Starting /dee2/code/volunteer_pipeline.sh SRR7172705 current disk space = 3057951657984 free memory = 1478262080 SRR7172705 SRAfilesize dcd4e1d144cabde7924938d190e4a015 SRR7172705.sra SRR7172705.sra file validated SRR7172705 is paired end SRR7172705 is conventional basespace SRR7172705 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.19075 32.0 18.0 33.0 18.0 33.0 2 31.01575 33.0 30.0 33.0 27.0 34.0 3 31.3595 33.0 32.0 33.0 27.0 34.0 4 31.99375 33.0 32.0 33.0 31.0 33.0 5 32.49075 33.0 33.0 33.0 32.0 34.0 6 37.2145 38.0 37.0 38.0 36.0 38.0 7 37.514 38.0 38.0 38.0 37.0 38.0 8 37.67825 38.0 38.0 38.0 38.0 38.0 9 37.70975 38.0 38.0 38.0 38.0 38.0 10-14 37.68645 38.0 38.0 38.0 38.0 38.0 15-19 37.6734 38.0 38.0 38.0 38.0 38.0 20-24 37.65885 38.0 38.0 38.0 38.0 38.0 25-29 37.658950000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.628400000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.58075 38.0 38.0 38.0 38.0 38.0 40-44 37.5345 38.0 38.0 38.0 38.0 38.0 45-49 37.518 38.0 38.0 38.0 38.0 38.0 50-54 37.48225 38.0 38.0 38.0 38.0 38.0 55-59 37.4052 38.0 38.0 38.0 37.4 38.0 60-64 37.39925 38.0 38.0 38.0 37.2 38.0 65-69 37.29795 38.0 38.0 38.0 37.0 38.0 70-74 37.29600000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.1849 38.0 38.0 38.0 36.8 38.0 80-84 37.13435 38.0 38.0 38.0 36.8 38.0 85-89 37.01755 38.0 38.0 38.0 36.0 38.0 90-94 37.02485 38.0 38.0 38.0 36.0 38.0 95-99 37.10055 38.0 38.0 38.0 36.0 38.0 100-104 36.9371 38.0 38.0 38.0 35.8 38.0 105-109 36.675650000000005 38.0 38.0 38.0 34.6 38.0 110-114 36.56955 38.0 38.0 38.0 34.2 38.0 115-119 36.527750000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.52815 38.0 38.0 38.0 34.4 38.0 125-129 36.180550000000004 38.0 37.8 38.0 33.6 38.0 130-134 35.867850000000004 38.0 36.8 38.0 32.4 38.0 135-139 35.38860000000001 38.0 36.0 38.0 29.6 38.0 140-144 35.461149999999996 38.0 36.0 38.0 30.4 38.0 145-149 35.3003 38.0 36.0 38.0 31.0 38.0 150-151 32.397125 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 4.0 20 0.0 21 2.0 22 2.0 23 2.0 24 2.0 25 8.0 26 8.0 27 14.0 28 18.0 29 19.0 30 30.0 31 46.0 32 46.0 33 88.0 34 105.0 35 214.0 36 537.0 37 2846.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.66921313980138 12.197606315253374 12.095747389865037 39.037433155080215 2 20.487682252388133 18.50175967823027 40.17094017094017 20.83961789844143 3 19.175 24.349999999999998 25.474999999999998 31.0 4 22.85 33.45 21.925 21.775 5 21.5 35.35 23.375 19.775000000000002 6 17.075000000000003 35.675000000000004 26.125 21.125 7 13.200000000000001 21.224999999999998 46.425 19.15 8 17.625 21.025 33.575 27.775 9 18.525 22.025 32.85 26.6 10-14 19.580000000000002 29.12 27.384999999999998 23.915 15-19 19.255 28.544999999999998 28.18 24.02 20-24 19.71 27.925 28.439999999999998 23.925 25-29 19.945 28.299999999999997 28.22 23.535 30-34 19.625 29.160000000000004 27.87 23.345 35-39 20.0 28.384999999999998 27.779999999999998 23.835 40-44 20.13 27.71 28.705000000000002 23.455000000000002 45-49 19.97 28.215 28.125 23.69 50-54 20.14 28.615000000000002 28.04 23.205000000000002 55-59 20.39 28.23 27.725 23.655 60-64 20.25 28.185 28.044999999999998 23.52 65-69 20.5 28.235 27.83 23.435 70-74 20.27 28.235 27.894999999999996 23.599999999999998 75-79 20.09 28.315 27.595 24.0 80-84 20.3 28.415000000000003 27.589999999999996 23.695 85-89 20.21 27.855 28.244999999999997 23.69 90-94 19.81 28.74 27.24 24.21 95-99 19.99 27.97 28.665000000000003 23.375 100-104 20.355 28.544999999999998 27.175 23.925 105-109 20.515 27.985 27.54 23.96 110-114 20.315 27.79 28.07 23.825 115-119 20.669999999999998 27.875 27.985 23.47 120-124 20.805 27.765 28.139999999999997 23.29 125-129 20.29 