Starting /dee2/code/volunteer_pipeline.sh SRR7172708 current disk space = 3059048574976 free memory = 1152629644 SRR7172708 SRAfilesize 55cc464c6d33a37406d2eba69493262b SRR7172708.sra SRR7172708.sra file validated SRR7172708 is paired end SRR7172708 is conventional basespace SRR7172708 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172708_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94725 33.0 33.0 34.0 31.0 34.0 2 32.58075 33.0 33.0 34.0 32.0 34.0 3 32.84275 33.0 33.0 34.0 32.0 34.0 4 32.92225 34.0 33.0 34.0 31.0 34.0 5 32.9985 34.0 33.0 34.0 32.0 34.0 6 37.11075 38.0 38.0 38.0 36.0 38.0 7 37.4935 38.0 38.0 38.0 37.0 38.0 8 37.52875 38.0 38.0 38.0 38.0 38.0 9 37.61825 38.0 38.0 38.0 38.0 38.0 10-14 37.623599999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.645849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.56935 38.0 38.0 38.0 38.0 38.0 25-29 37.61855 38.0 38.0 38.0 38.0 38.0 30-34 37.5674 38.0 38.0 38.0 38.0 38.0 35-39 37.54825 38.0 38.0 38.0 38.0 38.0 40-44 37.474900000000005 38.0 38.0 38.0 37.8 38.0 45-49 37.47 38.0 38.0 38.0 38.0 38.0 50-54 37.39209999999999 38.0 38.0 38.0 37.2 38.0 55-59 37.28985000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.2511 38.0 38.0 38.0 37.0 38.0 65-69 37.2383 38.0 38.0 38.0 37.0 38.0 70-74 37.13415 38.0 38.0 38.0 36.2 38.0 75-79 37.049350000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.0176 38.0 38.0 38.0 36.0 38.0 85-89 36.7255 38.0 38.0 38.0 35.2 38.0 90-94 36.8591 38.0 38.0 38.0 35.6 38.0 95-99 36.831149999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.66145 38.0 38.0 38.0 34.8 38.0 105-109 36.303700000000006 38.0 38.0 38.0 33.6 38.0 110-114 36.20975 38.0 37.8 38.0 33.4 38.0 115-119 36.1769 38.0 37.2 38.0 33.6 38.0 120-124 36.28745 38.0 38.0 38.0 34.0 38.0 125-129 36.0644 38.0 37.4 38.0 33.4 38.0 130-134 35.5986 38.0 36.2 38.0 30.8 38.0 135-139 35.1697 38.0 36.0 38.0 28.6 38.0 140-144 35.257149999999996 38.0 36.0 38.0 30.2 38.0 145-149 35.0415 38.0 36.0 38.0 30.6 38.0 150-151 31.455375 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 1.0 20 1.0 21 1.0 22 7.0 23 4.0 24 3.0 25 10.0 26 16.0 27 22.0 28 17.0 29 32.0 30 32.0 31 40.0 32 73.0 33 85.0 34 125.0 35 234.0 36 534.0 37 2755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.08188331627431 13.63868986693961 12.154554759467759 39.12487205731832 2 21.085699924604175 20.65845689871827 36.96908771048002 21.286755466197537 3 18.6 24.9 26.400000000000002 30.099999999999998 4 22.725 33.975 21.9 21.4 5 22.025 36.65 22.95 18.375 6 16.8 36.475 26.075 20.65 7 13.975000000000001 20.7 46.650000000000006 18.675 8 18.0 22.15 30.25 29.599999999999998 9 18.099999999999998 23.375 33.550000000000004 24.975 10-14 19.725 29.054999999999996 27.029999999999998 24.19 15-19 20.21 28.265 27.98 23.544999999999998 20-24 20.02 27.825 28.48 23.674999999999997 25-29 20.06 28.215 28.09 23.635 30-34 19.935 28.43 27.744999999999997 23.89 35-39 20.31 28.325 27.555000000000003 23.810000000000002 40-44 19.98 28.265 28.410000000000004 23.345 45-49 20.395 28.07 27.560000000000002 23.974999999999998 50-54 20.94 28.560000000000002 27.165 23.335 55-59 20.54 28.725 27.33 23.405 60-64 20.125 28.4 27.065 24.41 65-69 19.73 28.48 27.57 24.22 70-74 20.765 28.055000000000003 27.589999999999996 23.59 75-79 19.915 28.51 27.534999999999997 24.04 80-84 20.59 28.04 27.534999999999997 23.835 85-89 20.560000000000002 28.185 27.650000000000002 23.605 90-94 20.68 28.21 27.82 23.29 95-99 20.865000000000002 28.299999999999997 27.229999999999997 23.605 100-104 20.515 27.735 28.08 23.669999999999998 105-109 20.79 28.51 27.165 23.535 110-114 20.8008008008008 27.87787787787788 27.642642642642645 23.67867867867868 115-119 20.4 28.02 27.785 23.794999999999998 120-124 20.93 27.865000000000002 