 33.0 34.0 6 37.1705 38.0 38.0 38.0 38.0 38.0 7 37.24975 38.0 38.0 38.0 38.0 38.0 8 37.30975 38.0 38.0 38.0 38.0 38.0 9 37.25875 38.0 38.0 38.0 38.0 38.0 10-14 37.20965 38.0 38.0 38.0 38.0 38.0 15-19 37.203199999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.2199 38.0 38.0 38.0 38.0 38.0 25-29 36.9366 38.0 38.0 38.0 37.4 38.0 30-34 36.375150000000005 38.0 38.0 38.0 36.6 38.0 35-39 36.63934999999999 38.0 38.0 38.0 36.6 38.0 40-44 37.02535 38.0 38.0 38.0 37.0 38.0 45-49 37.069700000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.085 38.0 38.0 38.0 37.0 38.0 55-59 36.98405 38.0 38.0 38.0 36.8 38.0 60-64 36.802949999999996 38.0 38.0 38.0 36.4 38.0 65-69 36.6937 38.0 38.0 38.0 36.0 38.0 70-74 36.697799999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.72705 38.0 38.0 38.0 36.0 38.0 80-84 36.743950000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.672250000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.57735 38.0 38.0 38.0 35.2 38.0 95-99 36.5338 38.0 38.0 38.0 35.2 38.0 100-104 36.4602 38.0 38.0 38.0 34.8 38.0 105-109 36.42095 38.0 38.0 38.0 34.8 38.0 110-114 36.2482 38.0 38.0 38.0 34.0 38.0 115-119 36.14665 38.0 38.0 38.0 34.0 38.0 120-124 35.89065 38.0 38.0 38.0 33.2 38.0 125-129 35.66705 38.0 37.4 38.0 32.0 38.0 130-134 35.391450000000006 38.0 36.6 38.0 31.0 38.0 135-139 35.1163 38.0 36.0 38.0 31.0 38.0 140-144 34.6574 38.0 36.0 38.0 28.0 38.0 145-149 34.08385 38.0 35.4 38.0 25.8 38.0 150-151 29.773375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 6.0 5 2.0 6 0.0 7 3.0 8 0.0 9 2.0 10 3.0 11 0.0 12 5.0 13 0.0 14 1.0 15 5.0 16 2.0 17 3.0 18 3.0 19 6.0 20 2.0 21 4.0 22 7.0 23 11.0 24 8.0 25 8.0 26 13.0 27 29.0 28 29.0 29 32.0 30 34.0 31 39.0 32 46.0 33 76.0 34 110.0 35 235.0 36 474.0 37 2784.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.95 15.575 18.325 29.15 2 22.5 23.674999999999997 36.675000000000004 17.150000000000002 3 22.525000000000002 26.375 30.225 20.875 4 24.95 34.825 21.375 18.85 5 24.65 36.1 22.3 16.950000000000003 6 18.575 39.1 24.575 17.75 7 19.1 17.2 42.125 21.575 8 20.925 24.525 26.700000000000003 27.85 9 22.45 25.624999999999996 28.525 23.400000000000002 10-14 23.3 29.425 26.179999999999996 21.095 15-19 22.82 28.444999999999997 28.13 20.605 20-24 23.380000000000003 28.34 27.235 21.044999999999998 25-29 23.211862276954008 28.891681326966573 27.444081427494343 20.452374968585072 30-34 23.253793878698072 28.547340452710646 27.77579071074549 20.42307495784579 35-39 23.188039799989898 29.31461184908329 26.96095762412243 20.536390726804385 40-44 23.72 28.82 27.04 20.419999999999998 45-49 23.72 28.415000000000003 27.389999999999997 20.474999999999998 50-54 23.9 28.599999999999998 27.400000000000002 20.1 55-59 24.044999999999998 28.299999999999997 27.529999999999998 20.125 60-64 23.849999999999998 28.32 27.54 20.29 65-69 23.75 28.249999999999996 27.794999999999998 20.205000000000002 70-74 23.71 28.62 27.839999999999996 19.830000000000002 75-79 23.56 28.494999999999997 27.700000000000003 20.244999999999997 80-84 24.805 27.560000000000002 27.55 20.085 85-89 23.46 28.235 27.85 20.455000000000002 90-94 23.76 28.37 27.22 20.65 95-99 23.365 27.800000000000004 28.395 20.44 100-104 23.925 28.189999999999998 27.810000000000002 20.075000000000003 105-109 23.905 28.105000000000004 27.555000000000003 20.435 110-114 24.125 28.384999999999998 27.589999999999996 19.900000000000002 115-119 24.099999999999998 28.035 27.189999999999998 20.674999999999997 120-124 24.825 28.139999999999997 27.575 19.46 125-129 24.285 28.165000000000003 27.87 19.68 130-134 24.745 28.075 27.37 19.81 135-139 24.825 28.585 27.38 19.21 140-144 25.255 28.87 26.33 19.545 145-149 24.88 28.88 26.919999999999998 19.32 150-151 26.087500000000002 27.500000000000004 27.325 19.