Starting /dee2/code/volunteer_pipeline.sh SRR7172710 current disk space = 3058660757504 free memory = 1579868584 SRR7172710 SRAfilesize 6e3769307f5e90d3b1f23185c20daa82 SRR7172710.sra SRR7172710.sra file validated SRR7172710 is paired end SRR7172710 is conventional basespace SRR7172710 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.78 25.0 18.0 32.0 18.0 33.0 2 28.4645 29.0 27.0 31.0 18.0 33.0 3 31.11 33.0 30.0 33.0 27.0 33.0 4 32.1925 33.0 33.0 33.0 30.0 34.0 5 32.194 33.0 33.0 33.0 31.0 34.0 6 37.08975 38.0 37.0 38.0 36.0 38.0 7 37.38625 38.0 38.0 38.0 37.0 38.0 8 37.501 38.0 38.0 38.0 37.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.664049999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63080000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5676 38.0 38.0 38.0 38.0 38.0 25-29 37.5655 38.0 38.0 38.0 38.0 38.0 30-34 37.55115 38.0 38.0 38.0 38.0 38.0 35-39 37.516149999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.45655000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.28445000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.3789 38.0 38.0 38.0 37.0 38.0 55-59 37.216300000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.2043 38.0 38.0 38.0 36.8 38.0 65-69 37.1734 38.0 38.0 38.0 36.8 38.0 70-74 37.18075 38.0 38.0 38.0 36.6 38.0 75-79 37.01825 38.0 38.0 38.0 36.0 38.0 80-84 36.9227 38.0 38.0 38.0 36.0 38.0 85-89 36.75595 38.0 38.0 38.0 35.4 38.0 90-94 36.8748 38.0 38.0 38.0 35.6 38.0 95-99 36.7578 38.0 38.0 38.0 34.8 38.0 100-104 36.714 38.0 38.0 38.0 34.8 38.0 105-109 36.3718 38.0 38.0 38.0 34.0 38.0 110-114 36.2498 38.0 38.0 38.0 33.8 38.0 115-119 36.3177 38.0 38.0 38.0 34.0 38.0 120-124 36.25965000000001 38.0 37.8 38.0 33.8 38.0 125-129 35.81355 38.0 36.8 38.0 31.8 38.0 130-134 35.3223 38.0 36.0 38.0 29.0 38.0 135-139 35.147000000000006 38.0 36.0 38.0 28.6 38.0 140-144 35.08035 38.0 35.6 38.0 29.4 38.0 145-149 34.7186 38.0 35.6 38.0 28.4 38.0 150-151 31.299374999999998 35.5 30.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 5.0 21 5.0 22 1.0 23 5.0 24 12.0 25 6.0 26 14.0 27 16.0 28 24.0 29 25.0 30 53.0 31 42.0 32 57.0 33 90.0 34 136.0 35 258.0 36 686.0 37 2556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.83182406209573 15.239327296248383 12.21216041397154 42.716688227684344 2 18.421052631578945 17.719298245614034 39.423558897243105 24.43609022556391 3 19.0 24.9 25.8 30.3 4 22.75 31.724999999999998 21.6 23.925 5 22.3 34.300000000000004 24.4 19.0 6 17.0 34.925 26.424999999999997 21.65 7 13.5 22.375 45.225 18.9 8 18.55 22.125 31.25 28.075 9 18.025 23.275000000000002 33.7 25.0 10-14 19.0 29.439999999999998 27.700000000000003 23.86 15-19 19.405 28.48 28.18 23.935000000000002 20-24 19.39 28.754999999999995 28.050000000000004 23.805 25-29 19.855 28.470000000000002 27.82 23.855 30-34 19.470000000000002 28.605000000000004 28.355000000000004 23.57 35-39 19.845 28.485 28.1 23.57 40-44 19.16 29.285 27.46 24.095 45-49 19.794999999999998 28.825 27.415 23.965 50-54 19.645000000000003 28.96 27.47 23.925 55-59 19.775000000000002 28.51 28.235 23.48 60-64 20.04 28.749999999999996 27.98 23.23 65-69 19.96 27.834999999999997 27.855 24.349999999999998 70-74 20.165 28.060000000000002 28.23 23.544999999999998 75-79 20.24 28.535 27.765 23.46 80-84 20.424999999999997 28.18 27.325 24.07 85-89 20.005 28.310000000000002 27.715 23.97 90-94 20.200000000000003 28.23 27.63 23.94 95-99 20.145 28.54 27.860000000000003 23.455000000000002 100-104 20.355 28.405 27.224999999999998 24.015 105-109 20.205000000000002 28.315 27.305 24.175 110-114 20.125 28.535 27.650000000000002 23.69 115-119 20.415 27.93 27.61 24.044999999999998 120-124 20.715 27.925 27.860000000000003 23.5 125-129 20.965 27.815 27.634999999999998 23.585 130-134 20.794999999999998 27.825 27.22 24.16 135-139 20.41 