27.48 23.724999999999998 125-129 20.705000000000002 27.92 27.715 23.66 130-134 20.36 27.295 27.825 24.52 135-139 20.849999999999998 28.22 27.205000000000002 23.724999999999998 140-144 21.685 27.395000000000003 27.229999999999997 23.69 145-149 20.95 27.36 27.894999999999996 23.794999999999998 150-151 20.849999999999998 28.599999999999998 26.224999999999998 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 1.5 25 2.0 26 2.5 27 2.5 28 5.0 29 4.5 30 8.5 31 14.0 32 22.5 33 38.0 34 49.5 35 57.0 36 78.0 37 108.0 38 144.5 39 172.5 40 176.5 41 214.5 42 276.0 43 299.5 44 292.0 45 293.0 46 272.5 47 252.0 48 238.5 49 211.0 50 171.0 51 134.5 52 113.5 53 90.5 54 66.5 55 45.0 56 32.5 57 24.5 58 22.5 59 15.0 60 8.5 61 8.5 62 8.5 63 4.0 64 3.0 65 2.0 66 1.0 67 1.5 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.1 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.9749999999999999 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4875 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGGA 10 0.0063413354 148.60257 1 GTGAACA 10 0.0063413354 148.60257 1 >>END_MODULE SRR7172708 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172708_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11575 34.0 33.0 34.0 33.0 34.0 2 33.24975 34.0 33.0 34.0 33.0 34.0 3 33.242 34.0 33.0 34.0 33.0 34.0 4 33.22 34.0 33.0 34.0 33.0 34.0 5 33.24425 34.0 33.0 34.0 33.0 34.0 6 37.44275 38.0 38.0 38.0 38.0 38.0 7 37.43725 38.0 38.0 38.0 38.0 38.0 8 37.44075 38.0 38.0 38.0 38.0 38.0 9 37.31 38.0 38.0 38.0 38.0 38.0 10-14 37.3504 38.0 38.0 38.0 38.0 38.0 15-19 37.37995 38.0 38.0 38.0 38.0 38.0 20-24 37.303250000000006 38.0 38.0 38.0 38.0 38.0 25-29 36.98255 38.0 38.0 38.0 37.4 38.0 30-34 36.241600000000005 38.0 38.0 38.0 36.4 38.0 35-39 36.5635 38.0 38.0 38.0 36.0 38.0 40-44 37.2233 38.0 38.0 38.0 37.2 38.0 45-49 37.20515 38.0 38.0 38.0 37.0 38.0 50-54 37.17 38.0 38.0 38.0 37.0 38.0 55-59 37.066849999999995 38.0 38.0 38.0 36.6 38.0 60-64 36.935199999999995 38.0 38.0 38.0 36.4 38.0 65-69 36.90645 38.0 38.0 38.0 36.0 38.0 70-74 36.88955 38.0 38.0 38.0 36.0 38.0 75-79 36.78895 38.0 38.0 38.0 35.8 38.0 80-84 36.849599999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.79045 38.0 38.0 38.0 36.0 38.0 90-94 36.6061 38.0 38.0 38.0 35.0 38.0 95-99 36.55045 38.0 38.0 38.0 35.0 38.0 100-104 36.5021 38.0 38.0 38.0 34.8 38.0 105-109 36.442449999999994 38.0 38.0 38.0 34.2 38.0 110-114 36.24435 38.0 38.0 38.0 34.0 38.0 115-119 36.01950000000001 38.0 38.0 38.0 33.4 38.0 120-124 35.818200000000004 38.0 37.4 38.0 32.2 38.0 125-129 35.591300000000004 38.0 36.8 38.0 31.6 38.0 130-134 35.31 38.0 36.2 38.0 30.6 38.0 135-139 35.1519 38.0 36.0 38.0 30.4 38.0 140-144 34.6122 38.0 35.6 38.0 27.4 38.0 145-149 33.74275 38.0 33.2 38.0 23.8 38.0 150-151 29.513 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 3.0 5 0.0 6 0.0 7 5.0 8 0.0 9 1.0 10 2.0 11 3.0 12 2.0 13 1.0 14 4.0 15 4.0 16 3.0 17 2.0 18 3.0 19 1.0 20 3.0 21 4.0 22 10.0 23 7.0 24 14.0 25 17.0 26 16.0 27 18.0 28 26.0 29 29.0 30 31.0 31 36.0 32 71.0 33 96.0 34 166.0 35 256.0 36 510.0 37 2651.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.35 15.425 15.2 33.025 2 23.825 23.425 36.475 16.275000000000002 3 21.2 26.8 29.9 22.1 4 23.3 35.275 20.875 20.549999999999997 5 22.875 36.449999999999996 22.85 17.825 6 18.05 39.025 23.575 19.35 7 18.55 18.05 42.225 21.175 8 21.725 21.8 28.349999999999998 28.125 9 22.900000000000002 24.6 29.15 23.35 10-14 22.935 29.24 25.775 22.05 15-19 22.755 28.17 27.284999999999997 21.790000000000003 20-24 22.57 27.76 27.66 22.009999999999998 25-29 22.807725278604206 28.24365891785588 27.65367354142504 21.294942262114873 30-34 23.500952184878273 28.874363065520615 26.68691131813269 20.937773431468422 35-39 23.037923342121275 