27.965 27.825 23.919999999999998 130-134 20.915 28.335 27.334999999999997 23.415 135-139 20.75 27.915 27.884999999999998 23.45 140-144 20.985 27.310000000000002 27.735 23.97 145-149 20.810000000000002 27.58 28.189999999999998 23.419999999999998 150-151 20.925 28.537499999999998 27.200000000000003 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 0.5 25 1.0 26 4.5 27 6.0 28 6.5 29 8.5 30 16.5 31 25.5 32 27.0 33 39.5 34 54.5 35 63.5 36 83.5 37 103.5 38 124.5 39 174.0 40 229.5 41 241.0 42 250.5 43 271.0 44 287.0 45 296.0 46 291.5 47 254.5 48 211.0 49 184.0 50 160.5 51 141.0 52 110.5 53 82.5 54 59.0 55 49.0 56 39.5 57 24.5 58 16.5 59 12.5 60 8.0 61 6.0 62 7.0 63 7.0 64 3.5 65 1.5 66 2.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172705 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172705_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.179 34.0 33.0 34.0 33.0 34.0 2 33.2355 34.0 33.0 34.0 33.0 34.0 3 33.26075 34.0 33.0 34.0 33.0 34.0 4 33.316 34.0 33.0 34.0 33.0 34.0 5 33.3225 34.0 33.0 34.0 33.0 34.0 6 37.39275 38.0 38.0 38.0 38.0 38.0 7 37.4275 38.0 38.0 38.0 38.0 38.0 8 37.45375 38.0 38.0 38.0 38.0 38.0 9 37.4445 38.0 38.0 38.0 38.0 38.0 10-14 37.4343 38.0 38.0 38.0 38.0 38.0 15-19 37.485299999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.43415 38.0 38.0 38.0 38.0 38.0 25-29 37.2218 38.0 38.0 38.0 37.8 38.0 30-34 36.69675 38.0 38.0 38.0 37.0 38.0 35-39 36.96255 38.0 38.0 38.0 37.0 38.0 40-44 37.29775000000001 38.0 38.0 38.0 37.2 38.0 45-49 37.3338 38.0 38.0 38.0 37.2 38.0 50-54 37.304649999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2218 38.0 38.0 38.0 37.0 38.0 60-64 37.068 38.0 38.0 38.0 36.8 38.0 65-69 37.0187 38.0 38.0 38.0 36.4 38.0 70-74 36.97089999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.0213 38.0 38.0 38.0 36.2 38.0 80-84 36.988350000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.92975 38.0 38.0 38.0 36.0 38.0 90-94 36.871500000000005 38.0 38.0 38.0 35.6 38.0 95-99 36.8116 38.0 38.0 38.0 35.4 38.0 100-104 36.7586 38.0 38.0 38.0 35.2 38.0 105-109 36.66085 38.0 38.0 38.0 35.0 38.0 110-114 36.52034999999999 38.0 38.0 38.0 34.4 38.0 115-119 36.29945 38.0 38.0 38.0 34.0 38.0 120-124 36.1015 38.0 37.8 38.0 33.4 38.0 125-129 35.8625 38.0 37.2 38.0 32.4 38.0 130-134 35.619600000000005 38.0 36.8 38.0 31.4 38.0 135-139 35.3723 38.0 36.0 38.0 31.0 38.0 140-144 34.90070000000001 38.0 36.0 38.0 29.4 38.0 145-149 34.38535 38.0 35.6 38.0 27.6 38.0 150-151 29.87625 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 4.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 2.0 17 2.0 18 1.0 19 3.0 20 2.0 21 9.0 22 3.0 23 5.0 24 7.0 25 16.0 26 15.0 27 25.0 28 20.0 29 21.0 30 41.0 31 37.0 32 57.0 33 79.0 34 130.0 35 265.0 36 479.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 14.825 17.675 32.574999999999996 2 22.625 22.925 36.6 17.849999999999998 3 20.65 26.125 32.25 20.974999999999998 4 24.425 33.35 21.775 20.45 5 22.900000000000002 37.7 22.175 17.224999999999998 6 17.599999999999998 39.75 23.45 19.2 7 18.55 16.625 43.425000000000004 21.4 8 21.675 21.5 29.349999999999998 27.474999999999998 9 22.125 23.775 30.25 23.849999999999998 10-14 23.34 28.565 26.61 21.485000000000003 15-19 23.22 28.095 27.47 21.215 20-24 22.67 27.985 28.175 21.17 25-29 22.56314970120022 28.28303118565761 28.011851554261035 21.141967558881134 30-34 23.054989816700612 28.681262729124235 27.917515274949086 20.34623217922607 35-39 22.884217954533998 28.34820303442714 27.788699027168708 20.978879983870154 40-44 22.85 28.33 27.97 20.849999999999998 45-49 22.884999999999998 28.23 28.389999999999997 20.495 50-54 23.69 27.41 28.060000000000002 20.84 55-59 23.415 