28.225 27.82 23.544999999999998 140-144 21.005 27.615000000000002 27.605 23.775 145-149 21.025 28.199999999999996 26.950000000000003 23.825 150-151 20.9 28.025 26.937499999999996 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 4.0 25 3.0 26 3.5 27 8.0 28 8.5 29 17.5 30 23.5 31 22.0 32 31.5 33 42.5 34 53.5 35 70.5 36 94.5 37 116.0 38 132.5 39 168.0 40 197.5 41 224.5 42 254.0 43 270.0 44 289.0 45 290.5 46 274.5 47 250.5 48 222.0 49 184.0 50 162.0 51 143.0 52 110.0 53 83.5 54 63.0 55 47.5 56 35.5 57 30.0 58 22.5 59 11.0 60 5.5 61 6.0 62 4.5 63 3.0 64 4.0 65 3.0 66 1.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1375 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.05 0.0 0.0 0.0 0.0 136-137 3.3875 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATTC 15 1.14231094E-4 144.9625 9 >>END_MODULE SRR7172710 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172710_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.207 34.0 33.0 34.0 33.0 34.0 2 33.204 34.0 33.0 34.0 33.0 34.0 3 33.234 34.0 33.0 34.0 33.0 34.0 4 33.173 34.0 33.0 34.0 33.0 34.0 5 33.235 34.0 33.0 34.0 33.0 34.0 6 37.3765 38.0 38.0 38.0 38.0 38.0 7 37.314 38.0 38.0 38.0 37.0 38.0 8 37.34075 38.0 38.0 38.0 38.0 38.0 9 37.2815 38.0 38.0 38.0 38.0 38.0 10-14 37.2413 38.0 38.0 38.0 37.2 38.0 15-19 37.29765 38.0 38.0 38.0 38.0 38.0 20-24 37.26315 38.0 38.0 38.0 37.6 38.0 25-29 36.95375 38.0 38.0 38.0 37.0 38.0 30-34 36.1727 38.0 38.0 38.0 36.2 38.0 35-39 36.54615 38.0 38.0 38.0 35.8 38.0 40-44 37.11495 38.0 38.0 38.0 36.8 38.0 45-49 37.1336 38.0 38.0 38.0 37.0 38.0 50-54 37.075 38.0 38.0 38.0 37.0 38.0 55-59 36.9856 38.0 38.0 38.0 36.6 38.0 60-64 36.8596 38.0 38.0 38.0 36.0 38.0 65-69 36.6661 38.0 38.0 38.0 35.8 38.0 70-74 36.8226 38.0 38.0 38.0 36.0 38.0 75-79 36.7519 38.0 38.0 38.0 35.8 38.0 80-84 36.71375 38.0 38.0 38.0 35.4 38.0 85-89 36.604600000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.4405 38.0 38.0 38.0 34.4 38.0 95-99 36.354400000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.2501 38.0 38.0 38.0 34.0 38.0 105-109 36.111450000000005 38.0 38.0 38.0 33.4 38.0 110-114 35.761 38.0 37.4 38.0 31.8 38.0 115-119 35.55455 38.0 36.8 38.0 30.6 38.0 120-124 35.30315 38.0 36.4 38.0 29.2 38.0 125-129 35.1544 38.0 36.2 38.0 29.4 38.0 130-134 34.70285 38.0 36.0 38.0 27.6 38.0 135-139 34.1356 38.0 34.2 38.0 24.4 38.0 140-144 33.441050000000004 38.0 33.0 38.0 20.6 38.0 145-149 32.3884 38.0 33.0 38.0 10.8 38.0 150-151 27.574624999999997 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 3.0 5 1.0 6 1.0 7 2.0 8 2.0 9 1.0 10 2.0 11 0.0 12 2.0 13 4.0 14 6.0 15 4.0 16 2.0 17 2.0 18 2.0 19 7.0 20 6.0 21 7.0 22 10.0 23 9.0 24 12.0 25 11.0 26 16.0 27 22.0 28 30.0 29 46.0 30 54.0 31 55.0 32 81.0 33 123.0 34 176.0 35 278.0 36 594.0 37 2421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.599999999999994 16.25 17.95 31.2 2 21.875 23.474999999999998 36.8 17.849999999999998 3 22.05 25.624999999999996 30.9 21.425 4 25.05 33.95 21.8 19.2 5 24.275 37.325 22.475 15.925 6 19.1 37.9 23.925 19.075 7 18.375 16.975 43.5 21.15 8 21.45 23.425 26.924999999999997 28.199999999999996 9 22.400000000000002 25.525 28.599999999999998 23.474999999999998 10-14 23.435 28.994999999999997 26.235000000000003 21.335 15-19 22.975 28.194999999999997 27.655 21.175 20-24 22.945 28.595 27.365000000000002 21.095 25-29 23.657160133024288 28.287816184621583 27.325405623299403 20.729618059054722 30-34 23.50671399907393 28.93965118073777 26.943458352626433 20.610176467561867 35-39 23.750886794365055 28.118982466808557 27.541299280429715 20.588831458396676 40-44 24.055 27.994999999999997 27.575 20.375 45-49 22.93 27.384999999999998 28.53 21.154999999999998 50-54 23.91 28.360000000000003 27.355 20.375 55-59 23.89 28.565 27.32 20.225 60-64 23.705000000000002 27.63 27.85 