Starting /dee2/code/volunteer_pipeline.sh SRR7172709 current disk space = 3059095232512 free memory = 1400133664 SRR7172709 SRAfilesize 4fad6f07719f2987eb160acb0eba87ec SRR7172709.sra SRR7172709.sra file validated SRR7172709 is paired end SRR7172709 is conventional basespace SRR7172709 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.5075 28.0 18.0 32.0 18.0 33.0 2 28.17075 29.0 27.0 33.0 18.0 33.0 3 30.299 31.0 29.0 33.0 27.0 33.0 4 31.36625 33.0 31.0 33.0 29.0 33.0 5 32.19375 33.0 33.0 33.0 30.0 34.0 6 36.94825 38.0 37.0 38.0 35.0 38.0 7 37.36425 38.0 38.0 38.0 37.0 38.0 8 37.42275 38.0 38.0 38.0 37.0 38.0 9 37.604 38.0 38.0 38.0 38.0 38.0 10-14 37.592999999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.55485 38.0 38.0 38.0 38.0 38.0 20-24 37.5128 38.0 38.0 38.0 37.8 38.0 25-29 37.5618 38.0 38.0 38.0 38.0 38.0 30-34 37.51475 38.0 38.0 38.0 38.0 38.0 35-39 37.4884 38.0 38.0 38.0 38.0 38.0 40-44 37.43845 38.0 38.0 38.0 37.4 38.0 45-49 37.27395 38.0 38.0 38.0 37.0 38.0 50-54 37.36715 38.0 38.0 38.0 37.0 38.0 55-59 37.25835 38.0 38.0 38.0 37.0 38.0 60-64 37.1755 38.0 38.0 38.0 36.6 38.0 65-69 37.13975 38.0 38.0 38.0 36.2 38.0 70-74 37.1783 38.0 38.0 38.0 36.2 38.0 75-79 37.041 38.0 38.0 38.0 36.0 38.0 80-84 36.9248 38.0 38.0 38.0 36.0 38.0 85-89 36.72435 38.0 38.0 38.0 34.6 38.0 90-94 36.864599999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.8035 38.0 38.0 38.0 35.0 38.0 100-104 36.74455 38.0 38.0 38.0 35.0 38.0 105-109 36.32835 38.0 38.0 38.0 33.6 38.0 110-114 36.30050000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.325 38.0 37.8 38.0 33.8 38.0 120-124 36.25455 38.0 38.0 38.0 33.8 38.0 125-129 35.83925 38.0 36.8 38.0 31.8 38.0 130-134 35.3295 38.0 36.0 38.0 29.4 38.0 135-139 35.064 38.0 35.6 38.0 28.2 38.0 140-144 35.03959999999999 38.0 35.4 38.0 28.0 38.0 145-149 34.6199 38.0 35.0 38.0 27.4 38.0 150-151 30.779125 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 1.0 17 1.0 18 3.0 19 4.0 20 3.0 21 4.0 22 4.0 23 7.0 24 4.0 25 5.0 26 14.0 27 14.0 28 21.0 29 25.0 30 38.0 31 55.0 32 63.0 33 115.0 34 131.0 35 297.0 36 665.0 37 2521.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.4862361718549 14.046822742474916 13.146385387188062 42.320555698482124 2 18.483174284279258 21.62230035158212 37.594173782019084 22.30035158211954 3 19.55 24.55 26.075 29.825000000000003 4 22.35 32.0 20.875 24.775 5 20.925 34.699999999999996 25.15 19.225 6 17.424999999999997 37.5 25.575 19.5 7 13.8 22.8 42.575 20.825 8 18.45 24.349999999999998 31.125000000000004 26.075 9 17.95 23.799999999999997 32.15 26.1 10-14 19.29 30.154999999999998 27.075 23.48 15-19 19.375 28.560000000000002 28.065 24.0 20-24 19.43 29.73 27.67 23.169999999999998 25-29 19.715 29.104999999999997 28.025 23.155 30-34 19.695 28.7 27.544999999999998 24.060000000000002 35-39 19.814999999999998 28.549999999999997 27.785 23.849999999999998 40-44 19.775000000000002 29.035 27.694999999999997 23.494999999999997 45-49 19.88 28.15 27.92 24.05 50-54 19.905 28.694999999999997 27.875 23.525 55-59 19.905 28.7 27.93 23.465 60-64 19.945 29.225 27.125 23.705000000000002 65-69 19.439999999999998 28.549999999999997 27.825 24.185000000000002 70-74 20.01 28.93 27.105 23.955000000000002 75-79 19.78 28.215 27.87 24.135 80-84 19.935 28.37 27.955000000000002 23.74 85-89 20.89 28.59 27.47 23.05 90-94 20.28 28.134999999999998 27.72 23.865 95-99 20.155 27.83 27.955000000000002 24.060000000000002 100-104 20.28 28.294999999999998 27.565 23.86 105-109 20.095 28.494999999999997 27.83 23.580000000000002 110-114 20.435 27.72 27.944999999999997 23.9 115-119 20.044999999999998 28.165000000000003 27.685 24.104999999999997 120-124 20.419999999999998 28.705000000000002 27.02 23.855 125-129 20.205000000000002 28.044999999999998 27.810000000000002 23.94 130-134 20.72 27.589999999999996 27.805000000000003 23.885 135-139 