Starting /dee2/code/volunteer_pipeline.sh SRR7172706 current disk space = 3058958671872 free memory = 1408193160 SRR7172706 SRAfilesize 2c874a391adc510d362f192508562e24 SRR7172706.sra SRR7172706.sra file validated SRR7172706 is paired end SRR7172706 is conventional basespace SRR7172706 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172706_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3375 32.0 28.0 33.0 18.0 34.0 2 31.43225 33.0 32.0 33.0 27.0 34.0 3 31.65675 33.0 31.0 33.0 28.0 34.0 4 31.76975 33.0 32.0 33.0 30.0 34.0 5 32.338 33.0 33.0 33.0 31.0 34.0 6 36.7765 38.0 37.0 38.0 34.0 38.0 7 37.31425 38.0 38.0 38.0 36.0 38.0 8 37.39375 38.0 38.0 38.0 37.0 38.0 9 37.5595 38.0 38.0 38.0 38.0 38.0 10-14 37.623149999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6518 38.0 38.0 38.0 38.0 38.0 20-24 37.6493 38.0 38.0 38.0 38.0 38.0 25-29 37.65255 38.0 38.0 38.0 38.0 38.0 30-34 37.6327 38.0 38.0 38.0 38.0 38.0 35-39 37.627300000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.58385 38.0 38.0 38.0 38.0 38.0 45-49 37.55195 38.0 38.0 38.0 38.0 38.0 50-54 37.524899999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.48455 38.0 38.0 38.0 38.0 38.0 60-64 37.423500000000004 38.0 38.0 38.0 37.2 38.0 65-69 37.316 38.0 38.0 38.0 37.0 38.0 70-74 37.308800000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.22410000000001 38.0 38.0 38.0 36.4 38.0 80-84 37.11315 38.0 38.0 38.0 36.2 38.0 85-89 37.044 38.0 38.0 38.0 36.0 38.0 90-94 36.97925 38.0 38.0 38.0 35.8 38.0 95-99 36.96315 38.0 38.0 38.0 36.0 38.0 100-104 36.921499999999995 38.0 38.0 38.0 35.8 38.0 105-109 36.6696 38.0 38.0 38.0 34.4 38.0 110-114 36.51025 38.0 38.0 38.0 34.0 38.0 115-119 36.32665 38.0 38.0 38.0 34.0 38.0 120-124 36.3685 38.0 38.0 38.0 34.0 38.0 125-129 36.23145 38.0 37.6 38.0 33.6 38.0 130-134 35.73745 38.0 36.2 38.0 31.4 38.0 135-139 35.390550000000005 38.0 36.0 38.0 30.6 38.0 140-144 35.239450000000005 38.0 36.0 38.0 30.2 38.0 145-149 34.7746 38.0 35.2 38.0 28.8 38.0 150-151 30.632375000000003 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 1.0 21 0.0 22 4.0 23 1.0 24 3.0 25 5.0 26 7.0 27 9.0 28 16.0 29 22.0 30 23.0 31 42.0 32 60.0 33 86.0 34 144.0 35 244.0 36 660.0 37 2662.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.09133007460767 14.89580653460252 11.937226652945716 38.07563673784409 2 20.757113821138212 19.385162601626014 37.75406504065041 22.103658536585368 3 20.625 25.424999999999997 26.400000000000002 27.55 4 24.275 31.95 20.95 22.825 5 21.349999999999998 38.525 21.9 18.224999999999998 6 17.65 36.825 25.35 20.175 7 13.475000000000001 23.35 43.225 19.950000000000003 8 17.349999999999998 22.6 30.8 29.25 9 18.75 22.5 32.05 26.700000000000003 10-14 20.11 29.360000000000003 26.745 23.785 15-19 19.869999999999997 28.15 28.22 23.76 20-24 20.48 28.310000000000002 27.74 23.47 25-29 19.57 28.68 27.779999999999998 23.97 30-34 20.105 28.395 28.125 23.375 35-39 20.87 27.735 28.075 23.32 40-44 20.64 28.425 27.565 23.369999999999997 45-49 20.849999999999998 28.175 27.705000000000002 23.27 50-54 20.18 28.410000000000004 27.750000000000004 23.66 55-59 20.335 28.1 28.01 23.555 60-64 19.56 28.689999999999998 27.805000000000003 23.945 65-69 19.625 28.59 27.625 24.16 70-74 20.57 28.389999999999997 27.744999999999997 23.294999999999998 75-79 20.244999999999997 28.4 27.800000000000004 23.555 80-84 20.474999999999998 27.365000000000002 28.535 23.625 85-89 20.095 28.12 27.894999999999996 23.89 90-94 20.77 28.355000000000004 27.250000000000004 23.625 95-99 20.555 28.310000000000002 27.85 23.285 100-104 20.54 28.110000000000003 27.82 23.53 105-109 20.635 27.765 28.095 23.505000000000003 110-114 20.741407774275853 27.70523788083446 