Starting /dee2/code/volunteer_pipeline.sh SRR7172707 current disk space = 3059111329792 free memory = 1520429652 SRR7172707 SRAfilesize 42bb9dcdbcd08c69f3b753edf0b3cb21 SRR7172707.sra SRR7172707.sra file validated SRR7172707 is paired end SRR7172707 is conventional basespace SRR7172707 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172707_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.216 33.0 33.0 34.0 32.0 34.0 2 32.65 33.0 33.0 34.0 32.0 34.0 3 32.88075 33.0 33.0 34.0 32.0 34.0 4 32.622 33.0 33.0 34.0 31.0 34.0 5 32.891 33.0 33.0 34.0 32.0 34.0 6 37.166 38.0 38.0 38.0 36.0 38.0 7 37.4625 38.0 38.0 38.0 37.0 38.0 8 37.5595 38.0 38.0 38.0 38.0 38.0 9 37.55275 38.0 38.0 38.0 38.0 38.0 10-14 37.60325 38.0 38.0 38.0 38.0 38.0 15-19 37.63175 38.0 38.0 38.0 38.0 38.0 20-24 37.574799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.6177 38.0 38.0 38.0 38.0 38.0 30-34 37.566449999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.557750000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.468250000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.46825 38.0 38.0 38.0 38.0 38.0 50-54 37.40815 38.0 38.0 38.0 37.4 38.0 55-59 37.27445 38.0 38.0 38.0 36.8 38.0 60-64 37.249 38.0 38.0 38.0 37.0 38.0 65-69 37.19235 38.0 38.0 38.0 37.0 38.0 70-74 37.0672 38.0 38.0 38.0 36.2 38.0 75-79 37.049249999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.94885000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.63655 38.0 38.0 38.0 34.6 38.0 90-94 36.79605 38.0 38.0 38.0 35.6 38.0 95-99 36.7759 38.0 38.0 38.0 35.4 38.0 100-104 36.6072 38.0 38.0 38.0 34.8 38.0 105-109 36.15775 38.0 38.0 38.0 33.6 38.0 110-114 36.003949999999996 38.0 37.6 38.0 32.6 38.0 115-119 36.03595 38.0 37.4 38.0 33.0 38.0 120-124 36.1697 38.0 37.8 38.0 33.6 38.0 125-129 35.90245 38.0 37.2 38.0 32.4 38.0 130-134 35.5068 38.0 36.2 38.0 30.4 38.0 135-139 35.10245 38.0 35.8 38.0 28.8 38.0 140-144 35.212149999999994 38.0 36.0 38.0 30.4 38.0 145-149 34.8697 38.0 35.8 38.0 29.6 38.0 150-151 31.30425 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 7.0 20 1.0 21 5.0 22 1.0 23 8.0 24 7.0 25 10.0 26 15.0 27 13.0 28 19.0 29 21.0 30 37.0 31 60.0 32 65.0 33 76.0 34 144.0 35 228.0 36 581.0 37 2693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.27318932655654 13.672172808132146 12.274459974587039 38.78017789072427 2 19.42138364779874 19.471698113207548 40.0503144654088 21.056603773584907 3 18.675 27.85 24.95 28.525 4 22.45 35.775 21.8 19.975 5 21.3 36.275 25.0 17.424999999999997 6 18.325 36.125 26.525 19.025 7 12.825000000000001 22.2 45.225 19.75 8 18.975 21.625 30.9 28.499999999999996 9 18.8 21.725 33.125 26.35 10-14 19.435 29.65 27.415 23.5 15-19 19.915 28.28 27.85 23.955000000000002 20-24 19.735 28.544999999999998 28.050000000000004 23.669999999999998 25-29 19.645000000000003 29.29 27.275 23.79 30-34 19.37 28.32 28.225 24.085 35-39 20.235 28.435 27.500000000000004 23.830000000000002 40-44 20.115 28.4 27.77 23.715 45-49 19.875 28.645 28.08 23.400000000000002 50-54 19.825 28.415000000000003 27.98 23.78 55-59 19.865 28.645 27.334999999999997 24.154999999999998 60-64 20.21 28.335 27.634999999999998 23.82 65-69 20.655 28.265 27.589999999999996 23.49 70-74 20.8 28.42 27.07 23.71 75-79 20.62 28.58 27.189999999999998 23.61 80-84 20.615 28.134999999999998 27.939999999999998 23.31 85-89 20.18 28.58 27.715 23.525 90-94 20.665 28.499999999999996 27.295 23.54 95-99 20.805 28.470000000000002 27.644999999999996 23.080000000000002 100-104 20.830000000000002 29.13 27.38 22.66 105-109 20.305 27.71 27.725 24.26 110-114 20.855427713856926 27.768884442221108 28.189094547273637 23.186593296648326 115-119 21.245 28.515 27.11 23.13 120-124 20.755000000000003 28.744999999999997 27.04 23.46 125-129 20.91 28.095 27.055 23.94 130-134 21.175 28.78 26.939999999999998 23.105 135-139 20.78 28.04 26.88 24.3 140-144 20.630000000000003 28.29 27.01 24.07 145-149 21.01 28.305000000000003 26.375 24.310000000000002 150-151 21.8 29.562500000000004 24.8 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.0 24 2.5 25 2.5 26 4.0 27 7.5 28 10.0 29 11.0 30 13.0 31 23.0 32 29.5 33 44.0 34 55.0 35 66.5 36 87.0 37 118.5 38 141.0 39 168.5 40 209.0 41 219.0 42 249.5 43 269.5 44 262.5 45 289.5 46 288.0 47 259.0 48 229.0 49 185.0 50 162.5 51 134.0 52 98.5 53 83.0 54 71.0 55 54.0 56 39.0 57 29.0 58 22.0 59 13.5 60 10.0 61 8.5 62 6.0 63 4.0 64 2.5 65 2.5 66 1.0 67 2.0 68 2.