21.095 28.155 27.43 23.32 140-144 21.310000000000002 27.91 27.245 23.535 145-149 21.26 28.439999999999998 26.58 23.72 150-151 21.1125 28.325 26.2125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 2.5 23 1.5 24 1.0 25 3.5 26 6.5 27 9.0 28 13.5 29 13.0 30 17.5 31 29.5 32 30.0 33 34.5 34 55.5 35 85.5 36 98.0 37 105.0 38 151.5 39 181.5 40 192.0 41 218.5 42 249.5 43 278.0 44 278.0 45 278.0 46 264.5 47 229.0 48 224.5 49 208.0 50 170.5 51 135.5 52 105.5 53 87.5 54 62.0 55 39.5 56 31.0 57 26.0 58 19.5 59 16.5 60 14.0 61 8.5 62 4.5 63 4.0 64 4.0 65 2.5 66 0.0 67 0.5 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.3625 0.0 0.0 0.0 0.0 134-135 4.775 0.0 0.0 0.0 0.0 136-137 5.300000000000001 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172709 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172709_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12525 34.0 33.0 34.0 32.0 34.0 2 33.132 34.0 33.0 34.0 33.0 34.0 3 33.17725 34.0 33.0 34.0 33.0 34.0 4 33.15 34.0 33.0 34.0 33.0 34.0 5 33.131 34.0 33.0 34.0 33.0 34.0 6 37.195 38.0 38.0 38.0 37.0 38.0 7 37.183 38.0 38.0 38.0 37.0 38.0 8 37.1295 38.0 38.0 38.0 37.0 38.0 9 37.144 38.0 38.0 38.0 37.0 38.0 10-14 37.1464 38.0 38.0 38.0 37.0 38.0 15-19 37.2361 38.0 38.0 38.0 37.4 38.0 20-24 37.211200000000005 38.0 38.0 38.0 37.2 38.0 25-29 36.93195000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.2898 38.0 38.0 38.0 36.2 38.0 35-39 36.62335 38.0 38.0 38.0 36.0 38.0 40-44 37.055249999999994 38.0 38.0 38.0 36.8 38.0 45-49 37.02675000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.02915 38.0 38.0 38.0 37.0 38.0 55-59 36.9182 38.0 38.0 38.0 36.2 38.0 60-64 36.7907 38.0 38.0 38.0 35.8 38.0 65-69 36.583549999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.69500000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.7316 38.0 38.0 38.0 36.0 38.0 80-84 36.68645 38.0 38.0 38.0 35.4 38.0 85-89 36.53005 38.0 38.0 38.0 34.6 38.0 90-94 36.431349999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.274350000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.276300000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.069399999999995 38.0 38.0 38.0 33.6 38.0 110-114 35.74705 38.0 37.4 38.0 31.8 38.0 115-119 35.517100000000006 38.0 37.0 38.0 30.6 38.0 120-124 35.2065 38.0 36.0 38.0 28.6 38.0 125-129 35.133950000000006 38.0 36.0 38.0 28.6 38.0 130-134 34.77635 38.0 35.8 38.0 27.6 38.0 135-139 34.08669999999999 38.0 33.6 38.0 24.0 38.0 140-144 33.579150000000006 38.0 33.0 38.0 21.8 38.0 145-149 32.3224 38.0 32.8 38.0 10.8 38.0 150-151 27.305875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 2.0 5 2.0 6 1.0 7 3.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 3.0 14 4.0 15 0.0 16 8.0 17 2.0 18 3.0 19 3.0 20 8.0 21 5.0 22 6.0 23 11.0 24 14.0 25 12.0 26 17.0 27 24.0 28 35.0 29 34.0 30 54.0 31 53.0 32 75.0 33 117.0 34 185.0 35 302.0 36 665.0 37 2334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.300000000000004 15.725 18.4 31.574999999999996 2 22.475 23.1 37.6 16.825000000000003 3 20.5 25.174999999999997 32.574999999999996 21.75 4 25.124999999999996 33.35 22.85 18.675 5 25.85 34.625 22.15 17.375 6 18.0 39.050000000000004 23.549999999999997 19.400000000000002 7 19.425 16.625 42.0 21.95 8 20.825 23.1 28.475 27.6 9 23.5 24.3 28.299999999999997 23.9 10-14 23.49 28.935 26.575 21.0 15-19 23.43 28.59 27.625 20.355 20-24 23.47 28.665000000000003 27.229999999999997 20.635 25-29 23.223177908555908 28.811427996579646 26.884965544992706 21.080428549871737 30-34 22.915705867281577 28.53702280297207 27.691519344094285 20.855751985652063 35-39 23.181151726578694 27.93872288791142 27.45841549117751 21.421709894332373 40-44 23.54 27.785 27.800000000000004 20.875 45-49 23.605 28.335 27.1 20.96 50-54 23.125 28.185 27.865000000000002 20.825 55-59 23.86 27.785 27.575 20.78 60-64 23.595 28.435 27.515 