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.5 27 3.5 28 7.5 29 7.5 30 10.0 31 16.5 32 22.5 33 31.0 34 37.5 35 45.5 36 66.0 37 106.0 38 145.5 39 166.5 40 196.0 41 252.5 42 292.0 43 301.0 44 299.0 45 308.0 46 303.0 47 270.0 48 252.5 49 206.5 50 151.5 51 124.0 52 101.0 53 75.0 54 53.0 55 39.0 56 27.5 57 21.5 58 14.0 59 11.5 60 9.0 61 4.0 62 3.5 63 5.5 64 2.5 65 0.5 66 2.5 67 3.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.525 30-34 2.145 35-39 1.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.8082849204344532 1.6 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.6624999999999996 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGCT 25 8.761206E-4 86.88 1 >>END_MODULE Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651319 spots for SRR7172704.sra Written 651319 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra Read 651316 spots for SRR7172704.sra Written 651316 spots for SRR7172704.sra SRR ids: ['SRR7172704.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sd_874ak SRR7172704.sra spots: 13026323 blocks: [[1, 651316], [651317, 1302632], [1302633, 1953948], [1953949, 2605264], [2605265, 3256580], [3256581, 3907896], [3907897, 4559212], [4559213, 5210528], [5210529, 5861844], [5861845, 6513160], [6513161, 7164476], [7164477, 7815792], [7815793, 8467108], [8467109, 9118424], [9118425, 9769740], [9769741, 10421056], [10421057, 11072372], [11072373, 11723688], [11723689, 12375004], [12375005, 13026323]] SRR7172704 file size 4392493 SRR7172704 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172704 SRR7172704_1.fastq SRR7172704_2.fastq Input file: SRR7172704_1.fastq Paired file: SRR7172704_2.fastq trimmed: SRR7172704-trimmed-pair1.fastq, SRR7172704-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:13:42 2025 >> started Mon Feb 10 14:13:55 2025 >> done (13.280s) 13026323 read pairs processed; of these: 24559 ( 0.19%) short read pairs filtered out after trimming by size control 15111 ( 0.12%) empty read pairs filtered out after trimming by size control 12986653 (99.70%) read pairs available; of these: 5542429 (42.68%) trimmed read pairs available after processing 7444224 (57.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 10 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 8 0.00% 28 2 0.00% 29 3 0.00% 30 6 0.00% 31 1 0.00% 32 6 0.00% 33 1 0.00% 34 3 0.00% 35 0 0.00% 36 1 0.00% 37 4 0.00% 38 5 0.00% 39 4 0.00% 40 4 0.00% 41 5 0.00% 42 3 0.00% 43 7 0.00% 44 6 0.00% 45 15 0.00% 46 6 0.00% 47 15 0.00% 48 15 0.00% 49 18 0.00% 50 15 0.00% 51 28 0.00% 52 21 0.00% 53 31 0.00% 54 31 0.00% 55 33 0.00% 56 38 0.00% 57 40 0.00% 58 40 0.00% 59 66 0.00% 60 46 0.00% 61 62 0.00% 62 67 0.00% 63 82 0.00% 64 111 0.00% 65 104 0.00% 66 148 0.00% 67 111 0.00% 68 169 0.00% 69 217 0.00% 70 257 0.00% 71 267 0.00% 72 297 0.00% 73 351 0.00% 74 453 0.00% 75 457 0.00% 76 530 0.00% 77 617 0.00% 78 687 0.01% 79 774 0.01% 80 876 0.01% 81 1001 0.01% 82 1253 0.01% 83 1534 0.01% 84 2946 0.02% 85 3681 0.03% 86 3968 0.03% 87 4436 0.03% 88 4474 0.03% 89 4393 0.03% 90 4726 0.04% 91 