28.09 27.994999999999997 20.5 60-64 23.11 27.63 28.435 20.825 65-69 23.69 28.15 27.76 20.4 70-74 23.580000000000002 28.115000000000002 27.845 20.46 75-79 23.49 27.839999999999996 28.105000000000004 20.565 80-84 23.674999999999997 28.360000000000003 27.525 20.44 85-89 24.19 27.51 27.939999999999998 20.36 90-94 23.49 27.425 28.689999999999998 20.395 95-99 23.515 28.02 27.63 20.835 100-104 23.474999999999998 27.85 27.884999999999998 20.79 105-109 23.745 27.894999999999996 27.46 20.9 110-114 23.48 28.655 27.905 19.96 115-119 24.07 27.875 27.715 20.34 120-124 23.485 28.225 27.41 20.880000000000003 125-129 24.485 28.355000000000004 27.139999999999997 20.02 130-134 24.54 28.07 27.169999999999998 20.22 135-139 24.215 27.694999999999997 28.255000000000003 19.835 140-144 23.91 28.34 27.77 19.98 145-149 24.23 28.71 27.315 19.744999999999997 150-151 25.0125 27.650000000000002 27.5125 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 0.5 25 0.5 26 2.5 27 3.0 28 4.5 29 5.5 30 7.0 31 12.5 32 18.5 33 33.0 34 47.5 35 59.0 36 78.5 37 102.5 38 132.0 39 168.5 40 217.5 41 257.0 42 268.0 43 301.5 44 314.0 45 297.5 46 284.0 47 259.0 48 222.0 49 179.0 50 156.5 51 132.5 52 106.5 53 83.5 54 64.5 55 48.5 56 32.0 57 23.0 58 15.5 59 11.0 60 11.5 61 9.0 62 5.0 63 6.5 64 6.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.43499999999999994 30-34 1.7999999999999998 35-39 0.8049999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.25 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.675 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.0 0.0 0.0 0.0 0.0 138-139 3.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAGAT 10 0.0068555363 144.825 145 >>END_MODULE Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636414 spots for SRR7172705.sra Written 636414 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra Read 636398 spots for SRR7172705.sra Written 636398 spots for SRR7172705.sra SRR ids: ['SRR7172705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yxx1jwd3 SRR7172705.sra spots: 12727976 blocks: [[1, 636398], [636399, 1272796], [1272797, 1909194], [1909195, 2545592], [2545593, 3181990], [3181991, 3818388], [3818389, 4454786], [4454787, 5091184], [5091185, 5727582], [5727583, 6363980], [6363981, 7000378], [7000379, 7636776], [7636777, 8273174], [8273175, 8909572], [8909573, 9545970], [9545971, 10182368], [10182369, 10818766], [10818767, 11455164], [11455165, 12091562], [12091563, 12727976]] SRR7172705 file size 4291393 SRR7172705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172705 SRR7172705_1.fastq SRR7172705_2.fastq Input file: SRR7172705_1.fastq Paired file: SRR7172705_2.fastq trimmed: SRR7172705-trimmed-pair1.fastq, SRR7172705-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:45:29 2025 >> started Mon Feb 10 17:45:42 2025 >> done (12.801s) 12727976 read pairs processed; of these: 7102 ( 0.06%) short read pairs filtered out after trimming by size control 5358 ( 0.04%) empty read pairs filtered out after trimming by size control 12715516 (99.90%) read pairs available; of these: 4966268 (39.06%) trimmed read pairs available after processing 7749248 (60.