20.455000000000002 65-69 23.82 28.345 27.450000000000003 20.385 70-74 22.95 28.23 27.625 21.195 75-79 23.395 27.889999999999997 28.18 20.535 80-84 23.89 27.79 27.97 20.349999999999998 85-89 23.5 28.065 27.650000000000002 20.785 90-94 23.93 28.435 27.505000000000003 20.13 95-99 23.825 28.625 27.525 20.025000000000002 100-104 24.15 28.465 27.060000000000002 20.325 105-109 24.310000000000002 27.965 27.73 19.994999999999997 110-114 24.37 27.765 27.505000000000003 20.36 115-119 24.295 28.01 27.455000000000002 20.24 120-124 24.575 28.044999999999998 27.68 19.7 125-129 24.335 27.71 27.794999999999998 20.16 130-134 23.935000000000002 28.24 28.03 19.794999999999998 135-139 24.855 28.33 27.41 19.405 140-144 25.115 28.475 27.595 18.815 145-149 25.545 28.075 26.834999999999997 19.545 150-151 25.5625 27.525 27.025 19.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 1.0 26 1.5 27 4.5 28 5.5 29 8.0 30 11.0 31 13.5 32 18.5 33 24.5 34 37.0 35 54.0 36 82.5 37 110.5 38 138.0 39 165.0 40 188.0 41 244.0 42 287.5 43 284.0 44 296.0 45 296.5 46 261.5 47 247.5 48 231.5 49 194.5 50 172.5 51 150.5 52 123.0 53 98.0 54 70.0 55 45.5 56 31.0 57 27.0 58 22.5 59 13.5 60 7.5 61 4.5 62 4.0 63 6.0 64 3.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.5950000000000001 30-34 2.4250000000000003 35-39 1.105 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.4281037522034752 0.8500000000000001 3 0.07554772097708386 0.22499999999999998 4 0.0503651473180559 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.5625 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 4.012499999999999 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.324999999999999 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACGT 10 0.0069035282 144.4875 2 TCTGTCT 10 0.0069035282 144.4875 3 AGCACTT 10 0.0069035282 144.4875 3 TGGGAGC 10 0.0069035282 144.4875 145 >>END_MODULE Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826241 spots for SRR7172709.sra Written 826241 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra Read 826239 spots for SRR7172709.sra Written 826239 spots for SRR7172709.sra SRR ids: ['SRR7172709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kwrqkxsg SRR7172709.sra spots: 16524782 blocks: [[1, 826239], [826240, 1652478], [1652479, 2478717], [2478718, 3304956], [3304957, 4131195], [4131196, 4957434], [4957435, 5783673], [5783674, 6609912], [6609913, 7436151], [7436152, 8262390], [8262391, 9088629], [9088630, 9914868], [9914869, 10741107], [10741108, 11567346], [11567347, 12393585], [12393586, 13219824], [13219825, 14046063], [14046064, 14872302], [14872303, 15698541], [15698542, 16524782]] SRR7172709 file size 5578006 SRR7172709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172709 SRR7172709_1.fastq SRR7172709_2.fastq Input file: SRR7172709_1.fastq Paired file: SRR7172709_2.fastq trimmed: SRR7172709-trimmed-pair1.fastq, SRR7172709-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:03:09 2025 >> started Mon Feb 10 15:03:36 2025 >> done (27.340s) 16524782 read pairs processed; of these: 22559 ( 0.14%) short read pairs filtered out after trimming by size control 14948 ( 0.09%) empty read pairs filtered out after trimming by size control 16487275 (99.77%) read pairs available; of these: 7612428 (46.17%) trimmed read pairs available after processing 8874847 (53.