4787 0.04% 92 5102 0.04% 93 5449 0.04% 94 5933 0.05% 95 6410 0.05% 96 6821 0.05% 97 7344 0.06% 98 7676 0.06% 99 8523 0.07% 100 8838 0.07% 101 9783 0.08% 102 10560 0.08% 103 11260 0.09% 104 11940 0.09% 105 12647 0.10% 106 13679 0.11% 107 14419 0.11% 108 15523 0.12% 109 16231 0.12% 110 17475 0.13% 111 18334 0.14% 112 19350 0.15% 113 20663 0.16% 114 21576 0.17% 115 22949 0.18% 116 23735 0.18% 117 25021 0.19% 118 26200 0.20% 119 27054 0.21% 120 28111 0.22% 121 29310 0.23% 122 30608 0.24% 123 32215 0.25% 124 33246 0.26% 125 34674 0.27% 126 36118 0.28% 127 38175 0.29% 128 39014 0.30% 129 40539 0.31% 130 42143 0.32% 131 43295 0.33% 132 45300 0.35% 133 47769 0.37% 134 49604 0.38% 135 51799 0.40% 136 53204 0.41% 137 55801 0.43% 138 58730 0.45% 139 61224 0.47% 140 64430 0.50% 141 68881 0.53% 142 73800 0.57% 143 79851 0.61% 144 87656 0.67% 145 100879 0.78% 146 119611 0.92% 147 151074 1.16% 148 219118 1.69% 149 514581 3.96% 150 2766777 21.30% 151 7444224 57.32% 12986653 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=2.5 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=29.73 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.5 sequence=ATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.48 prefix-fanout=2.1 sequence=CTCAGTTGTTCCTTTACAATGATGGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=70.21 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAA SRR7172704 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:14:39 Started mapping on | Feb 10 14:14:39 Finished on | Feb 10 14:16:10 Mapping speed, Million of reads per hour | 513.76 Number of input reads | 12986653 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12236644 Uniquely mapped reads % | 94.22% Average mapped length | 294.23 Number of splices: Total | 12068137 Number of splices: Annotated (sjdb) | 11832304 Number of splices: GT/AG | 11873308 Number of splices: GC/AG | 153014 Number of splices: AT/AC | 10974 Number of splices: Non-canonical | 30841 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313539 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 57026 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 459833 459833 459833 N_multimapping 313539 313539 313539 N_noFeature 313076 12119366 364100 N_ambiguous 127201 836 60358 UnstrandedReadsAssigned:11796367 PositiveStrandReadsAssigned:116442 NegativeStrandReadsAssigned:11812186 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172704 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172704-trimmed-pair1.fastq SRR7172704-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,986,653 reads, 11,759,572 reads pseudoaligned [quant] estimated average fragment length: 222.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7172704.ke.tsv 34699 SRR7172704.se.tsv 87100 total ==> SRR7172704.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.54 1506 60.2678 Potri.005G024800.1.v4.1 1035 813.535 554 48.9587 Potri.004G059700.1.v4.1 961 739.54 60 5.83292 Potri.007G009000.2.v4.1 1416 1194.54 0 0 Potri.003G141000.2.v4.1 2943 2721.54 420 11.0951 Potri.016G087400.1.v4.1 270 82.7357 1060 921.104 Potri.015G069301.1.v4.1 564 344.217 0 0 Potri.010G195200.1.v4.1 1773 1551.54 349 16.1719 Potri.012G127500.1.v4.1 977 755.54 3914 372.443 ==> SRR7172704.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 614 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 568 SRR7172704 completed mapping pipeline successfully