20.815 65-69 23.24 27.91 27.950000000000003 20.9 70-74 23.26 27.63 28.095 21.015 75-79 23.200000000000003 27.800000000000004 28.43 20.57 80-84 23.695 28.235 27.72 20.349999999999998 85-89 23.94 28.575 27.63 19.855 90-94 23.74 27.83 27.77 20.66 95-99 23.549999999999997 28.345 27.939999999999998 20.165 100-104 24.3 28.275 27.589999999999996 19.835 105-109 23.855 28.015 27.939999999999998 20.19 110-114 24.15 27.58 28.005000000000003 20.265 115-119 24.404999999999998 27.675 28.1 19.82 120-124 23.715 27.92 27.96 20.405 125-129 24.525 27.889999999999997 27.529999999999998 20.055 130-134 24.395 28.765 27.544999999999998 19.295 135-139 24.285 28.294999999999998 27.900000000000002 19.52 140-144 24.565 27.345000000000002 28.449999999999996 19.64 145-149 24.779999999999998 28.57 27.134999999999998 19.515 150-151 26.0375 27.400000000000002 26.075 20.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 2.0 27 3.5 28 4.0 29 6.5 30 8.0 31 14.5 32 24.0 33 29.5 34 42.0 35 55.5 36 73.0 37 107.0 38 137.0 39 163.5 40 198.0 41 240.0 42 283.5 43 303.5 44 303.5 45 303.0 46 278.0 47 249.5 48 232.5 49 205.0 50 174.0 51 136.5 52 105.0 53 76.5 54 55.5 55 42.0 56 31.5 57 29.5 58 21.5 59 15.5 60 10.5 61 7.5 62 7.0 63 3.0 64 2.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.0 70 1.0 71 2.0 72 1.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.77 30-34 2.815 35-39 1.3299999999999998 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.8500000000000001 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.3875000000000002 0.0 0.0 0.0 0.0 124-125 1.6375000000000002 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.075 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874174 spots for SRR7172710.sra Written 874174 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra Read 874161 spots for SRR7172710.sra Written 874161 spots for SRR7172710.sra SRR ids: ['SRR7172710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tjj4vi1y SRR7172710.sra spots: 17483233 blocks: [[1, 874161], [874162, 1748322], [1748323, 2622483], [2622484, 3496644], [3496645, 4370805], [4370806, 5244966], [5244967, 6119127], [6119128, 6993288], [6993289, 7867449], [7867450, 8741610], [8741611, 9615771], [9615772, 10489932], [10489933, 11364093], [11364094, 12238254], [12238255, 13112415], [13112416, 13986576], [13986577, 14860737], [14860738, 15734898], [15734899, 16609059], [16609060, 17483233]] SRR7172710 file size 5902793 SRR7172710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172710 SRR7172710_1.fastq SRR7172710_2.fastq Input file: SRR7172710_1.fastq Paired file: SRR7172710_2.fastq trimmed: SRR7172710-trimmed-pair1.fastq, SRR7172710-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:09:59 2025 >> started Mon Feb 10 16:10:18 2025 >> done (19.622s) 17483233 read pairs processed; of these: 18388 ( 0.11%) short read pairs filtered out after trimming by size control 12029 ( 0.07%) empty read pairs filtered out after trimming by size control 17452816 (99.83%) read pairs available; of these: 7691363 (44.07%) trimmed read pairs available after processing 9761453 (55.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 5 0.00% 27 2 0.00% 28 3 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 0 0.00% 33 2 0.00% 34 4 0.00% 35 3 0.00% 36 0 0.00% 37 2 0.00% 38 1 0.00% 39 6 0.00% 40 1 0.00% 41 5 0.00% 42 5 0.00% 43 4 0.00% 44 9 0.00% 45 5 0.00% 46 5 0.00% 47 8 0.00% 48 12 0.00% 49 12 0.00% 50 9 0.00% 51 8 0.00% 52 13 0.00% 53 15 0.00% 54 16 0.00% 55 17 0.00% 56 21 0.00% 57 24 0.00% 58 30 0.00% 59 35 0.00% 60 40 0.00% 61 38 0.00% 62 45 0.00% 63 53 0.00% 64 58 0.00% 65 72 0.00% 66 72 0.00% 67 76 0.00% 68 92 0.00% 69 106 0.00% 70 127 0.00% 71 121 0.00% 72 124 0.00% 73 176 0.00% 74 196 0.00% 75 227 0.00% 76 258 0.00% 77 310 0.00% 78 309 0.00% 79 