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 7 0.00% 27 5 0.00% 28 3 0.00% 29 4 0.00% 30 0 0.00% 31 7 0.00% 32 3 0.00% 33 3 0.00% 34 1 0.00% 35 4 0.00% 36 4 0.00% 37 2 0.00% 38 2 0.00% 39 7 0.00% 40 4 0.00% 41 3 0.00% 42 8 0.00% 43 6 0.00% 44 9 0.00% 45 11 0.00% 46 11 0.00% 47 11 0.00% 48 21 0.00% 49 15 0.00% 50 21 0.00% 51 25 0.00% 52 20 0.00% 53 31 0.00% 54 27 0.00% 55 39 0.00% 56 36 0.00% 57 42 0.00% 58 44 0.00% 59 68 0.00% 60 69 0.00% 61 71 0.00% 62 76 0.00% 63 93 0.00% 64 100 0.00% 65 123 0.00% 66 149 0.00% 67 139 0.00% 68 171 0.00% 69 188 0.00% 70 227 0.00% 71 312 0.00% 72 311 0.00% 73 381 0.00% 74 434 0.00% 75 547 0.00% 76 665 0.00% 77 669 0.00% 78 752 0.00% 79 828 0.01% 80 1050 0.01% 81 1158 0.01% 82 1376 0.01% 83 1587 0.01% 84 2942 0.02% 85 3746 0.02% 86 4170 0.03% 87 4567 0.03% 88 4830 0.03% 89 4902 0.03% 90 5105 0.03% 91 5379 0.03% 92 5725 0.03% 93 6094 0.04% 94 6571 0.04% 95 6875 0.04% 96 7416 0.04% 97 8039 0.05% 98 8476 0.05% 99 9250 0.06% 100 10063 0.06% 101 10433 0.06% 102 11297 0.07% 103 12488 0.08% 104 13301 0.08% 105 14407 0.09% 106 15354 0.09% 107 16421 0.10% 108 17214 0.10% 109 18573 0.11% 110 19608 0.12% 111 20386 0.12% 112 22145 0.13% 113 23021 0.14% 114 25139 0.15% 115 26516 0.16% 116 27943 0.17% 117 28746 0.17% 118 29650 0.18% 119 31555 0.19% 120 32444 0.20% 121 34164 0.21% 122 36018 0.22% 123 37582 0.23% 124 39829 0.24% 125 40862 0.25% 126 42816 0.26% 127 44998 0.27% 128 46485 0.28% 129 48688 0.30% 130 51009 0.31% 131 53250 0.32% 132 55594 0.34% 133 58345 0.35% 134 61693 0.37% 135 64831 0.39% 136 67720 0.41% 137 72475 0.44% 138 76700 0.47% 139 81534 0.49% 140 87784 0.53% 141 95201 0.58% 142 104182 0.63% 143 114644 0.70% 144 131813 0.80% 145 154112 0.93% 146 185504 1.13% 147 245576 1.49% 148 362396 2.20% 149 706067 4.28% 150 3877765 23.52% 151 8874847 53.83% 16487275 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=27 prefix-density=0.64 prefix-fanout=2.3 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=126.91 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=13.0 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=28 prefix-density=0.76 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=77.94 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=16.2 sequence=TTGGTGCTGAGA SRR7172709 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:04:32 Started mapping on | Feb 10 15:04:32 Finished on | Feb 10 15:07:18 Mapping speed, Million of reads per hour | 357.56 Number of input reads | 16487275 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15353031 Uniquely mapped reads % | 93.12% Average mapped length | 294.63 Number of splices: Total | 15486081 Number of splices: Annotated (sjdb) | 15182317 Number of splices: GT/AG | 15239191 Number of splices: GC/AG | 192372 Number of splices: AT/AC | 12885 Number of splices: Non-canonical | 41633 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404869 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 69595 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.93% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 750014 750014 750014 N_multimapping 404869 404869 404869 N_noFeature 352229 15214104 409077 N_ambiguous 155261 1103 72472 UnstrandedReadsAssigned:14845541 PositiveStrandReadsAssigned:137824 NegativeStrandReadsAssigned:14871482 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172709 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172709-trimmed-pair1.fastq SRR7172709-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,487,275 reads, 14,745,260 reads pseudoaligned [quant] estimated average fragment length: 227.623 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7172709.ke.tsv 34699 SRR7172709.se.tsv 87100 total ==> SRR7172709.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.38 1296 38.1355 Potri.005G024800.1.v4.1 1035 808.377 496 32.3429 Potri.004G059700.1.v4.1 961 734.383 26 1.86622 Potri.007G009000.2.v4.1 1416 1189.38 0 0 Potri.003G141000.2.v4.1 2943 2716.38 685 13.2927 Potri.016G087400.1.v4.1 270 80.8882 1501 978.153 Potri.015G069301.1.v4.1 564 339.53 0 0 Potri.010G195200.1.v4.1 1773 1546.38 425.832 14.5156 Potri.012G127500.1.v4.1 977 750.377 1333 93.6401 ==> SRR7172709.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 750 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 222 SRR7172709 completed mapping pipeline successfully