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 5 0.00% 32 0 0.00% 33 2 0.00% 34 3 0.00% 35 0 0.00% 36 3 0.00% 37 2 0.00% 38 1 0.00% 39 0 0.00% 40 1 0.00% 41 1 0.00% 42 6 0.00% 43 2 0.00% 44 6 0.00% 45 6 0.00% 46 9 0.00% 47 4 0.00% 48 4 0.00% 49 4 0.00% 50 10 0.00% 51 8 0.00% 52 5 0.00% 53 15 0.00% 54 16 0.00% 55 20 0.00% 56 18 0.00% 57 26 0.00% 58 21 0.00% 59 25 0.00% 60 27 0.00% 61 30 0.00% 62 38 0.00% 63 48 0.00% 64 53 0.00% 65 55 0.00% 66 67 0.00% 67 74 0.00% 68 76 0.00% 69 111 0.00% 70 113 0.00% 71 132 0.00% 72 157 0.00% 73 143 0.00% 74 181 0.00% 75 239 0.00% 76 246 0.00% 77 294 0.00% 78 336 0.00% 79 371 0.00% 80 450 0.00% 81 511 0.00% 82 577 0.00% 83 667 0.01% 84 1218 0.01% 85 1495 0.01% 86 1655 0.01% 87 1946 0.02% 88 1990 0.02% 89 1869 0.01% 90 2073 0.02% 91 2304 0.02% 92 2477 0.02% 93 2623 0.02% 94 2804 0.02% 95 3093 0.02% 96 3266 0.03% 97 3452 0.03% 98 3672 0.03% 99 3988 0.03% 100 4210 0.03% 101 4615 0.04% 102 5060 0.04% 103 5378 0.04% 104 5838 0.05% 105 6377 0.05% 106 6696 0.05% 107 7051 0.06% 108 7551 0.06% 109 8222 0.06% 110 8768 0.07% 111 9092 0.07% 112 9824 0.08% 113 10193 0.08% 114 10906 0.09% 115 11642 0.09% 116 12402 0.10% 117 13154 0.10% 118 13441 0.11% 119 14169 0.11% 120 15047 0.12% 121 15630 0.12% 122 16330 0.13% 123 17246 0.14% 124 18457 0.15% 125 19212 0.15% 126 20143 0.16% 127 21476 0.17% 128 22086 0.17% 129 23347 0.18% 130 24618 0.19% 131 25608 0.20% 132 26986 0.21% 133 28637 0.23% 134 30518 0.24% 135 31879 0.25% 136 34502 0.27% 137 36340 0.29% 138 38422 0.30% 139 41834 0.33% 140 44386 0.35% 141 48552 0.38% 142 53852 0.42% 143 59523 0.47% 144 68755 0.54% 145 81711 0.64% 146 102935 0.81% 147 138510 1.09% 148 213346 1.68% 149 531294 4.18% 150 2895336 22.77% 151 7749248 60.94% 12715516 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=3.4 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=45.72 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.0 sequence=AAAACTCCAGTCGACTCCACAATATAATCAGCTCCGGTCTCACCCCATGGGATCTCCTCTGGGTTCCTGA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=28 prefix-density=0.27 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=17.95 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=8.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172705 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:46:40 Started mapping on | Feb 10 17:46:40 Finished on | Feb 10 17:48:19 Mapping speed, Million of reads per hour | 462.38 Number of input reads | 12715516 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11951630 Uniquely mapped reads % | 93.99% Average mapped length | 297.07 Number of splices: Total | 12836872 Number of splices: Annotated (sjdb) | 12639953 Number of splices: GT/AG | 12643012 Number of splices: GC/AG | 156742 Number of splices: AT/AC | 8580 Number of splices: Non-canonical | 28538 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342668 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 38547 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 429051 429051 429051 N_multimapping 342668 342668 342668 N_noFeature 240076 11855459 277329 N_ambiguous 117920 795 58535 UnstrandedReadsAssigned:11593634 PositiveStrandReadsAssigned:95376 NegativeStrandReadsAssigned:11615766 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172705 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172705-trimmed-pair1.fastq SRR7172705-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,715,516 reads, 11,534,651 reads pseudoaligned [quant] estimated average fragment length: 248.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7172705.ke.tsv 34699 SRR7172705.se.tsv 87100 total ==> SRR7172705.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.4 895 44.5871 Potri.005G024800.1.v4.1 1035 787.404 380 42.5642 Potri.004G059700.1.v4.1 961 713.429 56 6.92302 Potri.007G009000.2.v4.1 1416 1168.4 0 0 Potri.003G141000.2.v4.1 2943 2695.4 436 14.2666 Potri.016G087400.1.v4.1 270 72.2541 693 845.92 Potri.015G069301.1.v4.1 564 320.065 0 0 Potri.010G195200.1.v4.1 1773 1525.4 178.831 10.3399 Potri.012G127500.1.v4.1 977 729.409 2012 243.285 ==> SRR7172705.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 292 SRR7172705 completed mapping pipeline successfully