380 0.00% 80 435 0.00% 81 524 0.00% 82 603 0.00% 83 750 0.00% 84 1618 0.01% 85 2357 0.01% 86 2447 0.01% 87 2783 0.02% 88 2716 0.02% 89 2781 0.02% 90 2667 0.02% 91 2783 0.02% 92 2987 0.02% 93 3170 0.02% 94 3427 0.02% 95 3560 0.02% 96 3738 0.02% 97 4031 0.02% 98 4409 0.03% 99 4780 0.03% 100 5191 0.03% 101 5738 0.03% 102 6280 0.04% 103 6742 0.04% 104 7156 0.04% 105 8035 0.05% 106 8621 0.05% 107 9526 0.05% 108 10209 0.06% 109 11050 0.06% 110 11745 0.07% 111 12744 0.07% 112 13936 0.08% 113 14673 0.08% 114 16188 0.09% 115 17476 0.10% 116 18440 0.11% 117 19213 0.11% 118 20271 0.12% 119 21351 0.12% 120 22683 0.13% 121 24258 0.14% 122 25543 0.15% 123 27603 0.16% 124 28810 0.17% 125 30285 0.17% 126 32430 0.19% 127 33935 0.19% 128 36179 0.21% 129 38387 0.22% 130 40551 0.23% 131 42592 0.24% 132 45141 0.26% 133 48471 0.28% 134 51238 0.29% 135 54938 0.31% 136 58650 0.34% 137 62554 0.36% 138 67385 0.39% 139 73173 0.42% 140 79177 0.45% 141 87993 0.50% 142 98047 0.56% 143 110889 0.64% 144 127522 0.73% 145 151868 0.87% 146 188587 1.08% 147 254290 1.46% 148 383789 2.20% 149 765070 4.38% 150 4298995 24.63% 151 9761453 55.93% 17452816 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=22 prefix-density=0.23 prefix-fanout=2.9 sequence=AAGGATCTCTCTCCTTTAACGACACCATCATTGTAAAGGAACAACTGAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=186.47 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.0 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCTGATCACAACCTGGTGGTAAAGAGCTGCAAGTGCTGCTCCAATGAAGGGGCCAACCCA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=23 prefix-density=0.22 prefix-fanout=3.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=164.14 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=28.3 sequence=TGATGAGGATGA SRR7172710 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:11:07 Started mapping on | Feb 10 16:11:07 Finished on | Feb 10 16:13:21 Mapping speed, Million of reads per hour | 468.88 Number of input reads | 17452816 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16361759 Uniquely mapped reads % | 93.75% Average mapped length | 296.56 Number of splices: Total | 16548424 Number of splices: Annotated (sjdb) | 16271266 Number of splices: GT/AG | 16300035 Number of splices: GC/AG | 200698 Number of splices: AT/AC | 11292 Number of splices: Non-canonical | 36399 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368766 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 91644 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 739473 739473 739473 N_multimapping 368766 368766 368766 N_noFeature 367316 16234425 409648 N_ambiguous 163052 880 77440 UnstrandedReadsAssigned:15831391 PositiveStrandReadsAssigned:126454 NegativeStrandReadsAssigned:15874671 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172710 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172710-trimmed-pair1.fastq SRR7172710-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,452,816 reads, 15,787,886 reads pseudoaligned [quant] estimated average fragment length: 242.398 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR7172710.ke.tsv 34699 SRR7172710.se.tsv 87100 total ==> SRR7172710.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.6 1742 58.6549 Potri.005G024800.1.v4.1 1035 793.602 1345 101.383 Potri.004G059700.1.v4.1 961 719.612 12 0.997536 Potri.007G009000.2.v4.1 1416 1174.6 0 0 Potri.003G141000.2.v4.1 2943 2701.6 937.264 20.7533 Potri.016G087400.1.v4.1 270 73.8338 1086.07 879.927 Potri.015G069301.1.v4.1 564 325.504 0 0 Potri.010G195200.1.v4.1 1773 1531.6 456.709 17.8377 Potri.012G127500.1.v4.1 977 735.602 4214 342.687 ==> SRR7172710.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 551 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 95 SRR7172710 completed mapping pipeline successfully