27.970383711041073 23.582970633848614 115-119 20.481988075554888 28.628688812064734 27.631644871987575 23.257678240392803 120-124 21.09 28.18 27.744999999999997 22.985 125-129 20.61 28.285 27.99 23.115 130-134 20.935000000000002 28.38 26.895000000000003 23.79 135-139 20.72 28.23 27.084999999999997 23.965 140-144 20.735 27.93 27.389999999999997 23.945 145-149 21.15 27.915 27.175 23.76 150-151 20.7125 27.6 27.237499999999997 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 2.0 24 2.5 25 1.5 26 4.0 27 5.0 28 3.5 29 9.0 30 18.0 31 21.5 32 27.0 33 34.5 34 44.0 35 72.5 36 98.0 37 101.5 38 129.5 39 172.0 40 206.5 41 234.5 42 263.5 43 284.5 44 256.5 45 258.5 46 260.5 47 239.0 48 235.5 49 214.5 50 186.0 51 158.0 52 125.5 53 89.5 54 62.5 55 47.5 56 39.5 57 28.5 58 18.5 59 11.5 60 8.5 61 5.5 62 3.0 63 5.0 64 4.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 1.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.055 115-119 0.20500000000000002 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGAT 10 0.006090368 150.5974 1 CCTGATT 10 0.006582306 146.7848 2 TCCAGTA 10 0.0068378756 144.95 9 >>END_MODULE SRR7172706 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172706_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21375 34.0 33.0 34.0 33.0 34.0 2 33.2555 34.0 33.0 34.0 33.0 34.0 3 33.16925 34.0 33.0 34.0 33.0 34.0 4 33.22475 34.0 33.0 34.0 33.0 34.0 5 33.23525 34.0 33.0 34.0 33.0 34.0 6 37.4055 38.0 38.0 38.0 38.0 38.0 7 37.37525 38.0 38.0 38.0 38.0 38.0 8 37.31875 38.0 38.0 38.0 38.0 38.0 9 37.3175 38.0 38.0 38.0 38.0 38.0 10-14 37.27325 38.0 38.0 38.0 38.0 38.0 15-19 37.28395 38.0 38.0 38.0 38.0 38.0 20-24 37.28175 38.0 38.0 38.0 38.0 38.0 25-29 36.939350000000005 38.0 38.0 38.0 37.6 38.0 30-34 36.28785 38.0 38.0 38.0 36.8 38.0 35-39 36.59035 38.0 38.0 38.0 36.4 38.0 40-44 37.10074999999999 38.0 38.0 38.0 37.4 38.0 45-49 37.146 38.0 38.0 38.0 37.8 38.0 50-54 37.101 38.0 38.0 38.0 37.2 38.0 55-59 37.0255 38.0 38.0 38.0 37.0 38.0 60-64 36.95175 38.0 38.0 38.0 37.0 38.0 65-69 36.856700000000004 38.0 38.0 38.0 36.2 38.0 70-74 36.81445 38.0 38.0 38.0 36.2 38.0 75-79 36.795300000000005 38.0 38.0 38.0 36.2 38.0 80-84 36.70795 38.0 38.0 38.0 35.8 38.0 85-89 36.643100000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.62385 38.0 38.0 38.0 35.6 38.0 95-99 36.4735 38.0 38.0 38.0 35.0 38.0 100-104 36.3889 38.0 38.0 38.0 34.6 38.0 105-109 36.316449999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.2017 38.0 38.0 38.0 34.0 38.0 115-119 36.07965 38.0 38.0 38.0 33.8 38.0 120-124 35.817949999999996 38.0 38.0 38.0 33.2 38.0 125-129 35.5938 38.0 37.4 38.0 31.8 38.0 130-134 35.19884999999999 38.0 36.4 38.0 30.0 38.0 135-139 34.997699999999995 38.0 36.0 38.0 29.0 38.0 140-144 34.6488 38.0 35.6 38.0 27.6 38.0 145-149 33.689299999999996 38.0 33.8 38.0 21.8 38.0 150-151 29.69025 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 4.0 4 4.0 5 3.0 6 3.0 7 1.0 8 2.0 9 1.0 10 2.0 11 2.0 12 1.0 13 2.0 14 2.0 15 4.0 16 1.0 17 5.0 18 0.0 19 5.0 20 5.0 21 10.0 22 2.0 23 7.0 24 10.0 25 6.0 26 13.0 27 16.0 28 11.0 29 30.0 30 36.0 31 45.0 32 55.0 33 86.0 34 159.0 35 264.0 36 490.0 37 2698.