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.05 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11727616645649 98.25 2 0.8827238335435058 1.7500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.275 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.875 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 6.925 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172707 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172707_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.129 34.0 33.0 34.0 33.0 34.0 2 33.1885 34.0 33.0 34.0 33.0 34.0 3 33.233 34.0 33.0 34.0 33.0 34.0 4 33.18875 34.0 33.0 34.0 33.0 34.0 5 33.1645 34.0 33.0 34.0 33.0 34.0 6 37.28425 38.0 38.0 38.0 38.0 38.0 7 37.3305 38.0 38.0 38.0 38.0 38.0 8 37.30525 38.0 38.0 38.0 38.0 38.0 9 37.27125 38.0 38.0 38.0 37.0 38.0 10-14 37.2741 38.0 38.0 38.0 38.0 38.0 15-19 37.302200000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.2959 38.0 38.0 38.0 37.8 38.0 25-29 37.025 38.0 38.0 38.0 37.4 38.0 30-34 36.359049999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.64640000000001 38.0 38.0 38.0 36.0 38.0 40-44 37.10525 38.0 38.0 38.0 37.0 38.0 45-49 37.136700000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.0561 38.0 38.0 38.0 37.0 38.0 55-59 36.9347 38.0 38.0 38.0 36.4 38.0 60-64 36.830600000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.771699999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.7224 38.0 38.0 38.0 36.0 38.0 75-79 36.6434 38.0 38.0 38.0 35.4 38.0 80-84 36.705949999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.5837 38.0 38.0 38.0 35.0 38.0 90-94 36.49285 38.0 38.0 38.0 34.8 38.0 95-99 36.4538 38.0 38.0 38.0 35.0 38.0 100-104 36.3184 38.0 38.0 38.0 34.0 38.0 105-109 36.2817 38.0 38.0 38.0 34.0 38.0 110-114 36.104200000000006 38.0 38.0 38.0 33.8 38.0 115-119 35.7635 38.0 37.6 38.0 32.2 38.0 120-124 35.5893 38.0 37.2 38.0 31.8 38.0 125-129 35.3423 38.0 36.6 38.0 30.6 38.0 130-134 35.0292 38.0 36.0 38.0 28.2 38.0 135-139 34.7947 38.0 36.0 38.0 28.0 38.0 140-144 34.074250000000006 38.0 34.6 38.0 23.6 38.0 145-149 33.167950000000005 38.0 33.0 38.0 17.8 38.0 150-151 28.816499999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 2.0 6 3.0 7 2.0 8 1.0 9 2.0 10 3.0 11 6.0 12 2.0 13 2.0 14 1.0 15 2.0 16 7.0 17 2.0 18 4.0 19 4.0 20 6.0 21 8.0 22 10.0 23 10.0 24 10.0 25 10.0 26 21.0 27 19.0 28 31.0 29 35.0 30 39.0 31 51.0 32 66.0 33 98.0 34 144.0 35 266.0 36 533.0 37 2591.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.15 16.3 15.2 31.35 2 23.65 22.1 37.175000000000004 17.075000000000003 3 20.625 25.525 32.4 21.45 4 24.65 33.074999999999996 22.225 20.05 5 23.225 36.525 22.725 17.525 6 17.224999999999998 37.225 26.125 19.425 7 18.099999999999998 15.375 44.6 21.925 8 21.025 20.7 29.475 28.799999999999997 9 21.675 24.025 29.975 24.325 10-14 22.869999999999997 28.9 26.889999999999997 21.34 15-19 22.89 28.08 27.665 21.365000000000002 20-24 22.86 28.444999999999997 27.665 21.029999999999998 25-29 23.181772457499246 28.52831707071723 27.688361331857962 20.60154913992556 30-34 22.47697031729785 28.689866939611054 28.229273285568063 20.60388945752303 35-39 22.51642243557352 28.489135927235974 27.518948964123297 21.475492673067205 40-44 22.720000000000002 28.235 28.075 20.97 45-49 