28.15351855607382 27.479213141350638 21.329344960454268 40-44 22.91 27.875 27.800000000000004 21.415 45-49 23.435 28.025 27.855 20.685000000000002 50-54 23.275000000000002 28.58 27.37 20.775 55-59 23.47 27.944999999999997 27.139999999999997 21.445 60-64 23.799999999999997 28.115000000000002 27.605 20.48 65-69 22.98 28.244999999999997 27.415 21.36 70-74 23.724999999999998 28.065 27.544999999999998 20.665 75-79 23.395 27.985 28.005000000000003 20.615 80-84 23.06 28.134999999999998 27.41 21.395 85-89 24.060000000000002 27.905 27.529999999999998 20.505000000000003 90-94 23.18 27.685 28.07 21.065 95-99 23.265 27.715 28.24 20.78 100-104 23.315 27.83 27.944999999999997 20.91 105-109 23.315 28.315 27.54 20.830000000000002 110-114 23.715 27.875 27.77 20.64 115-119 24.02 28.155 27.345000000000002 20.48 120-124 24.43 28.475 27.029999999999998 20.064999999999998 125-129 24.395 27.505000000000003 27.544999999999998 20.555 130-134 24.46 28.275 26.995 20.27 135-139 24.709999999999997 27.71 26.919999999999998 20.66 140-144 24.295 28.055000000000003 27.365000000000002 20.285 145-149 24.825 28.02 27.22 19.935 150-151 24.05 27.9125 28.225 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 3.0 29 7.0 30 11.0 31 10.5 32 16.5 33 30.0 34 41.0 35 52.0 36 72.0 37 101.0 38 132.5 39 163.5 40 196.5 41 219.0 42 261.0 43 297.5 44 301.5 45 313.0 46 295.0 47 260.0 48 231.5 49 214.0 50 185.0 51 133.0 52 105.0 53 95.0 54 72.0 55 48.0 56 36.0 57 23.5 58 12.5 59 9.5 60 12.5 61 12.5 62 7.5 63 4.0 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.845 30-34 2.855 35-39 1.38 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 2.025 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.5374999999999996 0.0 0.0 0.0 0.0 132-133 2.8499999999999996 0.0 0.0 0.0 0.0 134-135 3.125 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.8625000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712752 spots for SRR7172708.sra Written 712752 spots for SRR7172708.sra Read 712761 spots for SRR7172708.sra Written 712761 spots for SRR7172708.sra SRR ids: ['SRR7172708.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4p0ryx1q SRR7172708.sra spots: 14255049 blocks: [[1, 712752], [712753, 1425504], [1425505, 2138256], [2138257, 2851008], [2851009, 3563760], [3563761, 4276512], [4276513, 4989264], [4989265, 5702016], [5702017, 6414768], [6414769, 7127520], [7127521, 7840272], [7840273, 8553024], [8553025, 9265776], [9265777, 9978528], [9978529, 10691280], [10691281, 11404032], [11404033, 12116784], [12116785, 12829536], [12829537, 13542288], [13542289, 14255049]] SRR7172708 file size 4808867 SRR7172708 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172708 SRR7172708_1.fastq SRR7172708_2.fastq Input file: SRR7172708_1.fastq Paired file: SRR7172708_2.fastq trimmed: SRR7172708-trimmed-pair1.fastq, SRR7172708-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:36:52 2025 >> started Mon Feb 10 14:37:08 2025 >> done (16.087s) 14255049 read pairs processed; of these: 9270 ( 0.07%) short read pairs filtered out after trimming by size control 8134 ( 0.06%) empty read pairs filtered out after trimming by size control 14237645 (99.88%) read pairs available; of these: 6860502 (48.19%) trimmed read pairs available after processing 7377143 (51.