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 15.4 17.875 27.975 2 25.1 24.175 33.050000000000004 17.675 3 20.474999999999998 27.575 30.975 20.974999999999998 4 24.825 33.75 21.475 19.950000000000003 5 24.099999999999998 36.5 21.075 18.325 6 19.400000000000002 37.775 23.724999999999998 19.1 7 18.925 17.75 41.9 21.425 8 21.275 22.7 26.6 29.425 9 22.6 25.275 28.175 23.95 10-14 22.915 28.84 26.215 22.03 15-19 23.13 28.134999999999998 27.525 21.21 20-24 22.15 28.435 27.785 21.63 25-29 23.18584962709131 28.4821608546664 27.0509977827051 21.280991735537192 30-34 21.970630519613884 28.16800164304785 28.758471965495996 21.102895871842268 35-39 22.530285366719045 28.4606416949668 27.827056617162555 21.182016321151604 40-44 23.27 28.084999999999997 27.775 20.87 45-49 23.125 27.905 27.915 21.055 50-54 22.66 28.715000000000003 27.810000000000002 20.815 55-59 23.315 28.13 27.889999999999997 20.665 60-64 23.09 28.525 27.33 21.055 65-69 23.23 28.415000000000003 28.02 20.335 70-74 23.61 27.650000000000002 28.42 20.32 75-79 23.385 28.115000000000002 28.165000000000003 20.335 80-84 23.425 28.215 27.735 20.625 85-89 23.880000000000003 27.889999999999997 27.389999999999997 20.84 90-94 23.29 28.29 27.615000000000002 20.805 95-99 23.465 28.044999999999998 27.41 21.08 100-104 23.78 28.42 27.43 20.369999999999997 105-109 23.474999999999998 28.27 27.71 20.544999999999998 110-114 23.52 28.04 27.615000000000002 20.825 115-119 23.72 27.965 27.975 20.34 120-124 23.9 28.194999999999997 27.544999999999998 20.36 125-129 24.63 28.355000000000004 26.845000000000002 20.169999999999998 130-134 24.29 27.99 26.8 20.919999999999998 135-139 25.264999999999997 27.93 26.995 19.81 140-144 24.884999999999998 27.71 27.235 20.169999999999998 145-149 24.84 27.82 27.055 20.285 150-151 24.587500000000002 28.462500000000002 26.474999999999998 20.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 1.0 25 1.5 26 2.5 27 3.0 28 6.0 29 10.5 30 8.5 31 10.5 32 18.0 33 30.5 34 42.0 35 59.0 36 86.0 37 119.0 38 150.0 39 174.5 40 215.5 41 233.0 42 251.0 43 278.0 44 295.0 45 293.5 46 268.5 47 247.0 48 226.5 49 204.5 50 166.0 51 136.0 52 110.5 53 85.0 54 71.5 55 55.0 56 36.0 57 25.5 58 22.5 59 16.0 60 9.0 61 6.0 62 3.5 63 3.0 64 6.5 65 5.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.7799999999999999 30-34 2.62 35-39 1.355 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.9749999999999996 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGCC 10 0.006882143 144.6375 1 TGAGCTG 10 0.006882143 144.6375 8 >>END_MODULE Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra Read 652177 spots for SRR7172706.sra Written 652177 spots for SRR7172706.sra Read 652166 spots for SRR7172706.sra Written 652166 spots for SRR7172706.sra SRR ids: ['SRR7172706.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kn1cn_vy SRR7172706.sra spots: 13043331 blocks: [[1, 652166], [652167, 1304332], [1304333, 1956498], [1956499, 2608664], [2608665, 3260830], [3260831, 3912996], [3912997, 4565162], [4565163, 5217328], [5217329, 5869494], [5869495, 6521660], [6521661, 7173826], [7173827, 7825992], [7825993, 8478158], [8478159, 9130324], [9130325, 9782490], [9782491, 10434656], [10434657, 11086822], [11086823, 11738988], [11738989, 12391154], [12391155, 13043331]] SRR7172706 file size 4398256 SRR7172706 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172706 SRR7172706_1.fastq SRR7172706_2.fastq Input file: SRR7172706_1.fastq Paired file: SRR7172706_2.fastq trimmed: SRR7172706-trimmed-pair1.fastq, SRR7172706-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:10:07 2025 >> started Mon Feb 10 14:10:30 2025 >> done (22.531s) 13043331 read pairs processed; of these: 15818 ( 0.12%) short read pairs filtered out after trimming by size control 12547 ( 0.10%) empty read pairs filtered out after trimming by size control 13014966 (99.78%) read pairs available; of these: 5210465 (40.03%) trimmed read pairs available after processing 7804501 (59.