22.994999999999997 27.855 27.74 21.41 50-54 23.275000000000002 28.084999999999997 27.755000000000003 20.885 55-59 22.99 27.82 28.27 20.919999999999998 60-64 23.585 27.66 27.889999999999997 20.865000000000002 65-69 23.505000000000003 27.98 27.77 20.745 70-74 23.52 27.485 27.92 21.075 75-79 23.580000000000002 28.055000000000003 27.839999999999996 20.525 80-84 24.215 27.794999999999998 27.92 20.07 85-89 23.919999999999998 27.965 27.445000000000004 20.669999999999998 90-94 23.13 28.444999999999997 28.13 20.294999999999998 95-99 24.095 27.935 27.72 20.25 100-104 23.919999999999998 28.055000000000003 27.889999999999997 20.135 105-109 23.95 27.925 28.13 19.994999999999997 110-114 23.815 28.244999999999997 27.46 20.48 115-119 24.085 28.585 27.22 20.11 120-124 23.95 27.83 27.57 20.65 125-129 24.52 27.93 27.485 20.064999999999998 130-134 24.8 28.560000000000002 27.12 19.52 135-139 25.16 28.694999999999997 26.790000000000003 19.355 140-144 24.705 28.62 27.565 19.11 145-149 25.525 27.705000000000002 26.55 20.22 150-151 25.362499999999997 28.299999999999997 26.900000000000002 19.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 3.5 27 4.0 28 3.0 29 5.5 30 14.5 31 17.5 32 18.0 33 28.5 34 46.5 35 59.0 36 78.0 37 105.0 38 127.5 39 185.5 40 233.5 41 240.5 42 263.5 43 290.5 44 281.5 45 274.5 46 268.0 47 256.0 48 235.0 49 193.5 50 163.5 51 140.5 52 115.5 53 90.0 54 68.0 55 46.0 56 32.0 57 20.5 58 17.0 59 15.0 60 11.5 61 13.5 62 9.5 63 6.0 64 4.5 65 3.5 66 2.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.59 30-34 2.3 35-39 1.05 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.050000000000001 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.925 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 8.1 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTCTG 10 0.006867937 144.7375 3 GACTGGT 10 0.006867937 144.7375 145 CAGATCT 10 0.006867937 144.7375 3 AGATCTA 10 0.006867937 144.7375 4 AAAAAAA 40 0.007735456 18.092186 105-109 >>END_MODULE Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra Read 686916 spots for SRR7172707.sra Written 686916 spots for SRR7172707.sra Read 686906 spots for SRR7172707.sra Written 686906 spots for SRR7172707.sra SRR ids: ['SRR7172707.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aoj2b84g SRR7172707.sra spots: 13738130 blocks: [[1, 686906], [686907, 1373812], [1373813, 2060718], [2060719, 2747624], [2747625, 3434530], [3434531, 4121436], [4121437, 4808342], [4808343, 5495248], [5495249, 6182154], [6182155, 6869060], [6869061, 7555966], [7555967, 8242872], [8242873, 8929778], [8929779, 9616684], [9616685, 10303590], [10303591, 10990496], [10990497, 11677402], [11677403, 12364308], [12364309, 13051214], [13051215, 13738130]] SRR7172707 file size 4633701 SRR7172707 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172707 SRR7172707_1.fastq SRR7172707_2.fastq Input file: SRR7172707_1.fastq Paired file: SRR7172707_2.fastq trimmed: SRR7172707-trimmed-pair1.fastq, SRR7172707-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:19:43 2025 >> started Mon Feb 10 15:19:58 2025 >> done (15.248s) 13738130 read pairs processed; of these: 11637 ( 0.08%) short read pairs filtered out after trimming by size control 10704 ( 0.08%) empty read pairs filtered out after trimming by size control 13715789 (99.84%) read pairs available; of these: 7185641 (52.39%) trimmed read pairs available after processing 6530148 (47.