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 6 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 1 0.00% 25 4 0.00% 26 6 0.00% 27 1 0.00% 28 0 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 4 0.00% 35 1 0.00% 36 3 0.00% 37 2 0.00% 38 1 0.00% 39 2 0.00% 40 3 0.00% 41 4 0.00% 42 5 0.00% 43 3 0.00% 44 5 0.00% 45 7 0.00% 46 9 0.00% 47 8 0.00% 48 19 0.00% 49 10 0.00% 50 9 0.00% 51 14 0.00% 52 19 0.00% 53 15 0.00% 54 20 0.00% 55 26 0.00% 56 19 0.00% 57 27 0.00% 58 18 0.00% 59 22 0.00% 60 43 0.00% 61 53 0.00% 62 37 0.00% 63 48 0.00% 64 80 0.00% 65 73 0.00% 66 71 0.00% 67 82 0.00% 68 126 0.00% 69 129 0.00% 70 119 0.00% 71 164 0.00% 72 164 0.00% 73 217 0.00% 74 243 0.00% 75 251 0.00% 76 311 0.00% 77 413 0.00% 78 401 0.00% 79 485 0.00% 80 558 0.00% 81 648 0.00% 82 731 0.01% 83 947 0.01% 84 1464 0.01% 85 1879 0.01% 86 1944 0.01% 87 2145 0.02% 88 2248 0.02% 89 2499 0.02% 90 2575 0.02% 91 2733 0.02% 92 2972 0.02% 93 3239 0.02% 94 3452 0.02% 95 3756 0.03% 96 4154 0.03% 97 4326 0.03% 98 4658 0.03% 99 4983 0.03% 100 5534 0.04% 101 5846 0.04% 102 6390 0.04% 103 6858 0.05% 104 7420 0.05% 105 7997 0.06% 106 8461 0.06% 107 9154 0.06% 108 9521 0.07% 109 9952 0.07% 110 10575 0.07% 111 11247 0.08% 112 12121 0.09% 113 12934 0.09% 114 13911 0.10% 115 14644 0.10% 116 15540 0.11% 117 16458 0.12% 118 17090 0.12% 119 17469 0.12% 120 18429 0.13% 121 19647 0.14% 122 20795 0.15% 123 21901 0.15% 124 23151 0.16% 125 24500 0.17% 126 25684 0.18% 127 26937 0.19% 128 27915 0.20% 129 29362 0.21% 130 30914 0.22% 131 32256 0.23% 132 34396 0.24% 133 36668 0.26% 134 39108 0.27% 135 41488 0.29% 136 44645 0.31% 137 47252 0.33% 138 50910 0.36% 139 54865 0.39% 140 59093 0.42% 141 65195 0.46% 142 72573 0.51% 143 81695 0.57% 144 94132 0.66% 145 112642 0.79% 146 141526 0.99% 147 190875 1.34% 148 305017 2.14% 149 725367 5.09% 150 4086709 28.70% 151 7377143 51.81% 14237645 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=391.57 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=35.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.6 sequence=TACAACATCCAGAAGGAGTCCACCCTCCACTTGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=275.98 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.4 sequence=AGAAGAAGAGAGG SRR7172708 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:37:58 Started mapping on | Feb 10 14:37:59 Finished on | Feb 10 14:39:30 Mapping speed, Million of reads per hour | 563.25 Number of input reads | 14237645 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13531095 Uniquely mapped reads % | 95.04% Average mapped length | 296.39 Number of splices: Total | 14446027 Number of splices: Annotated (sjdb) | 14228217 Number of splices: GT/AG | 14225202 Number of splices: GC/AG | 180354 Number of splices: AT/AC | 10379 Number of splices: Non-canonical | 30092 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397310 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 41951 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.81% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 319172 319172 319172 N_multimapping 397310 397310 397310 N_noFeature 268193 13409377 322714 N_ambiguous 127026 766 59351 UnstrandedReadsAssigned:13135876 PositiveStrandReadsAssigned:120952 NegativeStrandReadsAssigned:13149030 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172708 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172708-trimmed-pair1.fastq SRR7172708-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,237,645 reads, 13,078,819 reads pseudoaligned [quant] estimated average fragment length: 246.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7172708.ke.tsv 34699 SRR7172708.se.tsv 87100 total ==> SRR7172708.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.21 975 40.0955 Potri.005G024800.1.v4.1 1035 789.214 392 36.1991 Potri.004G059700.1.v4.1 961 715.229 88 8.96695 Potri.007G009000.2.v4.1 1416 1170.21 0 0 Potri.003G141000.2.v4.1 2943 2697.21 337 9.10587 Potri.016G087400.1.v4.1 270 74.3406 1106 1084.27 Potri.015G069301.1.v4.1 564 322.01 0 0 Potri.010G195200.1.v4.1 1773 1527.21 111 5.297 Potri.012G127500.1.v4.1 977 731.222 1890 188.373 ==> SRR7172708.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 186 SRR7172708 completed mapping pipeline successfully