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 0 0.00% 38 5 0.00% 39 6 0.00% 40 4 0.00% 41 1 0.00% 42 3 0.00% 43 5 0.00% 44 4 0.00% 45 8 0.00% 46 4 0.00% 47 7 0.00% 48 8 0.00% 49 5 0.00% 50 12 0.00% 51 10 0.00% 52 22 0.00% 53 15 0.00% 54 23 0.00% 55 21 0.00% 56 25 0.00% 57 22 0.00% 58 23 0.00% 59 38 0.00% 60 49 0.00% 61 41 0.00% 62 62 0.00% 63 52 0.00% 64 99 0.00% 65 68 0.00% 66 95 0.00% 67 115 0.00% 68 133 0.00% 69 146 0.00% 70 159 0.00% 71 212 0.00% 72 245 0.00% 73 265 0.00% 74 332 0.00% 75 354 0.00% 76 438 0.00% 77 487 0.00% 78 554 0.00% 79 645 0.00% 80 679 0.01% 81 850 0.01% 82 925 0.01% 83 1167 0.01% 84 1943 0.01% 85 2551 0.02% 86 2763 0.02% 87 3015 0.02% 88 3201 0.02% 89 3168 0.02% 90 3618 0.03% 91 3755 0.03% 92 4080 0.03% 93 4379 0.03% 94 4765 0.04% 95 5100 0.04% 96 5305 0.04% 97 5842 0.04% 98 6144 0.05% 99 6680 0.05% 100 7223 0.06% 101 7891 0.06% 102 8531 0.07% 103 9177 0.07% 104 9773 0.08% 105 10488 0.08% 106 11089 0.09% 107 11746 0.09% 108 12519 0.10% 109 13246 0.10% 110 14082 0.11% 111 15023 0.12% 112 15984 0.12% 113 16479 0.13% 114 17645 0.14% 115 18887 0.15% 116 19827 0.15% 117 20814 0.16% 118 21418 0.16% 119 22273 0.17% 120 23342 0.18% 121 24419 0.19% 122 25698 0.20% 123 26424 0.20% 124 27895 0.21% 125 28836 0.22% 126 30061 0.23% 127 31547 0.24% 128 32380 0.25% 129 33951 0.26% 130 35382 0.27% 131 36985 0.28% 132 38582 0.30% 133 40243 0.31% 134 42341 0.33% 135 44331 0.34% 136 46705 0.36% 137 48463 0.37% 138 50728 0.39% 139 54167 0.42% 140 57784 0.44% 141 61789 0.47% 142 67143 0.52% 143 73826 0.57% 144 83191 0.64% 145 95906 0.74% 146 116242 0.89% 147 151991 1.17% 148 227733 1.75% 149 445783 3.43% 150 2747693 21.11% 151 7804501 59.97% 13014966 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=44.37 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=14.7 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=19 prefix-density=0.40 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=19.70 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172706 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:11:36 Started mapping on | Feb 10 14:11:36 Finished on | Feb 10 14:13:42 Mapping speed, Million of reads per hour | 371.86 Number of input reads | 13014966 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12225910 Uniquely mapped reads % | 93.94% Average mapped length | 295.42 Number of splices: Total | 12611141 Number of splices: Annotated (sjdb) | 12405849 Number of splices: GT/AG | 12412128 Number of splices: GC/AG | 160183 Number of splices: AT/AC | 9834 Number of splices: Non-canonical | 28996 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348117 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 35283 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455414 455414 455414 N_multimapping 348117 348117 348117 N_noFeature 258592 12121050 307621 N_ambiguous 111684 751 55302 UnstrandedReadsAssigned:11855634 PositiveStrandReadsAssigned:104109 NegativeStrandReadsAssigned:11862987 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172706 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172706-trimmed-pair1.fastq SRR7172706-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,014,966 reads, 11,800,047 reads pseudoaligned [quant] estimated average fragment length: 239.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7172706.ke.tsv 34699 SRR7172706.se.tsv 87100 total ==> SRR7172706.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.39 1033 49.1077 Potri.005G024800.1.v4.1 1035 796.389 484 51.4091 Potri.004G059700.1.v4.1 961 722.423 56 6.55717 Potri.007G009000.2.v4.1 1416 1177.39 0 0 Potri.003G141000.2.v4.1 2943 2704.39 457 14.2944 Potri.016G087400.1.v4.1 270 79.8576 1065 1128.12 Potri.015G069301.1.v4.1 564 329.262 0 0 Potri.010G195200.1.v4.1 1773 1534.39 197 10.8605 Potri.012G127500.1.v4.1 977 738.423 1622 185.809 ==> SRR7172706.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 129 SRR7172706 completed mapping pipeline successfully