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 0 0.00% 25 4 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 1 0.00% 36 5 0.00% 37 8 0.00% 38 7 0.00% 39 9 0.00% 40 7 0.00% 41 12 0.00% 42 7 0.00% 43 11 0.00% 44 3 0.00% 45 6 0.00% 46 22 0.00% 47 21 0.00% 48 32 0.00% 49 16 0.00% 50 31 0.00% 51 36 0.00% 52 56 0.00% 53 36 0.00% 54 65 0.00% 55 56 0.00% 56 86 0.00% 57 86 0.00% 58 101 0.00% 59 129 0.00% 60 117 0.00% 61 140 0.00% 62 161 0.00% 63 205 0.00% 64 233 0.00% 65 277 0.00% 66 270 0.00% 67 348 0.00% 68 364 0.00% 69 441 0.00% 70 526 0.00% 71 559 0.00% 72 680 0.00% 73 779 0.01% 74 925 0.01% 75 1010 0.01% 76 1149 0.01% 77 1289 0.01% 78 1445 0.01% 79 1626 0.01% 80 1911 0.01% 81 2205 0.02% 82 2516 0.02% 83 2899 0.02% 84 3846 0.03% 85 4484 0.03% 86 4817 0.04% 87 5289 0.04% 88 5789 0.04% 89 6094 0.04% 90 6444 0.05% 91 7246 0.05% 92 8007 0.06% 93 8743 0.06% 94 9640 0.07% 95 10066 0.07% 96 10868 0.08% 97 11334 0.08% 98 12249 0.09% 99 13071 0.10% 100 14057 0.10% 101 14966 0.11% 102 16052 0.12% 103 16909 0.12% 104 18149 0.13% 105 19622 0.14% 106 20482 0.15% 107 21537 0.16% 108 22293 0.16% 109 23266 0.17% 110 24103 0.18% 111 25574 0.19% 112 26539 0.19% 113 27887 0.20% 114 29157 0.21% 115 30433 0.22% 116 31873 0.23% 117 32581 0.24% 118 33734 0.25% 119 34633 0.25% 120 35747 0.26% 121 37537 0.27% 122 38212 0.28% 123 40091 0.29% 124 41796 0.30% 125 42439 0.31% 126 44413 0.32% 127 46016 0.34% 128 46836 0.34% 129 48036 0.35% 130 49840 0.36% 131 51106 0.37% 132 53236 0.39% 133 55790 0.41% 134 57420 0.42% 135 60032 0.44% 136 62791 0.46% 137 65449 0.48% 138 68167 0.50% 139 72113 0.53% 140 75540 0.55% 141 81339 0.59% 142 87686 0.64% 143 95504 0.70% 144 107411 0.78% 145 123464 0.90% 146 150078 1.09% 147 195148 1.42% 148 296764 2.16% 149 672954 4.91% 150 3647901 26.60% 151 6530148 47.61% 13715789 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.98 fanout-score-rank=25 prefix-density=0.21 prefix-fanout=4.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=498.09 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=35.0 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=38 prefix-density=0.25 prefix-fanout=2.3 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=428.79 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=33.1 sequence=AAGAAGAAGAAA SRR7172707 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:20:43 Started mapping on | Feb 10 15:20:43 Finished on | Feb 10 15:22:23 Mapping speed, Million of reads per hour | 493.77 Number of input reads | 13715789 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12981022 Uniquely mapped reads % | 94.64% Average mapped length | 292.60 Number of splices: Total | 13090368 Number of splices: Annotated (sjdb) | 12859644 Number of splices: GT/AG | 12881569 Number of splices: GC/AG | 165071 Number of splices: AT/AC | 9865 Number of splices: Non-canonical | 33863 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323852 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 69057 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 421234 421234 421234 N_multimapping 323852 323852 323852 N_noFeature 359907 12870583 411833 N_ambiguous 122734 1008 63592 UnstrandedReadsAssigned:12498381 PositiveStrandReadsAssigned:109431 NegativeStrandReadsAssigned:12505597 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172707 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172707-trimmed-pair1.fastq SRR7172707-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,715,789 reads, 12,467,260 reads pseudoaligned [quant] estimated average fragment length: 225.913 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7172707.ke.tsv 34699 SRR7172707.se.tsv 87100 total ==> SRR7172707.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.09 1117 52.9622 Potri.005G024800.1.v4.1 1035 810.087 209 21.9345 Potri.004G059700.1.v4.1 961 736.094 99 11.4345 Potri.007G009000.2.v4.1 1416 1191.09 0 0 Potri.003G141000.2.v4.1 2943 2718.09 411.146 12.8602 Potri.016G087400.1.v4.1 270 87.8519 832 805.168 Potri.015G069301.1.v4.1 564 342.367 0 0 Potri.010G195200.1.v4.1 1773 1548.09 157.708 8.66106 Potri.012G127500.1.v4.1 977 752.094 7438 840.811 ==> SRR7172707.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 244 SRR7172707 completed mapping pipeline successfully